Disease-resistant gene osstomr and application thereof in improving plant disease resistance and disease prevention and control

Abstract

This invention belongs to the field of genetic engineering technology and discloses a disease-resistant gene. OsSTOMR The gene's protein sequence, encoded by the gene, is shown in SEQ ID NO.2, and its nucleotide sequence is shown in SEQ ID NO.1. Molecular genetic experiments have shown that knocking out the receptor that recognizes the pathogen-associated molecular pattern STOM... NbSTOMR Tobacco mutant of the gene ( nbstomr In ), express OsSTOMR It is believed that STOM can enhance the production of reactive oxygen species induced by this mutant. OsSTOMR It is a pattern recognition receptor that recognizes the pathogen-associated molecular pattern STOM and is expressed in tobacco. OsSTOMR This can enhance the tobacco's resistance to Sclerotinia sclerotiorum. Therefore, the invention provides... OsSTOMR OsSTOMR It is a disease resistance-related pattern recognition receptor in rice that can enhance tobacco's resistance to Sclerotinia sclerotiorum and can be applied to tobacco disease resistance breeding.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to disease-resistant genes. OsSTOMR And its application in improving plant disease resistance and disease control. Background Technology

[0002] Plants have developed a complex and efficient immune system over a long period of evolution to defend against various pathogens. Unlike animals, plants lack mobile immune cells and therefore rely on inherent cellular-level defense mechanisms to identify and prevent pathogen invasion. Pattern recognition receptors (PRRs) are the first line of defense in the plant immune system, capable of sensing conserved molecular structures widely present in pathogens, namely pathogen-associated molecular patterns (PAMPs), thereby triggering pattern-triggered immunity (PTI). PTI typically manifests as a series of defensive responses, including reactive oxygen species bursts, MAPK signaling activation, upregulation of immune-related gene expression, and cell wall reinforcement, effectively inhibiting the initial invasion of pathogens.

[0003] Over the past two decades, several important pharmacokinetic receptors (PRRs) and the pharmacokinetic proteins (PAMPs) they recognize have been identified. For example, in Arabidopsis thaliana, FLS2 recognizes the bacterial flagellin fragment flg22; EFRs recognize the bacterial elongation factor EF-Tu; and LYK5 / CERK1 recognizes fungal chitin oligosaccharides. A series of PRRs, such as OsCERK1 and OsCEBiP, also exist in rice, participating in chitin recognition and activating immune responses. These findings not only deepen our understanding of plant immune sensing mechanisms but also provide important molecular resources for crop disease resistance breeding.

[0004] However, the distribution of PRRs is uneven among different plant species, exhibiting evolutionary loss or functional deficiency. For example, in the Solanaceae family, *Nicotiana benthamiana* (… Nicotiana benthamiana In some plants, PRRs (Protein Receptors) are mutated or deleted, rendering them unable to recognize specific PAMPs, thus weakening the plant's immune response to certain pathogens. Recent studies have found that a new fungal-derived PAMP—STOM (Secreted Toxin-like Oligopeptide Motif)—can be recognized by PRRs in plants of the genus *Nicotiana* (Solanaceae) and induce a typical immune response. However, when the corresponding PRR gene in *Nicotiana benthamiana* is knocked out, its ability to sense STOM is significantly lost, thereby weakening its resistance to related pathogens.

[0005] It is noteworthy that rice also possesses pattern recognition receptors with functions similar to the STOM receptor in tobacco, one of which is OsSTOMR, the subject of this study. OsSTOMR can recognize STOM and activate an immune response. Introducing the rice-derived OsSTOMR gene into a receptor-deficient mutant of Nicotiana benthamiana restores its ability to sense STOM, thereby reactivating the typical PTI response. This result demonstrates that OsSTOMR retains its function in a cross-species context and can compensate for immune deficiencies in receptor-deficient plants.

[0006] *Sclerotinia sclerotiorum* is a globally important fungal pathogen with a wide host range, capable of infecting almost all major crops, including rapeseed, soybean, cotton, and tobacco. *Sclerotinia sclerotiorum* can cause stem rot, leaf soft rot, and fruit rot, leading to large-scale yield reductions or even total crop failure in severe cases. Due to its robust survival ability and complex infection mechanism, effective chemical control methods are currently lacking, making disease-resistant breeding one of the most economical and sustainable strategies for controlling this disease. However, the reported tobacco *Sclerotinia sclerotiorum* resistance gene resources are limited, and traditional disease-resistant breeding has progressed slowly. How to introduce new disease-resistant gene resources through molecular breeding methods is an urgent problem to be solved in the field of tobacco breeding.

[0007] PRR-mediated innate immunity is a broad-spectrum, durable defense mechanism that is independent of specific resistance genes. Therefore, using heterologous PRR transfer to enhance crop disease resistance has become an emerging strategy. Previous studies have shown that introducing the Arabidopsis thaliana EFR gene into plants such as tomato and tobacco can confer resistance to a wide range of bacteria. The rice pattern recognition receptor OsSTOMR identified in this invention can sense STOM across family lines and activate immune responses. By introducing OsSTOMR into Nicotiana benthamiana, not only was its sensitivity to STOM restored, but its resistance to Sclerotinia sclerotiorum was also significantly enhanced. This discovery provides a new genetic resource and technical route for using rice PRR genes to improve disease resistance in tobacco and other crops. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention identifies a pattern recognition receptor in rice that can recognize the pathogen-associated molecular pattern STOM. OsSTOMR In knocking out the receptor that recognizes the pathogen-associated molecular pattern STOM NbSTOMR Tobacco mutant of the gene ( nbstomr In this study, expression of OsSTOMR enhanced STOM-induced reactive oxygen species production in the mutant; simultaneously, OsSTOMR It can also enhance the resistance of tobacco to Sclerotinia sclerotiorum, as evidenced by the enhanced resistance observed in Nicotiana benthamiana when the gene is expressed. Therefore, the purpose of this invention is to provide a novel disease resistance gene derived from rice.OsSTOMR The protein encoded by this gene can recognize the pathogen-associated molecular pattern STOM, and its transfer into tobacco significantly enhances the resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum.

[0009] In a first aspect, the present invention provides a disease-resistant protein OsSTOMR derived from rice that can be applied to tobacco resistance against Sclerotinia sclerotiorum, wherein the protein OsSTOMR is a protein as follows: 1) or 2) or 3) or 4) 1) A protein consisting of the amino acid sequence of SEQ ID NO:2 in the sequence listing; 2) Proteins derived from SEQ ID NO:2 by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence in the sequence listing, while still retaining the function of recognizing pathogen-associated molecular patterns or enhancing plant disease resistance.

[0010] 3) Proteins that have more than 90% homology with the amino acid sequence of 1) or 2) and encode proteins that can recognize pathogen-related molecular patterns or enhance tobacco disease resistance.

[0011] 4) Proteins derived from the protein shown in SEQ ID NO:2 that retain the ability to recognize pathogen-related molecular patterns or enhance plant disease resistance even after deletion or recombination of the amino acid sequence of 1) or 2).

[0012] Secondly, this invention also provides a disease resistance gene derived from rice that can be applied to tobacco resistance to Sclerotinia sclerotiorum. OsSTOMR The gene OsSTOMR It is a nucleic acid molecule that is either 1), 2), or 3) as follows: 1) Its nucleotide sequence is shown in SEQ ID NO.1; 2) The nucleotide sequence encoding the protein as described in the first aspect; 3) A nucleic acid molecule that hybridizes to the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the disease resistance-associated protein OsSTOMR.

[0013] Thirdly, the present invention also provides a product containing the ingredients described in the second aspect. OsSTOMR Biological materials containing nucleic acid molecules, wherein the biological material is any one of the following: 1) Contains the content described in the second aspect OsSTOMR Nucleic acid expression cassettes; 2) Contains the content described in the second aspect OsSTOMR Recombinant expression vectors for nucleic acid molecules; 3) An expression carrier containing the expression box described in 1); 4) Recombinant microorganisms containing the recombinant expression vector described in 2); 5) Recombinant microorganisms containing the recombinant expression vector described in 3).

[0014] Fourthly, the present invention also provides a composition capable of improving tobacco resistance to Sclerotinia sclerotiorum, said composition containing the protein OsSTOMR described in the first aspect and the gene described in the second aspect. OsSTOMR Or the biological materials described in the third aspect.

[0015] Fifthly, the present invention also provides the protein OsSTOMR described in the first aspect and the gene described in the second aspect. OsSTOMR Or the application of the biological materials described in the third aspect in the breeding of tobacco resistant to sclerotinia or in the control of tobacco sclerotinia disease.

[0016] In some embodiments, the application includes using the protein OsSTOMR described in the first aspect and the antinuclear gene described in the second aspect. OsSTOMR Or the steps described in the third aspect, in which biological materials are transferred into tobacco through gene editing, transgenic technology, or other techniques.

[0017] Sixthly, the present invention also provides a method for improving tobacco resistance to diseases caused by Sclerotinia sclerotiorum, the method comprising administering the protein OsSTOMR described in the first aspect and the antinuclear gene described in the second aspect. OsSTOMR Or the steps described in the third aspect, in which biological materials are transferred into tobacco through gene editing, transgenic technology, or other techniques.

[0018] In some embodiments, the method specifically involves introducing the protein described in the first aspect into tobacco tissue; or introducing the gene described in the second aspect. OsSTOMR Alternatively, fragments can be linked to plant expression vectors and introduced into tobacco tissue.

[0019] Compared with the prior art, the advantages and beneficial effects of this application are as follows: (1) This invention identifies a disease resistance gene derived from rice that can be applied to tobacco resistance to Sclerotinia sclerotiorum. OsSTOMR As a pattern recognition receptor, it can recognize pathogen-associated molecular patterns (STOMs) and induce plant immune responses. Meanwhile, the resistance-related genes described in this invention... OsSTOMR It can enhance the resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum.

[0020] (2) The resistance-related gene described in this invention OsSTOMR The identified pathogen-associated molecular pattern STOM exists in various pathogens, thus possessing broad-spectrum antiviral potential and promising application prospects. Attached Figure Description

[0021] Figure 1 Disease resistance-related genes OsSTOMR Interacting with the pathogen-associated molecular pattern STOM.

[0022] Figure 2 In Ben's tobacco nbstomr OsSTOMR expression in the knockout body can mediate STOM-induced reactive oxygen species production.

[0023] Figure 3 The expression of OsSTOMR in Nicotiana benthamiana enhances the resistance of tobacco to Sclerotinia sclerotiorum. Detailed Implementation

[0024] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention is further described below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0025] Example 1: Disease Resistance Related Genes OsSTOMR STOM interaction with pathogen-associated molecular patterns Using pattern recognition receptors OsSTOMR Its nucleotide sequence is shown in SEQ ID NO:1 in the sequence listing, and its amino acid sequence is shown in SEQ ID NO:2.

[0026] (1) Construction of prokaryotic expression vector Specific primers were designed to encode the STOM gene, a molecular pattern associated with the pathogen *Aspergillus oryzae*. The forward primer was 5'-ggatccccaggaattcccgggATGCTGTACTTTGACTTCCGGC-3' (SEQ ID NO:3), and the reverse primer was 5'-tcagtcagtcacgatgcggccgcTCAGTCAAGACCGACGTTGGG-3' (SEQ ID NO:4). Using *Aspergillus oryzae* cDNA as a template, the full-length STOM gene was amplified (94℃ 5 min; 94℃ 30 s, 58℃ 30 s, 72℃ 30 s, 34 cycles; 72℃ 5 min). After digesting the pGEX4T vector with Sma I and Not I, the STOM fragment was cloned into the pGEX4T vector using recombinant cloning.

[0027] Similarly, designing a coding pattern recognition receptor OsSTOMRExtracellular domain-specific primers were used: forward primer: 5'-ctgtattttcagggcgaattcATGGAACATCTCTTCACCCTCATC-3' (SEQ ID NO:5), reverse primer: 5'-caggtcgactctagaggatccTTACTTCTTTTGTTTCTTCCACTTGAT-3' (SEQ ID NO:6), and amplification products were generated. These products were cloned into the undigested pHMTc vector containing EcoRI and BamHI using recombinant cloning.

[0028] The recombinant vector was transformed into Escherichia coli DH5α strain, plated on plates containing ampicillin, and positive clones were screened by colony PCR. Plasmids were extracted from the screened positive clones by shaking to obtain the recombinant vector for prokaryotic expression.

[0029] Results: The prokaryotic expression vector was obtained through colony PCR and sequencing verification.

[0030] (2) Inducing protein expression The recombinant plasmid was introduced into *E. coli* Rosetta expression host and plated on selective medium containing ampicillin and chloramphenicol. Positive clones were screened by colony PCR. Positive strains were picked and inoculated into 4 mL of LB medium containing both antibiotics, incubated overnight at 37°C with shaking, and then transferred to 200 mL of LB liquid medium with the same antibiotic conditions. The culture was continued until the OD600 reached 0.6–0.8. Subsequently, 200 μL of 0.1 M IPTG was added, and the culture was induced overnight at 28°C with shaking.

[0031] (3) Purification of recombinant proteins The induced bacterial cells were collected in 50 mL centrifuge tubes and centrifuged at 8000 rpm for 10 min at 4 °C. The cells were resuspended in 10–20 mL of lysis buffer (NaH₂PO₄ 50 mM, NaCl 300 mM, Imidazole 10 mM, pH 8.0) and 20 μL of lysozyme was added. The mixture was incubated on ice for 30 min. The cells were then sonicated (1 s / 3 s intervals, 30 min), followed by centrifugation at 10000 rpm for 70 min at 4 °C. The supernatant was collected. A 400 μL nickel column was washed twice with 10 mL of lysis buffer, and the supernatant was added. The column was incubated on a shaker at 4 °C for 2 h. After incubation, the supernatant was removed by centrifugation at 3210 rpm for 5 min. The sample was then washed three times sequentially with 20 mM elution buffer (NaH₂PO₄ 50 mM, NaCl 300 mM, Imidazole 20 mM, pH 8.0), followed by three washes with 50 mM elution buffer (Imidazole 50 mM), and finally eluted 10 times consecutively with 250 μL elution buffer (Imidazole 250 mM). 10 μL of the eluent was added to 6× SDS loading buffer, and the mixture was boiled in a water bath for 10 min before SDS-PAGE analysis. The purification was assessed using Coomassie Brilliant Blue R250 staining. The purified product was then transferred to imidazole-free Tris buffer via ultrafiltration (Millipore Amicon Ultra-15c) for subsequent experiments.

[0032] Results: Purified GST-labeled STOM and MBP-labeled OsSTOMR extracellular domain proteins were successfully obtained.

[0033] (4) Pull-Down Detection Interaction Equal amounts of GST-tagged STOM and MBP-tagged OsSTOMRThe extracellular domains were incubated in a buffer containing Glutathione Sepharose 4B (GS4B, Cytiva) resin (50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM MgCl2, and 1% NP-40). After incubation at 4°C for 1 hour, the cells were washed 5 times with elution buffer (50 mM Tris-HCl (pH 8.0), 400 mM NaCl, 50 mM reduced glutathione, 1 mM EDTA, and 1 mM DTT), with GST used as a negative control. The loaded and eluted proteins were treated with 6× SDS loading buffer and boiled for 10 min before SDS-PAGE and Western blot analysis. GST and MBP antibodies were used to detect the expression of the STOM and OsSTOMR extracellular domains, respectively.

[0034] Results: STOM interacts with the extracellular domain of OsSTOMR, while GST itself does not interact with the extracellular domain of OsSTOMR (see [link to results]). Figure 1 ).

[0035] Example 2: Benedict's smoke nbstomr OsSTOMR expression in knockout mutants can mediate STOM-induced reactive oxygen species production. (1) Benedict's tobacco nbstomr Obtaining knockout mutants 1) Constructing a knockout vector Design Targets NbSTOMRGene targets: t1: 5'- ATCGAGCTCGTTGCTGATCG CGG-3' (SEQ ID NO:7); t2: 5'- GGAGATAATCCAGCTCCTAAAGG-3' (SEQ ID NO:8); t3: 5'-CTTGTTGTTGAGGACTAGTA AGG-3' (SEQ ID NO:9); then the three fragments were fused together via fragment synthesis to serve as a template for subsequent amplification. Amplification primers were designed: forward primer: 5'- cagtGGTCTCatgcaatcgagctcgttgctgatcggtttc-3' (SEQ ID NO:10), reverse primer: 5'- cagtGGTCTCaaaactactagtcctcaacaacaagtgcaccag-3' (SEQ ID NO:11). The fused fragment was amplified and then constructed into a BsaI / Eco31I-digested K5-KRSN vector. The recombinant vector was transformed into E. coli, and positive clones were screened by colony PCR. Finally, the knockout vector was obtained by extracting the plasmid through shaking.

[0036] 2) Plasmid transformation into Agrobacterium GV3101 Add 1 µL of plasmid to 50 µL of GV3101 Agrobacterium competent cells and transform them using liquid nitrogen. Add the successfully transformed GV3101 cells to 1 mL of LB liquid medium and incubate at 30°C and 180 rpm for 30 min on a shaker. Then, inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30°C for 48 h.

[0037] 3) Agrobacterium-mediated stable transformation of Nicotiana benthamiana Sterile tobacco leaves were cut into small pieces with a scalpel and inoculated onto pre-culture medium. An Agrobacterium resuspension with an OD600 of 0.2 was prepared. Tobacco leaves pre-cultured for 2-3 days were inoculated into this suspension for 10-15 minutes. The inoculated tobacco leaves were then inoculated onto filter paper, dried, and then inoculated onto a co-culture medium for 48-72 hours in the dark. After 2 days of culture, the leaves were transferred to an induction medium to induce callus formation. Callus tissue grew after approximately 10 days. Callus tissue meeting the criteria was selected and inoculated onto the corresponding resistance selection medium for 15-30 days. Vigorous positive callus tissue from the second screening was inoculated onto differentiation medium, 4-5 calluses per dish, and cultured at 23℃ for 16h / 8h light / dark for 15-30 days. If seedlings formed during differentiation, they were inoculated onto a seedling growth medium and grown for 7-10 days. Tobacco genomic DNA was extracted using the CTAB method and detected by PCR to finally obtain the genetic information for *Nicotiana benthamiana*. nbstomr Knockout mutants.

[0038] (2) Construction of plant expression vectors Design coding OsSTOMR Gene-specific primers were used: forward primer: 5'-gaacgatagggtacccccgggATGGAACATCTCTTCACCCTCATC-3' (SEQ ID NO: 12), reverse primer: 5'-gtaaggcctactagtggatccCTGGAGTGAACTGATATATGATGCAG-3' (SEQ ID NO: 13). The gene was amplified (94℃ 5min; 94℃ 30s, 58℃ 30s, 72℃ 30s, 34 cycles; 72℃ 5min). The pBINHA vector was digested with Sma I and BamHI, and the amplified product was cloned into the pBINHA vector using recombinant cloning. The recombinant vector was transformed into *Escherichia coli* DH5α strain, plated on agar plates containing kanamycin, and positive clones were screened by colony PCR. Plasmids were extracted from the screened positive clones by shaking to obtain the plant expression recombinant vector.

[0039] (3) Agrobacterium-mediated transient transformation of Nicotiana benthamiana Will contain OsSTOMR The plant expression vector was transformed into Agrobacterium competent cells GV3101 using liquid nitrogen. Positive clones were screened by colony PCR, and then added to liquid medium containing 4 ml LB. After incubation at 30°C and 180 rpm for 36 hours, the cells were washed and the OD value was adjusted to 0.5. The culture was then injected into the abaxial surface of Nicotiana benthamiana leaves using a 1 ml needleless syringe. Twelve hours later, the plant expression vector containing STOM was injected.

[0040] (4) Observation of reactive oxygen species phenotype The reactive oxygen species phenotype needs to be observed through DAB staining: Injected leaves are placed in DAB staining solution (1 mg / ml, pH=3.8) and treated at room temperature in the dark for 8 hours. After removing the staining solution, anhydrous ethanol is added for destaining. Once all the green color has been removed from the leaves, the leaves are removed and photographed.

[0041] Result: In nbstomr The knockout body expresses OsSTOMR Later, it was discovered that the expression OsSTOMR It can restore pathogen-associated molecular pattern-induced cell death and reactive oxygen species (see Figure 2 This further demonstrates that OsSTOMR recognizes pathogen-associated molecular patterns and elicits plant immune responses.

[0042] Example 3: Overexpression of disease resistance-related genes OsSTOMR Enhance the resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum. In Ben's smoke, instantaneous expression OsSTOMRThen, inoculate with Sclerotinia sclerotiorum, keep in a moist environment for culture, and count the area of ​​the lesions.

[0043] Results: Overexpression in *Tobacco Benedict's tobacco* OsSTOMR The lesion area was significantly smaller than the WT, indicating that OsSTOMR positively regulates resistance to Sclerotinia sclerotiorum (see...). Figure 3 ).

[0044] The present invention has been described above by way of example. It should be noted that any simple modifications, alterations or other equivalent substitutions that can be made by those skilled in the art without creative effort without departing from the core of the present invention fall within the protection scope of the present invention.

Claims

1. A method for improving tobacco resistance to diseases caused by Sclerotinia sclerotiorum, characterized in that, The method comprises transforming a gene OsSTOMR The relevant biological material is introduced into tobacco by transgenic technology. The biomaterial is any of the following: 1) Contains the aforementioned gene OsSTOMR Nucleic acid expression cassettes; 2) Contains the aforementioned gene OsSTOMR Recombinant expression vectors for nucleic acid molecules; 3) An expression carrier containing the expression box described in 1); The gene OsSTOMR The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that, The gene OsSTOMR The amino acid sequence of the encoded protein OsSTOMR is shown in SEQ ID NO.2.

Images