High-weight hermetia illucens larvae and production method and application thereof

By genetically modifying the signal protein 1a gene of black soldier fly larvae, the problem of delayed metamorphosis in larvae was solved, increasing their weight and metamorphosis ability, and enhancing their application efficiency in food, feed, and waste management.

CN120813245APending Publication Date: 2025-10-17FREEZEM CRYOGENICS LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202480015011.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-03-02
Filing Date
2024-02-29
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to produce high-quality black soldier fly larvae, resulting in delayed or inability to mature during metamorphosis, which affects their application in food, feed, and waste management.

Method used

By genetically modifying the signal protein 1a (Sema1a) gene of black soldier fly larvae, its expression and activity are reduced, prolonging the larval growth period and increasing their weight, enabling them to successfully metamorphose into adults.

Benefits of technology

This enabled black soldier fly larvae to reach a higher weight before metamorphosis, improving their efficiency in food, feed, and waste management, and enhancing their ability as a source of protein and fat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005566467410000201
    Figure BDA0005566467410000201
  • Figure BDA0005566467410000202
    Figure BDA0005566467410000202
  • Figure BDA0005566467410000211
    Figure BDA0005566467410000211
Patent Text Reader

Abstract

The present invention relates to larvae of Hermetia illucens having high weight, to methods of producing the larvae, and to the use of high weight larvae in various applications, including as food or feed, as a source of food grade ingredients comprising proteins, chitin and fat, and for converting waste into biomass.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to high weight black soldier fly larvae, to methods of their production and to the use of high weight larvae in various applications, including use as food or feed, as a source of food grade ingredients comprising proteins and fats, and for conversion of waste into biomass. BACKGROUND

[0002] Black soldier fly (BSF), i.e. Hermetia illucens (Diptera: Stratiomyidae), is a true fly of the family Stratiomyidae. BSF larvae are reared on a wide variety of organic matter and are reported to be one of the most efficient insects for converting organic waste into biomass. Thus, BSF larvae can be used for waste management and, due to their edibility, also as feed for various farm animals and as a source of food.

[0003] Korean application number KR20210157505 relates to dog food using BSF, and an apparatus and method of manufacturing the same. The system comprises a fermentation tank in which a mixture comprising BSF is subjected to microbial fermentation for a predetermined time; and an odor reducer for capturing and burning odors produced during drying or fermentation of the mixture in the fermentation tank.

[0004] Chinese application number CN109006699 discloses an ecological breeding method for treating pig manure using black soldier fly larvae. The method comprises the following steps: larvae treatment, pig manure water content treatment, and larvae inoculation and pig manure treatment steps. In the treatment, the manure is mixed with four-day-old larvae. The manure treatment process is simple, controllable, convenient for farmers to apply, and reduces the treatment cost.

[0005] Chinese application number CN107549126 discloses the use of black soldier fly larvae in waste management, in particular for treating kitchen-based waste by growing black soldier fly larvae on kitchen organic waste, thereby converting the organic waste into biomass.

[0006] For example, international PCT application publication number WO 2020 / 234884 discloses methods of modifying oil extracted from black soldier fly larvae. Applications of the modified black soldier fly larvae oil include skin and / or oral applications, topical treatments, and applications to medical devices and industrial applications.

[0007] The exceptional waste bioconversion capacity of black soldier fly larvae makes it a species with potential for large-scale production globally. Most of the food consumption and biomass accumulation is achieved in the larval stage of the fly’s life cycle. Thus, prolonging the larval stage will improve larval performance.

[0008] In insects, metamorphosis and sexual maturation require changes in the hormonal secretory activity of the steroidogenic prothoracic gland (PG). Commitment to metamorphosis is strongly dependent on the nutrition available during larval growth and on the larval body weight. Reared larvae must reach a “critical weight” to start maturation. Upon reaching the critical weight, the PG initiates a small release of the steroid prohormone, ecdysone. Days later, fluctuations in ecdysone trigger the end of feeding, initiate wandering, and entry into the pupal stage. Little is known about how body fat is perceived to trigger ecdysone release.

[0009] Zhan et al. (Zhan S et al., 2020. Cell Research 30(1): 50-60. doi:10.1038 / s41422-019-0252-6) used a CRISPR / Cas9-based gene editing approach to explore phenotypes in black soldier flies. Using this approach, they have identified a prothoracicotropic hormone (PTTH) gene mutant that has an enhanced feeding capacity phenotype. The PTTH gene is responsible for initiating a signaling cascade that peaks ecdysone biosynthesis and release, which helps to facilitate metamorphosis. However, metamorphosis in the PTTH mutant BSF larvae was significantly delayed (from 4-5 days to over 85 days), which makes this mutant unsuitable for industrial applications.

[0010] Juarez-Carreno et al. (Juarez-Carreno S et al., 2021. Cell Reports 37: 109830; doi.org / 10.1016 / j.celrep.2021.109830) conducted an RNAi screening experiment to identify genes whose silencing leads to an inability to initiate sexual maturation. Using this approach, they found that signaling and perception of fat sufficiency for sexual maturation commitment requires apolipoprotein (apolpp) in fat cells and signal protein-1a (Sema1a) in the neuroendocrine prothoracic gland (PG). RNAi silencing of Sema1a in the PG gland resulted in larvae that failed to mature and continued to feed and gain weight until death, failing to metamorphose. Activation of the PTTH / Ras pathway in the PG could not rescue the Sema1a-deficient phenotype.

[0011] Currently, there is a growing demand for high-quality BSF larvae that can sustain the natural life cycle of BSF for various applications of these larvae, and obtaining such larvae would be highly advantageous. SUMMARY

[0012] The present invention satisfies the above needs by providing high weight Black Soldier Fly (BSF) larvae that retain their ability to metamorphose into adults. The high weight BSF larvae of the present invention can be used in animal feed in their whole form, in food as a source of food grade proteins, fats, vitamins, etc., as a source of industrial ingredients such as chitin, and also in waste management, where the high weight of the larvae improves all these applications. The ability of the mutant larvae to complete the life cycle is a prerequisite for their use in large scale commercial farming.

[0013] The present invention is based, in part, on the unexpected fact that BSF larvae genetically modified to have at least one mutation in the gene encoding the axon guidance protein signal protein la (Semala) in their genome metamorphose to the pupal stage later and are significantly larger at the end of the larval stage compared to corresponding non-genetically modified wild type larvae, while showing no or negligible detrimental effects associated with the modification and retaining their ability to transform into pupae and mature into adults.

[0014] The present invention further discloses edible compositions comprising the high weight larvae of the present invention and their use as feed / food. The present invention also relates to the use of the high weight larvae as a source of nutritional ingredients including but not limited to proteins and fats. The present invention also relates to the use of the high weight larvae as a biological conversion tool in waste management applications.

[0015] According to certain aspects, the present invention provides a genetically modified Black Soldier Fly larvae (BSFL) having reduced expression and / or activity of a signal protein 1a (Sema1a) protein or homolog thereof, wherein the genetically modified larvae have a higher weight at the end of the 5th instar larval stage than corresponding non-modified BSFL raised under similar conditions and at the same larval stage.

[0016] According to certain embodiments, the genetically modified BSFL are capable of metamorphosing into pupae. According to certain embodiments, the genetically modified BSFL are capable of metamorphosing into pupae and further into adults. According to these embodiments, the adults are fertile. According to certain embodiments, the adults that mature from the genetically modified larvae have an increased weight compared to adults that mature from corresponding non-modified BSFL grown under similar conditions.

[0017] According to certain embodiments, the genetically modified BSFL metamorphose at least 1 day, at least 2 days, at least 3 days, at least 4 days or at least 5 days after the corresponding non-modified BSFL grown under similar conditions metamorphose.

[0018] According to certain embodiments, the genetically modified BSFL have a weight growth similar to that of corresponding non-modified BSFL throughout the linear growth phase.

[0019] For the purposes of the present document, the term "linear growth phase" of BSF larvae, for wild type larvae, refers to the period from about 4-5 days after hatching to about 10-14 days after hatching; for genetically modified larvae of the present application, refers to the period from 4-5 days after hatching to about 10-20 days after hatching under regular growth conditions.

[0020] As used herein, the term "regular growth conditions" refers to growth at 27-30 °C, 55-70% humidity, 50,000 larvae per square meter.

[0021] According to some embodiments, the feed conversion ratio (FCR) of the genetically modified BSFL is lower compared to the FCR of the corresponding unmodified BSFL. According to some embodiments, the FCR is lower throughout the entire growth period of the BSFL. According to some embodiments, the FCR is lower at specific stages of the growth of the BSFL. According to certain embodiments, the FCR value of the genetically modified BSFL is improved by about 10% to about 50% compared to the FCR of the corresponding unmodified BSFL. According to certain exemplary embodiments, the FCR is improved by about 15% to about 25%.

[0022] According to certain embodiments, the Sema1a protein or homolog thereof comprises an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 1.

[0023] According to certain exemplary embodiments, the Sema1a protein comprises the amino acid sequence set forth in SEQ ID NO: 1.

[0024] According to certain embodiments, the Sema1a protein is encoded by a Sema1a gene or homolog thereof having at least 85% identity to the nucleic acid sequence set forth between positions 159,092,514 to 159,592,196 of the nucleotide sequence set forth in NCBI Reference Sequence NC_051851.1. According to these embodiments, the nucleic acid sequence of the genomic sequence encoding the Sema1a protein comprises 499,683 base pairs (bps).

[0025] According to certain embodiments, the Sema1a gene comprises the nucleic acid sequence set forth between positions 159,092,514 to 159,592,196 of NCBI Reference Sequence NC_051851.1.

[0026] According to certain embodiments, the Sema1a protein is encoded by a nucleic acid sequence having at least 85% identity to the nucleic acid sequence set forth in SEQ ID NO: 2.

[0027] According to some embodiments, the Sema1a protein is encoded by the nucleic acid sequence set forth in SEQ ID NO: 2.

[0028] According to certain embodiments, the genetically modified BSFL comprises at least one mutant allele of a Sema1a gene or homolog thereof within its genome.

[0029] According to certain embodiments, the mutant allele of Sema1a or homolog thereof comprises at least one mutation. According to certain embodiments, the mutant allele of Sema1a is designated herein as Sema1a mut .

[0030] According to certain embodiments, the Sema1a mut allele or homolog thereof comprises a single mutation. According to certain embodiments, the Sema1a mut allele or homolog thereof comprises multiple mutations.

[0031] According to certain embodiments, the Sema1a mut allele or homolog thereof results in a reduced or loss of function of the encoded Sema1A protein.

[0032] Any mutation can be inserted into the polynucleotide encoding Sema1a or homolog thereof, including deletions, insertions, insertion-deletion mutations (indels), site-specific mutations including nucleotide substitutions, and the like, so long as the mutations result in downregulation of the gene expression, and a reduction in expression of the Sema1a protein, and / or production of a protein or homolog thereof with reduced or no function.

[0033] According to certain embodiments, the Sema1a mut allele or homolog thereof comprises a mutation in its Sema domain. According to certain embodiments, the Sema1a mut allele or homolog thereof comprises a mutation outside of its Sema domain.

[0034] According to certain exemplary embodiments, the at least one mutation within the at least one allele is a deletion mutation. According to further exemplary embodiments, the at least one deletion comprises an exon or a portion thereof. According to further certain exemplary embodiments, the at least one mutation within the at least one allele is a deletion mutation that results in a premature stop codon.

[0035] According to certain exemplary embodiments, the Sema1a mutThe at least one mutation in the allele is a deletion within the genomic sequence encoding the Sema1a protein. According to certain exemplary embodiments, the deletion is a deletion of 50987 nucleotides from position 159,121,513 to position 159,172,499 on the nucleic acid sequence set forth in NCBI Reference Sequence NC_051851.1.

[0036] According to certain exemplary embodiments, the Sema1a mut The allele comprises the nucleic acid sequence set forth in SEQ ID NO: 3.

[0037] According to certain embodiments, the Sema1a mut The at least one mutation in the allele is a deletion within the coding sequence of the Semala gene (SEQ ID NO: 2). According to further certain exemplary embodiments, the at least one mutation is a deletion of the nucleotide A (adenine) at position 80 of the nucleic acid sequence set forth in SEQ ID NO: 2. According to these embodiments, the Sema1a mut The allele comprises the nucleic acid sequence set forth in SEQ ID NO: 8.

[0038] According to some additional exemplary embodiments, the at least one mutation is a deletion of 10 nucleotides (CCTCGGAAAT) at positions 72 to 81 of the nucleic acid sequence set forth in SEQ ID NO: 2. According to these embodiments, the Sema1a mut The allele comprises the nucleic acid sequence set forth in SEQ ID NO: 9.

[0039] According to some embodiments, the genetically modified BSFL is heterozygous for Sema1a mut The allele.

[0040] According to some embodiments, the genetically modified BSFL is homozygous for Sema1a mut The allele.

[0041] Any mutagenesis method known in the art and suitable for use with black soldier flies (BSF) can be used in accordance with the teachings of the present application. Mutagenesis methods include, but are not limited to, chemical mutagenesis, radiation mutagenesis, and site-directed mutagenesis, for example using genome editing techniques.

[0042] According to certain embodiments, the mutation is a site-directed mutation produced by a method selected from, but not limited to, site-directed plasmid mutagenesis and gene editing methods using artificially designed nucleases.

[0043] According to certain embodiments, the artificially designed nuclease is selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas, CRISPR / Cas homologs, and modified CRISPR / Cas systems.

[0044] The generation of site-directed mutations, in particular using gene editing systems, has the advantage of a mutagenesis tool that can be designed without off-target effects.

[0045] According to certain exemplary embodiments, therefore, the genetically modified BSFL having a higher weight compared to unmodified BSFL in the present application are obtained by generating mutations within at least one Semala allele using the CRISPR / Cas system.

[0046] According to certain embodiments, the genetically modified BSFL have a weight that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50% or more higher compared to the weight of a corresponding unmodified BSFL.

[0047] According to certain embodiments, the genetically modified BSFL have a protein content comprising at least 10% by weight, at least 20% by weight, at least 30% by weight, at least 40% by weight, at least 50% by weight (% w / w) or more of protein based on the total weight of the BSFL.

[0048] According to certain exemplary embodiments, the genetically modified BSFL comprise between about 25% and about 50% by weight of protein based on the total weight of the BSFL.

[0049] According to certain embodiments, the genetically modified BSFL comprise at least 10% by weight, at least 20% by weight, at least 30% by weight, at least 40% by weight, at least 50% by weight or more of fat based on the total weight of the BSFL.

[0050] According to certain exemplary embodiments, the genetically modified BSFL comprise between about 25% and about 50% by weight of fat based on the total weight of the BSFL.

[0051] According to certain additional aspects, the present application provides an edible composition comprising a plurality of genetically modified BSFL of the present application and / or portions thereof. According to certain embodiments, the edible composition further comprises at least one food grade excipient or carrier.

[0052] According to certain embodiments, the edible composition comprises at least one additional nutritional ingredient selected from at least one food-grade protein and / or amino acid, at least one food-grade carbohydrate, at least one food-grade fatty acid, and any combination thereof. Each possibility represents a separate embodiment of the present invention.

[0053] According to certain embodiments, the edible composition comprises the genetically modified BSFL or a portion thereof in a form selected from the group consisting of a living form, a dried form, and combinations thereof. Each possibility represents a separate embodiment of the present invention.

[0054] According to certain embodiments, the dried genetically modified BSFL is in a form selected from the group consisting of a whole larvae form and a larvae powder form.

[0055] According to certain embodiments, the dried genetically modified BSFL has been defatted.

[0056] According to certain embodiments, the edible composition is used to feed a non-human animal. According to certain embodiments, the non-human animal is selected from terrestrial animals and aquatic animals. According to certain embodiments, the aquatic animal is selected from fish and crustaceans. According to certain embodiments, the terrestrial animal is selected from birds, reptiles, and mammalian farm animals. According to certain embodiments, the animal is an insect.

[0057] According to certain embodiments, the edible composition is a food for humans.

[0058] According to these embodiments, the plurality of genetically modified BSFLs are in a dried form.

[0059] According to a further aspect, the present invention provides a method for producing high-weight BSFL, comprising reducing the expression and / or activity of Sema1a protein in at least one cell of the BSFL. According to certain embodiments, the BSFL obtained by this method has a higher weight than a corresponding BSFL in which the expression and / or activity of Sema1a protein is not modified.

[0060] According to certain embodiments, the method comprises generating at least one mutation in at least one wild-type allele of Sema1a to form Sema1a1 mut Allele, wherein the at least one mutation causes the encoded Sema1a protein to lose function, reduce function or abnormal function.

[0061] The wild-type Sema1a protein, the gene encoding the protein, and the method for generating at least one mutation are as described above.

[0062] According to certain exemplary embodiments, the at least one mutation is induced by genome editing using the CRISPR / Cas system.

[0063] Also encompassed herein are BSFL and portions thereof produced by the methods of the present application.

[0064] According to yet further aspects, the present application provides a composition comprising at least one component derived from a genetically modified BSFL of the present application, wherein the at least one component is selected from the group consisting of a protein component, a fat component, a vitamin and mineral component, a chitinous component, and any combination thereof.

[0065] According to certain embodiments, the mineral component is an aqueous component.

[0066] Any method known in the art for obtaining a protein component, a fat component, or an aqueous component containing vitamins, chitinous components, and for obtaining isolated proteins and / or components thereof, fats and / or components thereof, and / or vitamins and / or minerals can be used in accordance with the teachings of the present application.

[0067] According to yet further aspects, the present application provides a method of converting organic waste into biomass, the method comprising providing organic waste as the sole source of nutrition to a plurality of BSFL of the present application.

[0068] According to certain embodiments, the organic waste is household organic waste. According to certain additional or alternative embodiments, the organic waste is agricultural waste.

[0069] According to certain embodiments, the method further comprises the step of separating non-organic compounds and / or toxic compounds from the organic waste.

[0070] According to certain embodiments, the method results in a weight increase of at least 25%, at least 50%, at least 100%, at least 150%, at least 200%, at least 250% or more from the average initial weight of the plurality of genetically modified BSFL.

[0071] It is to be understood that any combination of the various aspects and embodiments disclosed herein are expressly encompassed by the disclosure of the present application.

[0072] Further embodiments, as well as the full scope of applicability of the present application, will become apparent from the detailed description given herein. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the application, are given by way of illustration only, since various changes and modifications within the scope and spirit of the application concepts disclosed herein will become apparent to one of ordinary skill in the art from this detailed description. BRIEF DESCRIPTION OF DRAWINGS

[0073] Figure 1 shows the generation of a signal protein 1A (Semala) deletion mutation. Figure 1ASchematic diagram of the exon / intron structure of the Semala gene in the Hermetia illucens soldier fly. Exons are boxed; introns are thin lines. The positions of the guide RNAs (gRNAs) are annotated, and the protospacer adjacent motif (PAM) site is in bold. Deletions are indicated by double-headed arrows. The total length of the deletion is 50,987 bp, and the distance between the gRNAs is 50,961 bp. Figure 1B The target locus in the Sema1a gene and the deletion in the mutant lines are shown.

[0074] Figure 2 Shown are mutations created using the CRISPR-Cas9 system with sgRNA sgD (SEQ ID NO: 13).

[0075] Figure 3 Shown are mutations created using the CRISPR-Cas9 system with sgRNA sgA (SEQ ID NO: 12).

[0076] FIG4 is a schematic diagram of deletion mutations in the Sema1a coding region and the resulting non-functional protein. Figure 4A :Schematic diagram of Sema1a mRNA. Figure 4B : The mutation position on SEQ ID NO:2. Figure 4C :Depend on Figure 4B Schematic diagram of the premature stop codon in the Sema1a protein caused by the indicated mutations. Numbers and single letters represent the amino acid positions in SEQ ID NO: 2. Three-letter groups represent the codons encoding the respective amino acids. * indicates a stop codon.

[0077] Figure 5 shows Sema1a mut Phenotypic characteristics. Figure 5A : Shown are the Sema1a mutant larval population and the control population at day 16 after hatching from eggs. Figure 5B : Representative CRISPR mutant larvae of the Semala gene and wild-type (WT) control larvae at day 14 after hatching from eggs. Figure 5C : Average larval weights of WT controls and Sema1a mutants (n=30; mean±SEM). Figure 5D : Time course of larval weight changes of control and Sema1a mutants during days 6–14 after hatching from eggs. Figure 5E : Representative CRISPR mutant flies of the Sema1a gene and WT control flies (top). mut Body parts compared to wild-type flies: wings, metathoracic right leg, and head (bottom). Figure 5F : Weight of flies expressing CRISPR mutants of the Sema1a gene compared to wild-type controls.

[0078] Figure 6 Weight gain of "Tian" mutant larvae (larvae comprising Sema1a mut ) versus wild type (WT) larvae until melanization.

[0079] Figure 7 Representative pictures of wild type (WT) versus mutant larvae (larvae comprising Sema1a mut allele with SEQ ID NO: 9) until the melanization point. Days - days after hatching from the egg.

[0080] Figure 8 Percentage of larvae reaching melanization of wild type (WT) versus "Tian" mutant larvae (larvae comprising Sema1a mut allele with SEQ ID NO: 9). DETAILED DESCRIPTION

[0081] The present invention relates to the technical field of insect rearing and uses, in particular to the production of Black Soldier Fly (BSF) larvae having at least one mutation in the gene Semala encoding a signal protein or a homolog thereof, which are capable of reaching a high weight before metamorphosis into pupae and, in turn, into reproductive, high weight adults. The genetically modified BSF larvae of the present invention exhibit an improved feed conversion rate (FCR) compared to corresponding unmodified BSF larvae grown under the same conditions and comparable protein, fat and chitin distribution as corresponding larvae expressing wild type Semala.

[0082] The genetically modified BSF larvae of the present invention can be used for all known and future known uses of insect larvae, including as animal feed, as an ingredient in animal feed or human food compositions, as a source of nutritional ingredients including in particular protein, fat, minerals and vitamins, as a waste management formulation, and for rearing adult BSF flies.

[0083] Definitions

[0084] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0085] "comprise," "comprising," and the like are to be construed in an inclusive sense, as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to" unless specifically so stated.

[0086] As used in relation to the weight of larvae, the term "weight" refers to the live wet weight of larvae at a specified number of days post-oviposition / hatching.

[0087] As used herein, the term "about" is understood to be within the normal range of variation in the art, for example within 2 standard deviations of the mean. "About" can be understood to be within + / - 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. All numerical values provided herein are to be understood to be modified by the term "about".

[0088] As used herein, the term "unmodified BSF larvae" refers to larvae of BSF flies whose expression of endogenous Sema1a protein or homolog thereof has not been artificially modified. According to certain exemplary embodiments, unmodified BSF larvae express wild-type Sema1a protein or homolog thereof having an amino acid sequence which is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the amino acid sequence set forth in SEQ ID NO: 1.

[0089] The genomic sequence encoding wild-type BSF Sema1a protein comprises 499,683 base pairs (bp) between positions 159,092,514 and 159,592,196 in the nucleic acid sequence set forth in NCBI Reference Sequence NC_051851.1 (designated as SEQ ID NO: 2 in Israeli Patent Application No. 301082, which is a priority document of the present application).

[0090] According to certain embodiments, the wild-type Sema1a protein or homolog thereof is encoded by a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity to the amino acid sequence set forth in SEQ ID NO: 2 (cDNA coding sequence).

[0091] It is expressly understood that "unmodified BSFL" can comprise other modifications, for example modifications in the expression and / or activity of proteins other than Sema1a. According to certain embodiments, the term "corresponding" in relation to BSFL refers to larvae of the same species of BSF.

[0092] Homology (e.g., percent homology, sequence identity + sequence similarity) can be determined using any homology comparison software that calculates the homology of a pair of sequences.

[0093] As used herein, in the context of two nucleic acid or polypeptide sequences, "sequence identity" or "identity" includes residues in the two sequences that are the same after alignment. When percent sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, i.e., substitutions of a residue by another residue that has similar chemical properties (e.g., charge or hydrophobicity) and therefore does not significantly change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are considered to have "sequence similarity" or "similarity". Methods of making this adjustment are well known to those of ordinary skill in the art. Usually, this involves recognizing that not all conservative substitutions affect function. If all conservative substitutions are given a weight of 1, then the percent sequence identity is simply the number of identical positions divided by the total number of positions. If conservative substitutions are given a weight of 0.5, then the percent sequence identity is higher. For example, if identical residues are given a score of 1 and non-conservative substitutions are given a score of 0, then a conservative substitution would be given a score of 0.5. The score for a conservative substitution can be calculated, for example, according to the algorithm of Henikoff S and Henikoff JG (Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 89(22), 10915-9, 1992).

[0094] Identity (e.g., percent homology) can be determined using any homology comparison software, including, for example, the BlastN, BlastX or Blastp software of the National Center for Biotechnology Information (NCBI), which can be determined by using default parameters.

[0095] According to some embodiments of the application, the identity is global identity, i.e., identity to the entire amino acid or nucleic acid sequence of the application, and not identity to a portion of the amino acid or nucleic acid sequence of the application.

[0096] According to some embodiments of the application, the term "homology" or "homologous" refers to identity of two or more nucleic acid sequences; or identity of two or more amino acid sequences; or identity of an amino acid sequence to one or more nucleic acid sequences.

[0097] The term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises a coding sequence required for the production of an RNA or polypeptide. The polypeptide can be encoded by the full-length coding sequence or any portion thereof. In reference to a gene, the term "a portion thereof" refers to a fragment of the gene. The fragments can range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, a "nucleic acid sequence comprising at least a portion of a gene" can comprise a fragment of the gene or the entire gene.

[0098] The term "gene" also encompasses the coding region of a structural gene, and also includes sequences located on both the 5' and 3' ends of the coding region, extending from about 1 kb on either end, such that the gene corresponds to the length of the pre-mRNA transcript. The sequences that are present on the pre-mRNA, which are located just upstream of the translational start at the 5' end and just downstream of the translational end at the 3' end are referred to as 5' and 3' untranslated sequences, respectively. It is expressly understood that "Sema1a allele" and "Sema1a mutant allele (Sema1a mut )" encompass genomic sequences as well as mRNA that encode wild-type or mutant Sema1a proteins.

[0099] The terms "polynucleotide", "polynucleotide sequence", "nucleic acid sequence", and "isolated polynucleotide" are used interchangeably herein. These terms encompass isolated nucleotide sequences and the like. A polynucleotide can be a polymer of RNA or DNA, or a hybrid thereof, which can be single-stranded or double-stranded, linear or branched, and which can optionally contain synthetic, non-natural or modified nucleotide bases. These terms also encompass RNA / DNA hybrids.

[0100] For the purposes herein, the term "a plurality" means at least two. According to certain embodiments of the application, the Sema1a mut The plurality of mutations within the allele includes two, three, four, five, six or more mutations. Each possibility represents a separate embodiment of the application.

[0101] According to certain aspects, the application provides a genetically modified Black Soldier Fly Larva (BSFL) having reduced expression and / or activity of a Semaphorin 1a (Sema1a) protein or a homolog thereof, wherein the genetically modified BSFL has a weight at the end of the 5th instar larval stage that is higher than the weight of a corresponding unmodified BSFL grown under the same conditions and at the same developmental stage.

[0102] Semaphorins are a family of glycoproteins whose members are modulating molecules in neural system development and axon guidance. They also play important roles in other biological processes such as angiogenesis, immune regulation, and the respiratory system. Known Sema1a mutant phenotypes are mainly derived from neural system defects such as abnormal motor behavior and abnormal neuroanatomy (e.g., Shen HC et al. 2017. PLOS Genetics

[0103] 13(4):el006751. doi.org / 10.1371 / journal.pgen.1006751; Hernandez-Fleming M et al., 2017, Cell Reports 18: 174-184; Cafferty P et al. 2006. The Journal of Neuroscience, 26(15):3999-4003).

[0104] According to certain embodiments, the signal protein protein according to the teachings of the present application is a signal protein of Scaptodroma guttata or a homolog thereof.

[0105] According to certain embodiments, the signal protein of Scaptodroma guttata comprises the amino acid sequence set forth in SEQ ID NO: 1 (NCBI Reference Sequence: XP_037911809.1).

[0106] For the purposes of the present text, expression and / or activity of a Semala protein is considered to be “reduced”, “inhibited”, “down-regulated”, “knocked out” or “knocked down” if the level of the Semala-encoding gene, the level of the encoded protein or the measured protein activity is reduced by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, to 96%, at least 97%, at least 98%, at least 99% or more compared to the level in a corresponding cell or BSF larva which has not been genetically modified according to the teachings of the present application. It is expressly understood that “reduced activity” encompasses expression of aberrant and / or modified proteins which result in reduced, lost or aberrant function of the Semala protein.

[0107] According to certain embodiments, the reduction of expression and / or activity of a Semala protein does not negatively affect larval maturation.

[0108] Growth of wild-type BSF larvae typically comprises three phases, a first phase of slow growth rate (up to 4-5 day old larvae, or about 5 mg in weight), a second phase of rapid linear growth (from 4-5 day old to 10-14 day old, from about 5 mg to about 200 mg), and a third phase of growth arrest (after the rapid linear growth), during which the larvae turn black. The genetically modified BSFL of the present application of high weight exhibit a second phase of linear growth of 10-20 days, starting from an initial weight of about 5 mg, reaching a weight of about 350 mg or more at the end of the linear phase.

[0109] According to certain embodiments, the genetically modified BSFL of the present application have a weight of about 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, about 350 mg or more at the end of the linear phase.

[0110] According to certain embodiments, the genetically modified BSFL of the present application have a weight that is comparable or higher than the weight of a corresponding unmodified BSFL throughout the entire growth cycle of the larvae.

[0111] According to certain alternative embodiments, the genetically modified BSFL have a weight that is comparable or higher than the weight of a corresponding unmodified BSFL during the linear growth phase of the larvae.

[0112] According to certain embodiments, the genetically modified BSFL of the present application have a weight that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65% or more higher than the weight of a corresponding unmodified BSFL grown under similar conditions and at the same number of days post-egg hatch.

[0113] According to certain exemplary embodiments, the genetically modified BSFL of the present application have a weight that is about 40% to about 60% higher than the weight of a corresponding unmodified BSFL.

[0114] Feed conversion ratio (FCR) is a conventional measure of production efficiency, involving the conversion of consumed feed (input) to desired output. FCR for BSFL is the weight of ingested feed divided by the weight of larval weight gain.

[0115] According to certain embodiments, the genetically modified BSFL have a feed conversion ratio (FCR) value that is lower than the FCR value of a corresponding unmodified BSFL. According to some embodiments, the FCR is lower throughout the entire growth cycle of the BSFL. According to some embodiments, the FCR is lower at a particular phase of growth of the BSFL. According to some embodiments, the FCR is lower during the linear growth phase.

[0116] According to certain embodiments, the genetically modified BSFL of the present application have a FCR value that is about 10% to about 50% lower than the FCR value of a corresponding unmodified BSFL. According to some embodiments, the genetically modified BSFL have a FCR value that is about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, or about 25% lower than the FCR value of a corresponding unmodified BSFL.

[0117] According to certain embodiments, the genetically modified BSFL have a shorter overall growth cycle from hatching to the industrial harvest stage as compared to the growth cycle of a corresponding unmodified larva. According to certain embodiments, the genetically modified BSFL have an overall growth cycle that is at least 1 day shorter, at least 2 days shorter, at least 3 days shorter, at least 4 days shorter, or at least 5 days shorter from oviposition to the industrial harvest stage. Each possibility represents a separate embodiment of the present application.

[0118] The industrial harvest stage generally refers to the stage at which a wild type larva reaches a weight of about 150-180 mg. It is expressly understood that the genetically modified larvae of the present application can further grow and reach a weight of more than 180 mg, typically about 250 mg to 300 mg, before entering the growth arrest stage and being harvested.

[0119] According to certain embodiments, the genetically modified BSFL are capable of metamorphosing into a pupa. According to certain embodiments, the genetically modified BSFL are capable of metamorphosing into a pupa and then into an adult. According to these embodiments, the adult is capable of reproduction. The ability of the genetically modified BSFL of the present application to complete the life cycle up to the ability to reproduce as an adult is of great significance in the commercial rearing of the larvae of the present application.

[0120] According to certain embodiments, the adult that matures from the genetically modified larvae has an increased weight as compared to the adult that matures from a corresponding unmodified BSFL grown under the same conditions.

[0121] According to certain embodiments, the genetically modified BSFL metamorphose at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, or at least 6 days after the corresponding unmodified larvae metamorphose. Each possibility represents a separate embodiment of the present application.

[0122] According to certain embodiments, the weight of the adult insect that matures from the genetically modified BSFL of the present application is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or more, higher than the weight of the corresponding unmodified BSFL adult insect that matures under the same conditions and at the same age post-hatching.

[0123] According to certain exemplary embodiments, the weight of the adult insect that matures from the genetically modified BSFL of the present application is from about 20% to about 80% higher than the weight of the corresponding unmodified BSFL.

[0124] According to certain exemplary embodiments, the weight of the adult insect that matures from the genetically modified BSFL of the present application is from about 30% to about 50% higher than the weight of the corresponding unmodified BSFL.

[0125] According to certain embodiments, the Semala protein or homolog thereof comprises an amino acid sequence that is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or identical to SEQ ID NO: 1.

[0126] According to certain embodiments, the Semala protein or homolog thereof is encoded by a polynucleotide comprising a nucleic acid sequence that is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical or identical to SEQ ID NO: 2.

[0127] Any mutation can be introduced into the polynucleotide encoding the Semala protein or homolog thereof, including deletions, insertions, indels, site-specific mutations including nucleotide substitutions, as long as these mutations result in down-regulation of gene expression, or produce a less functional or non-functional protein.

[0128] According to the teachings of the present application, any mutagenesis method known in the art can be employed, including chemical mutagenesis, radiation mutagenesis, and site-directed mutagenesis, for example using genome editing techniques.

[0129] According to certain current exemplary embodiments, the mutant BSF larvae of the present application are generated by inserting mutations in the Semala gene using the CRISPR / Cas system, the CRISPR / Cas homologous system and the CRISPR / Cas modified system.

[0130] The Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) / Cas system is known in the art and was designed for directed genome editing. Cas genes encode RNA-guided DNA endonucleases that are able to introduce double-strand breaks in double-stranded nucleic acid sequences. With the help of single guide RNA (sgRNA) and a tracer cell mechanism, Cas enzymes can be guided for making double-strand breaks at target sites within a gene.

[0131] The CRISPR / Cas system for genome editing comprises two different components: gRNA (guide RNA) and an endonuclease, such as Cas9.

[0132] The gRNA is usually a 20-nucleotide sequence that encodes, in a single chimeric transcript, the combination of a target homologous sequence (crRNA) and an endogenous bacterial RNA (tracrRNA) that links the crRNA to the Cas9 nuclease. The gRNA / Cas9 complex is recruited to the target sequence by base pairing between the gRNA sequence and the complementary genomic DNA. For Cas9 to bind successfully, the genomic target sequence must also contain the correct protospacer adjacent motif (PAM) sequence next to the target sequence. Binding of the gRNA / Cas9 complex localizes Cas9 to the genomic target sequence, so that Cas9 can cut both strands of the DNA, creating a double-strand break. Like other genome-editing nucleases, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the double-strand breaks created by CRISPR / Cas can undergo homologous recombination or non-homologous end joining (NHEJ).

[0133] The Cas9 nuclease has two functional domains: RuvC and HNH, each domain cleaving a different DNA strand. When both domains are active, Cas9 creates a double-strand break in the genomic DNA.

[0134] A significant advantage of CRISPR / Cas is that the system is highly efficient combined with the ability to easily construct synthetic gRNAs that can target multiple genes simultaneously. In addition, most cells carrying mutations present bi-allelic mutations in the target gene.

[0135] However, the apparent flexibility of the base-pairing interaction between the gRNA sequence and the genomic DNA target sequence can allow for imperfect matches to the target sequence to be cleaved by Cas9.

[0136] Modified versions of Cas9 enzymes containing a single inactive catalytic domain (RuvC or HNH) are referred to as "nickases." Because there is only one active nuclease domain, Cas9 nickases cut only one strand of the target DNA, creating a single-stranded break or "nick." Single-stranded breaks or nicks are typically repaired quickly using the intact complementary DNA strand as a template by the HDR pathway. However, two adjacent, opposite-strand nicks introduced by a Cas9 nickase are treated as a double-stranded break, which is often referred to as a "double-nick" CRISPR system. Double-nicks can be repaired by NHEJ or homology-directed repair (HDR), depending on the intended effect on the genetic target. Thus, if specificity and reduced off-target effects are critical, the use of Cas9 nickases to create double-nicks by designing target sequences with very close proximity and two gRNAs on opposite strands of genomic DNA can reduce off-target effects because either gRNA alone creates a nick that does not alter the genomic DNA.

[0137] Modified versions of Cas9 enzymes containing two inactive catalytic domains (dead Cas9, or dCas9) have no nuclease activity, but can still bind to DNA based on gRNA specificity. dCas9 can be used as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, dCas9 alone binding to a target sequence in genomic DNA can interfere with gene transcription.

[0138] A variety of publicly available tools are available to assist in selecting and / or designing target sequences and biologically information-determined unique gRNA lists for different genes in different species, such as Target Finder by the Feng Zhang lab, Target Finder (E-CRISP) by the Michael Boutros lab, RGEN Tools: Cas-OFFinder, CasFinder: a flexible algorithm for identifying specific Cas9 targets in genomes, and CRISPR Optimal Target Finder.

[0139] To use the CRISPR system, the gRNA and Cas9 should be expressed in the target cell. The insertion vector can contain both cassettes on a single plasmid, or the two cassettes are expressed from two independent plasmids.

[0140] Meltzer et al. (Meltzer H et al., 2019. Nat Commun 10: 2113. doi.org / 10.1038 / s41467-019-10140-0) characterized tissue-specific (ts) CRISPR in the complex neuronal system of Drosophila mushroom bodies. The generation of a library of plasmids expressing gRNAs using an optimization tool and the application of this library in large-scale in vivo screens in Drosophila strains was described.

[0141] According to certain embodiments, reducing the expression and / or activity of the Semala protein can be achieved by methods other than silencing the expression of the Semala gene with an RNA inhibitory molecule.

[0142] According to certain embodiments, reducing the expression and / or activity of the Semala protein is achieved by silencing the expression of the Semala gene with an RNA inhibitory molecule.

[0143] According to certain exemplary embodiments, the at least one mutation in the at least one allele is a deletion mutation. According to further exemplary embodiments, the at least one deletion comprises an exon or a portion thereof.

[0144] According to certain exemplary embodiments, the Sema1a mut allele comprises the nucleic acid sequence set forth in SEQ ID NO: 3.

[0145] Any method known in the art for identifying BSF larvae or BSF adults comprising a mutant Semala-encoding gene can be used according to the teachings of the present application. According to certain current exemplary embodiments, the Sema1a mut allele is identified using a primer pair comprising SEQ ID NO: 4 (GAGGAGGCCAACTAACAGTTCC) and SEQ ID NO: 5 (TGGGCCAATTCCTTATGGAG) to amplify a fragment of about 400 bp.

[0146] According to certain embodiments, the at least one mutation in the Sema1a mut allele is a deletion within the coding sequence of the Semala gene (SEQ ID NO: 2).

[0147] According to certain embodiments, the deletion mutation results in a premature stop codon. A variety of mutation types can result in a premature stop codon, including point mutations and frameshift mutations. The presence of a new stop codon results in the production of a shortened protein. According to embodiments of the present application, the shortened protein has reduced or no function.

[0148] According to further certain exemplary embodiments, the at least one mutation is a deletion of the nucleotide A (adenine) at position 80 of the nucleic acid sequence set forth in SEQ ID NO: 2. According to these embodiments, Sema1a mut the allele comprises the nucleic acid sequence set forth in SEQ ID NO: 8.

[0149] According to further certain exemplary embodiments, the at least one mutation is a deletion of the 10 nucleotides (CCTCGGAAAT) at positions 72-81 of the nucleic acid sequence set forth in SEQ ID NO: 2. According to these embodiments, Sema1a mut the allele comprises the nucleic acid sequence set forth in SEQ ID NO: 9.

[0150] According to some embodiments, the genetically modified BSFL is heterozygous for Sema1a mut the allele.

[0151] According to some embodiments, the genetically modified BSFL is homozygous for Sema1a mut the allele.

[0152] According to certain exemplary embodiments, the mutant Sema1a gene of the present application is ubiquitously expressed in the tissues of the BSFL (i.e., expression is not tissue dependent).

[0153] According to certain embodiments, the genetically modified BSFL comprises at least about 10 wt.%, at least about 15 wt.%, at least about 20 wt.%, at least about 25 wt.%, at least about 30 wt.%, at least about 35 wt.%, at least about 40 wt.%, at least about 45 wt.%, at least about 50 wt.%, at least about 55 wt.% or more protein, based on the total weight of the BSFL, on a dry weight basis.

[0154] According to certain exemplary embodiments, the genetically modified BSFL comprises about 25 wt.% to about 50 wt.% protein, based on the total weight of the BSFL, on a dry weight basis. According to certain further exemplary embodiments, the genetically modified BSFL comprises about 30 wt.% to about 45 wt.% protein, based on the total weight of the BSFL, on a dry weight basis.

[0155] According to certain embodiments, the genetically modified BSFL comprises at least about 10 wt.%, at least about 15 wt.%, at least about 20 wt.%, at least about 25 wt.%, at least about 30 wt.%, at least about 35 wt.%, at least about 40 wt.%, at least about 45 wt.%, at least about 50 wt.% fat, based on the total weight of the BSFL, on a dry weight basis.

[0156] According to certain exemplary embodiments, the genetically modified BSFL comprises, on a dry weight basis, from about 20% to about 50% fat by weight based on the total weight of the BSFL. According to certain further exemplary embodiments, the genetically modified BSFL comprises, on a dry weight basis, from about 25% to about 40% fat by weight based on the total weight of the BSFL.

[0157] According to certain aspects, the present application provides at least one component derived from a plurality of genetically modified BSFL of the present application, or a composition comprising the same.

[0158] According to certain embodiments, the at least one component is selected from the group consisting of a protein component, a fat component, a vitamin and mineral containing aqueous component, a chitinous component, and any combination thereof.

[0159] Methods for extracting proteins, oils, chitins, or vitamin and mineral containing aqueous components from BSFL are known in the art.

[0160] According to certain additional aspects, the present application provides an edible composition comprising a plurality of genetically modified BSFL of the present application and / or portions thereof.

[0161] According to certain embodiments, the edible composition further comprises at least one food grade excipient or carrier.

[0162] According to certain embodiments, the edible composition comprises at least one additional nutritional ingredient selected from the group consisting of at least one food grade protein and / or amino acid, at least one food grade carbohydrate, at least one food grade fatty acid, and any combination thereof.

[0163] According to certain embodiments, the edible composition comprises genetically modified BSFL or portions thereof in a form selected from the group consisting of live form, dried form, and combinations thereof.

[0164] According to certain embodiments, the dried genetically modified BSFL is in a form selected from the group consisting of whole larvae and larval powder.

[0165] According to certain embodiments, the dried genetically modified BSFL is defatted.

[0166] According to certain embodiments, the edible composition is for feeding a non-human animal. According to certain embodiments, the non-human animal is selected from the group consisting of terrestrial animals and aquatic animals. According to certain embodiments, the aquatic animal is selected from the group consisting of fish and crustaceans. According to certain embodiments, the terrestrial animal is selected from the group consisting of avian, reptilian, and mammalian farm animals. According to certain embodiments, the animal is an insect. According to certain embodiments, the edible composition is a human food. According to these embodiments, the plurality of genetically modified BSFL is in a dried form.

[0167] According to a further aspect, the present application provides a method of producing a high weight BSFL, the method comprising reducing expression and / or activity of at least one Semala protein within a cell of the BSFL. According to certain embodiments, the method results in a BSFL having a higher weight as compared to a corresponding BSFL having an unmodified expression and / or activity of the Semala protein.

[0168] According to certain embodiments, the method comprises introducing at least one mutation in at least one wild-type allele of Semala to form a Semala1 mut allele, wherein the at least one mutation results in a loss-of-function, a reduced-function, or a gain-of-function of the encoded Semala protein.

[0169] The wild-type Semala protein, the gene encoding the protein, and the method of generating at least one of the above mutations are as described hereinabove.

[0170] The following examples are intended to be more fully understood by the following description. They are not intended to limit the broad scope of the present application in any way. Many alterations and modifications will become apparent to those skilled in the art without departing from the scope of the present application.

[0171] Example

[0172] Example 1: Sema1a mut production

[0173] Mutagenesis of BSF Semala-I

[0174] Based on BLAST sequence identity (based on the nucleic acid sequence shown in NCBI Reference Sequence NC_051851.1), two sgRNA targeting sites were identified, named gRNA1 (or sgC, CCAGAATTACATCCGCACCA, SEQ ID NO: 10) and gRNA2 (or sgB, TCAGACAATGAATTATATTC, SEQ ID NO: 11). All gRNA templates described in this study were chemically synthesized guide RNAs produced by Integrated DNA Technologies (IDT, Coralville, IA, USA). Cas9 protein was also purchased from IDT. Fertilized eggs were collected at oviposition and incubated at 30°C. Cas9 protein was microinjected into the eggs with gRNA1 and gRNA2 molecules. Injected eggs were incubated at 30°C in a humidified chamber for 3-4 days until hatching. Hatched larvae were reared on chicken feed containing 19% protein at 28°C. To identify somatic mutations, first instar larvae were selected for preparation of genomic DNA. A fragment covering both targeting sites was amplified with primers gRNA1 F (SEQ ID NO: 4, GAGGAGGCCAACTAACAGTTCC) and gRNA2 R (SEQ ID NO: 5, TGGGCCAATTCCTTATGGAG). Amplified fragments were sequenced on the Sanger platform. Wild-type alleles were amplified with primer pair gRNA1 F (SEQ ID NO: 4) and gRNA1 R (SEQ ID NO: 6, GCCTCAAGGGAGTAGTTGTTTGC), or primer pair gRNA2 F (SEQ ID NO: 7, CTGGCTGTGCGCTCATATCTAG) and SEQ ID NO: 5.

[0175] Using the CRISPR / Cas9 system, a BSF line containing a deletion mutation in the Semala gene was produced (Figure 1). The mutation is a deletion of 50,987 bps from position 419,698 to position 470,684 on the genomic sequence encoding Semala1, shown between positions 159,092,514 and 159,592,196 of the NCBI Reference Sequence NC_051851.1 nucleic acid sequence. This Sema1a mut The allele comprises SEQ ID NO: 3.

[0176] Mutagenesis of BSF Semala-II

[0177] Two additional sgRNA targeting sites, designated sgA (GCCAGGCACTTAAATT TCCG, SEQ ID NO: 12) and sgD (TGTGGACTCGGACTACTTGA, SEQ ID NO: 13), were each injected into fertilized eggs along with Cas9 protein as described above. The injected eggs (embryos) developed into adults and mated. F1 larvae of the eggs were injected with sgD and raised under optimal conditions, and individual larvae showing a delayed melanization phenotype were collected and genotyped. Mutations in the targeted region were observed in all larvae showing a mutant phenotype of increased weight and delayed pupation (Table 1). Figure 2 These results indicate that multiple mutations in the gene encoding Semala produce the expected effect of increasing larval weight at the end of the fifth instar larval stage (before pupation).

[0178] The offspring larvae (after the F1 generation) of the eggs injected with sgA showed two specific deletion mutations: a point deletion of nucleotide A (adenine) at position 80 of SEQ ID NO: 2 (forming a Semala selenoblastoma containing SEQ ID NO: 8) and a point deletion of nucleotide A (adenine) at position 80 of SEQ ID NO: 2 (forming a Semala selenoblastoma containing SEQ ID NO: 8). mut allele) and a deletion of 10 nucleotides between positions 72-81 of SEQ ID NO: 2 (forming Sema1a mut The allele comprises SEQ ID NO:9, Figure 3 Both mutations are frameshift mutations that result in premature stop codons, rendering the Semala protein inactive and leading to a weight gain phenotype in the mutant larvae (Table 2).

[0179] Table 1: Weights of wild-type larvae and larvae hatched from Cas9-sgD injected eggs

[0180]

[0181] Table 2: Weights of wild-type larvae and larvae hatched from Cas9-sgA injected eggs

[0182]

[0183] Example 2: Sema1a-containing mut Characterization of BSFL of alleles

[0184] The larvae hatched from the eggs laid by the mutant adults in Example 1 metamorphosed to the pupal stage later. FIG5 shows wild-type larvae and larvae containing Sema1a comprising SEQ ID NO: 3. mut 16 days after hatching, the mutant larvae were compared with the mutant larvae that maintained their bright color and continued to grow ( Figure 5A , right panel), the control larvae have turned black, indicating that they have reached the pre-pupae stage ( Figure 5A , left figure).Figure 5B Representative pictures of CRISPR mutant larvae containing the Semala gene of SEQ ID NO: 3 and WT control larvae 14 days after egg laying are shown. The average weight of the mutant larvae was significantly higher than the body weight of the wild type larvae (average values of 280 mg vs. 210 mg, Figure 5C ) respectively). The growth pattern of the mutant larvae showed higher weight Figure 5D ) during the period of 10th to 14th day.

[0185] The adult flies that matured from the mutant larvae were also larger Figure 5E ) than the adult flies that matured from the wild type larvae and had significantly higher average weight (91.5 mg vs. 56.1 mg, Figure 5F ) respectively).

[0186] Figure 6 Representative pictures of Sema1a mut larvae containing SEQ ID NO: 9 and WT larvae are shown. The weight of both groups increased over time, with the growth pattern of the mutant larvae similar to or slightly slower than that of the control larvae. Notably, the control larvae stopped feeding and growing at day 12 after hatching from the egg (16 days after egg laying), while the mutant larvae exhibited continued growth until day 16 after hatching (20 days after egg laying). This extended growth period resulted in a significant increase in the final weight of the mutant larvae compared to their wild type counterparts. Figure 7 It is shown that, although both WT and mutant larvae enter the melanization stage, the mutant larvae reach this stage at a later time after egg laying and at a higher weight.

[0187] In summary, the present application demonstrates for the first time that BSFL containing a mutant Semala gene, in which expression of the mutant gene is not restricted to a specific time or organ, allowing for continuous expression of the mutant gene throughout the larval body. BSFL carrying this mutant allele exhibit delayed maturation and increased body weight. Moreover, and unexpectedly, the mutant larvae are able to metamorphose and reach the adult stage as high weight, fertile flies.

[0188] Example 3: Determination of feed conversion ratio (FCR)

[0189] Two hundred mutant larvae and 200 wild type larvae were grown on equal amounts of food. At the end of the experiment on day 12, all larvae were weighed. FCR was calculated according to the following formula:

[0190]

[0191] The FCR of the genetically modified larvae was improved by about 20% (FCR value of 3.305, compared to a value of 4.160 for the wild type larvae).

[0192] Example 4: Larval nutritional value

[0193] The nutritional value of the mutant larvae was compared to the nutritional value of wild type larvae.

[0194] Approximate composition of wild type larvae and Semala mutant larvae at the same developmental stage was analyzed at Milouda & Migal laboratories in Israel using the following defined AOAC International Official Methods Program: moisture analysis according to AOAC 950.46; crude protein analysis according to AOAC 976.05, 950.36, 991.20 and 986.25; hydrolysis of fat according to Nestle LI00.527-1; ash analysis according to AOAC 923.03.

[0195] The results are presented in Table 3. The similar observed moisture values indicate that the higher weight of the mutant larvae is not due to excess moisture. The similar percentages of crude protein and crude fat indicate that the protein and fat composition of the mutant larvae is not changed compared to the wild type strain; however, since the total weight of the mutant larvae is higher, they provide higher weight of protein and fat.

[0196] Table 3: Larval nutritional value

[0197]

[0198] Example 5: Sema1a-containing mut Life cycle of BSF of alleles

[0199] To further clarify the effect of the mutation on the BSF life cycle, 100 wild type (WT) larvae and 100 mutant larvae (Sema1a mut containing SEQ ID NO: 9) were monitored from the late larval stage to the pre-pupal stage. The ratio of black to white in the population was recorded daily. 100% of the individual larvae from both the wild type and mutant groups completed metamorphosis into the pupal stage Figure 8 ). In addition, the emergence of adult from the mutant pupae was not negatively affected and was similar to the wild type pupae: 96 out of 100 mutant pupae emerged as adults; 94 out of 100 wild type pupae emerged as adults.

[0200] The foregoing description of the specific embodiments will so fully reveal the general nature of the application that others can, by applying current knowledge, readily modify and / or adapt for various applications such specific embodiments without the exercise of inventive faculty. Therefore, it is intended that the disclosure is to be considered as exemplary only and not as limiting the scope of the application. It is therefore apparent that there have been some preferred embodiments, modifications and variations of the specific aspects of the application. It is therefore intended to cover in the appended claims all such modifications and variations that come within the scope of this application.

Claims

1. A genetically modified black soldier fly larva (BSFL) having reduced expression and / or activity of a signal protein 1a (Semala) protein or a homologue thereof, wherein the weight of the genetically modified larva at the end of the fifth instar larval stage is greater than the weight of a corresponding unmodified black soldier fly larva grown under similar conditions and at the same larval stage.

2. The genetically modified BSFL according to claim 1, wherein the genetically modified BSFL is capable of metamorphosing into a pupa.

3. The genetically modified BSFL according to claim 2, wherein metamorphosis to pupation occurs at least one day after metamorphosis of the corresponding non-genetically modified BSFL.

4. The genetically modified BSFL according to any one of claims 2-3, wherein The genetically modified BSFL can further metamorphose into adults.

5. The genetically modified BSFL according to claim 4, wherein the adult has an increased weight compared to an adult metamorphosed from a corresponding unmodified BSFL.

6. The genetically modified BSFL according to any one of claims 4-5, wherein the adult worms are fertile.

7. The genetically modified BSFL according to any one of claims 1 to 6, wherein the feed conversion ratio (FCR) of the genetically modified BSFL is lower as compared to the FCR of the corresponding unmodified BSFL.

8. The genetically modified BSFL according to claim 7, wherein the FCR value of the genetically modified BSFL is increased by about 10% to about 50% compared to the FCR of the corresponding unmodified BSFL.

9. The genetically modified BSFL according to any one of claims 1 to 8, wherein The Semala protein or a homolog thereof comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:

1.

10. The genetically modified BSFL according to any one of claims 1 to 9, wherein the Semala protein is encoded by the Semala gene or a homolog thereof, and the Sema1a gene or a homolog thereof has at least 85% identity with the nucleic acid sequence shown between positions 159,092,514 and 159,592,196 in the NCBI reference sequence NC_051851.

1.

11. The genetically modified BSFL according to any one of claims 1 to 9, wherein the Semala protein is encoded by a Semala gene or a homolog thereof, and the Semala gene or a homolog thereof has at least 85% identity with the nucleic acid sequence shown in SEQ ID NO:

2.

12. The genetically modified BSFL according to any one of claims 1 to 11, wherein the genetically modified BSFL comprises at least one mutant allele of the Semala gene or a homologue thereof in its genome.

13. The genetically modified BSFL of claim 12, wherein the mutant allele comprises at least one deletion mutation.

14. The genetically modified BSFL according to any one of claims 12-13, wherein at least one mutation in the mutant allele of Semala is a deletion within the genomic sequence encoding the Semala protein, wherein the genomic sequence has at least 85% identity with the nucleic acid sequence shown between positions 159,092,514 and 159,592,196 in the NCBI reference sequence NC_051851.

1. 15 . The genetically modified BSFL according to claim 14 , wherein the deletion is a deletion of 50,987 nucleotides between positions 159,121,513 and 159,172,499 in the nucleic acid sequence shown in the NCBI reference sequence NC_051851.

1.

16. The genetically modified BSFL according to any one of claims 14-15, wherein the mutant allele of Semala comprises the nucleic acid sequence shown in SEQ ID NO:

3.

17. The genetically modified BSFL according to any one of claims 12-13, wherein at least one mutation in the mutant allele of Semala is a deletion within the coding sequence of Semala protein, wherein the coding sequence has at least 85% identity to SEQ ID NO:

2. The genetically modified BSFL according to claim 17 , wherein the deletion is a deletion of nucleotide A at position 80 of the nucleic acid sequence shown in SEQ ID NO:

2.

19. The genetically modified BSFL according to any one of claims 17-18, wherein the mutant allele comprises the nucleic acid sequence shown in SEQ ID NO:

8. 20 . The genetically modified BSFL according to claim 17 , wherein the deletion is a deletion of 10 nucleotides between positions 72 and 81 of the nucleic acid sequence shown in SEQ ID NO:

2.

21. The genetically modified BSFL according to claim 17 or 20, wherein the mutant allele of Semala comprises the nucleic acid sequence shown in SEQ ID NO:

9.

22. The genetically modified BSFL according to any one of claims 12-21, wherein the genetically modified BSFL is heterozygous for a mutant Semala allele.

23. The genetically modified BSFL according to any one of claims 12-21, wherein the genetically modified BSFL is homozygous for the Semala mutant allele.

24. The genetically modified BSFL of any one of claims 1-23, wherein the weight of the genetically modified BSFL is at least 10%, at least 20%, at least 30%, at least 40%, at least 50% higher than the weight of the corresponding unmodified BSFL.

25. The genetically modified BSFL according to any one of claims 1-24, wherein on a dry weight basis, the genetically modified BSFL comprises at least 10 wt%, at least 20 wt%, at least 30 wt%, at least 40 wt% or at least 50 wt% fat, based on the total weight of the BSFL.

26. The genetically modified BSFL according to any one of claims 1-25, comprising, on a dry weight basis, at least 10 wt%, at least 20 wt%, at least 30 wt%, at least 40 wt% or at least 50 wt% protein, based on the total weight of the BSFL.

27. An edible composition comprising a plurality of the genetically modified BSFLs of any one of claims 1-26.

28. The edible composition of claim 27, further comprising at least one food grade excipient or carrier.

29. The edible composition of any one of claims 27-28, further comprising at least one additional nutritional ingredient selected from the group consisting of at least one food-grade protein and / or amino acid, at least one food-grade carbohydrate, at least one food-grade fatty acid, and any combination thereof.

30. The edible composition according to any one of claims 27-29, wherein the edible composition comprises the genetically modified BSFL or a portion thereof in a form selected from the group consisting of a living form, a dried form, and combinations thereof.

31. The edible composition according to claim 30, wherein The genetically modified BSFL is in a dry form, and the edible composition comprises the genetically modified BSFL in a form selected from the group consisting of whole larvae and larvae powder.

32. The edible composition according to claim 31, wherein The dried genetically modified BSFL is defatted.

33. An edible composition according to any one of claims 27 to 32, wherein The edible composition is used to feed non-human animals.

34. The edible composition according to claim 33, wherein The non-human animal is selected from terrestrial animals and aquatic animals.

35. The edible composition according to claim 34, wherein The aquatic animal is selected from fish and crustaceans, and / or the terrestrial animal is selected from birds, reptiles and mammalian farm animals.

36. The edible composition of claim 33, wherein the non-human animal is an insect.

37. The edible composition of any one of claims 31-32, wherein the edible composition is a human food.

38. A method for producing high-weight BSFL, the method comprising reducing the expression and / or activity of Semala protein in at least one cell of the BSFL.

39. The method of claim 38, wherein the method comprises generating at least one mutation in at least one wild-type allele of Semala or a homolog thereof to form a Semala1 mutant allele, wherein the at least one mutation results in loss of function, reduced function or abnormal function of the encoded Semala protein.

40. The method of any one of claims 38-39, wherein the wild-type allele of Semala or a homolog thereof comprises a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence shown between positions 159,092,514 and 159,592,196 of the NCBI reference sequence NC_051851.

1.

41. The method of any one of claims 38-40, wherein the wild-type allele of Semala or a homolog thereof comprises a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from the group consisting of: the nucleic acid sequence shown between positions 159,092,514 and 159,592,196 of the nucleic acid sequence shown in the NCBI reference sequence NC_051851.1; and the nucleic acid sequence shown in SEQ ID NO:

2.

42. The method of any one of claims 38-41, wherein the mutation is selected from the group consisting of a deletion, an insertion, an insertion-deletion mutation (indel), a site-specific mutation, and any combination thereof.

43. The method of claim 42, wherein the mutation is a site-specific mutation.

44. The method of any one of claims 38-43, comprising inducing the mutation by genome editing using at least one artificially designed nuclease.

45. The method of claim 44, wherein the artificially designed nuclease is selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a CRISPR / Cas system, a CRISPR / Cas homology system, and a CRISPR / Cas modification system.

46. ​​The method of claim 45, wherein the mutation is induced by genome editing using the CRISPR / Cas system.

47. High weight genetically modified BSFL produced by the method of any one of claims 38-46.

48. A composition comprising at least one component derived from the genetically modified BSFL of any one of claims 1-26 and 47.

49. The composition of claim 48, wherein the at least one component is selected from the group consisting of a protein component, a fat component, a chitin component, an aqueous component containing vitamins and minerals, and any combination thereof.

50. A method for converting organic waste into biomass, the method comprising using the organic waste as the sole nutrient source and providing a plurality of genetically modified BSFLs according to any one of claims 1-26 and 47.

51. The method of claim 50, wherein the organic waste is selected from the group consisting of household organic waste, agricultural waste, and combinations thereof.

52. The method according to any one of claims 50-51, wherein the method further comprises the step of separating non-organic compounds and / or toxic compounds from the organic waste.

53. The method of any one of claims 50-52, wherein the method results in a weight increase of at least 25%, at least 50%, at least 100%, at least 150%, at least 200%, at least 250% or more of the average initial weight of a plurality of genetically modified BSFLs.

Citation Information

Patent Citations

  • Modified black soldier fly larvae oil with modified lauric acid for treatment against biofilm formation and microorganism growth

    WO2020234884A1

  • Animal feed by applying black soldier fly larva

    CN106472846A