Rice immunological negative regulation gene ospskr10 and application thereof

Abstract

The application relates to the field of plant genetic engineering and molecular biology technology, and provides a rice immune negative regulation gene OsPSKR10 and application. The OsPSKR10 gene knockout suspension cell line provided in the application can activate the burst of active oxygen in rice cells and the expression of PR defense genes and other immune responses after exogenous chitin is applied. The OsPSKR10 gene knockout mutant plant can significantly improve the disease resistance to rice blast, bacterial leaf blight and sheath blight, can be applied to molecular breeding improvement and creation of a new rice variety with wide-spectrum disease resistance, and has a wide application prospect.

Description

Technical Field

[0001] This application relates to the fields of plant genetic engineering and molecular biology, specifically to a rice immune negative regulatory gene OsPSKR10 and its applications. Background Technology

[0002] Rice yield and quality are severely threatened by a variety of diseases, including bacterial blight, rice blast, and sheath blight. Rice blast can cause yield reductions of 10-35%, bacterial blight 20-30%, and sheath blight 10-30%. In severe cases, multiple diseases can occur simultaneously, potentially leading to complete crop failure. With climate change and rapid natural mutation of pathogens, many resistant and high-quality varieties are gradually losing their resistance, making the incidence of diseases increasingly severe. Therefore, cultivating highly resistant, broad-spectrum, and durable disease-resistant rice varieties is of extremely high demand in agricultural production.

[0003] Phytosulfokine (PSK) is a plant peptide growth factor. PSK is a disulfated pentapeptide with the structure Tyr(SO3H)-Ile-Tyr(SO3H)-Thr-Gln. The PSK precursor gene family is widely distributed in higher plants, with seven homologous genes encoding PSK precursor proteins in the rice genome. These precursor genes encode secretory precursor proteins containing approximately 80 amino acids. These precursor proteins undergo post-translational tyrosine sulfation modification in the trans-Golgi apparatus via tyrosine protein thiotransferase (TPST), followed by proteolytic cleavage in the apoplast to produce mature, active PSK peptides. The presence of sulfate groups (SO3H) on the first and third tyrosine residues of the mature pentapeptide backbone is a unique characteristic of PSK and plays a crucial role in its biological activity. PSK promotes multiple aspects of plant growth and development, including the growth of cell cultures or callus, somatic embryogenesis, tracheal element differentiation, pollen germination, and adventitious root formation. Furthermore, PSK is considered a damage-associated molecular pattern (DAMP) that plays a significant role in plant immune responses. PSK weakens Arabidopsis resistance to *Pseudomonas syringae* pv. tomato DC3000 (Pst DC3000) by inhibiting pattern-triggered immunity (PTI) triggered by the pathogen-associated molecular pattern (PAMP). Conversely, PSK can enhance plant resistance to diseases caused by necrotrophic fungi, such as gray mold in tomato and leaf spot in Arabidopsis.

[0004] Mature PSK peptides are recognized on the cell surface by membrane-bound PSK receptors (PSKRs), which belong to the leucine-rich repeat (LRR) receptor-like kinase (RLK) family. A PSKR consists of an N-terminal extracellular domain, a helical transmembrane domain, and an intracellular kinase domain. The N-terminus contains 21 LRRs, each composed of 24 amino acids. The 18th LRR is interrupted by an island domain that binds to PSK. PSKRs regulate plant growth and responses to biotic and abiotic stresses. AtPSKR1 is the major PSK receptor in Arabidopsis thaliana and can antagonize the infection of plants by biotrophic bacteria and necrotrophic fungi by inhibiting the salicylic acid signaling pathway and activating the jasmonic acid signaling pathway. The tomato PSK receptor SlPSKR1 promotes calcium absorption through interaction with calmodulin. 2+ Influx and activation of auxin biosynthesis pathways enhance tomato resistance to gray mold. Recent studies have found that AtPSKR1 balances plant growth and immunity to avoid immune autoactivation caused by growth-promoting *Pseudomonas fluorescens* in the plant rhizosphere microbiota. Fifteen homologous PSKR-encoding genes have been identified in the rice genome, among which OsPSKR (i.e., OsPSKR12) regulates the conversion of cellular defense signals into growth signals during leaf damage, which is crucial for normal rice growth and development and the suppression of unnecessary immune responses.

[0005] However, the role of OsPSKR10 in rice disease resistance remains unclear, and how this protein participates in regulating plant immune signaling pathways has not been reported. Therefore, elucidating the disease resistance function of rice OsPSKR10 and clarifying its mechanism of action is of significant scientific value for understanding the rice innate immune system. Summary of the Invention

[0006] To address the above problems, this invention provides a rice immune negative regulatory gene OsPSKR10 and its applications.

[0007] The present invention adopts the following technical solution:

[0008] This invention provides a rice immune negative regulatory protein OsPSKR10, the amino acid sequence of which is shown in SEQ ID NO.4 (NO. is the sequence number, the same below).

[0009] This invention provides a rice immune negative regulatory gene OsPSKR10 that encodes the rice immune negative regulatory protein OsPSKR10. The cDNA sequence of the rice immune negative regulatory gene OsPSKR10 is shown in SEQ ID NO.2.

[0010] This invention provides an application of rice immune negative regulatory protein OsPSKR10 or rice immune negative regulatory gene OsPSKR10 to improve the broad-spectrum disease resistance of rice, or to cultivate rice varieties with high broad-spectrum disease resistance.

[0011] This invention provides a knockout vector for the rice immune negative regulatory gene OsPSKR10. The gRNA sequence targeting the rice immune negative regulatory gene OsPSKR10 is ligated to the Bsa I site of the pYLgRNA-OsU6a vector. The pYLgRNA-OsU6a vector with the ligated gRNA sequence is then digested with Bsa I and assembled into the pYLCRISPR / Cas9Pubi-H vector using a cloning method, thereby obtaining the knockout vector for the rice immune negative regulatory gene OsPSKR10.

[0012] This invention provides a method for improving the broad-spectrum disease resistance of rice by converting a knockout vector into a recipient rice variety to obtain rice plants with enhanced broad-spectrum disease resistance.

[0013] This invention provides a mutant of the rice immune negative regulatory protein OsPSKR10, the amino acid sequence of which is shown in SEQ ID NO.7 or SEQ ID NO.8.

[0014] This invention provides an application of a mutant to improve the broad-spectrum disease resistance of rice.

[0015] Optionally, broad-spectrum disease resistance includes resistance to rice blast caused by *Oryza sativa*, bacterial blight caused by *Bacillus oryzae*, and sheath blight caused by *Rhizoctonia solani*.

[0016] The above-mentioned at least one technical solution adopted in this invention can achieve the following beneficial effects:

[0017] The OsPSKR12 gene knockout suspension cell line provided by this invention, upon exogenous application of chitin, activates immune responses in rice cells, including the burst of reactive oxygen species and the expression of PR defense genes. OsPSKR12 gene knockout mutant plants significantly enhance rice resistance to rice blast, bacterial blight, and sheath blight, and can be applied to molecular breeding improvement and the creation of new rice varieties with broad-spectrum disease resistance, showing broad application prospects. Attached Figure Description

[0018] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0019] Figure 1This is a diagram showing the nucleic acid electrophoresis results of the gDNA PCR products of the T0 generation transgenic positive line in Example 3;

[0020] Figure 2 This is a sequence alignment diagram of the sequencing results of the ospskr10-1 and ospskr10-2 mutants in Example 3;

[0021] Figure 3 The diagram shows the disease development of OsPSKR10 gene knockout mutant and wild-type rice after spray inoculation with rice blast fungus in Example 4. Figure (A) shows the appearance of diseased rice leaves, Figure (B) shows the statistical results of the number of lesions on rice leaves, and Figure (C) shows the statistical results of the relative fungal biomass of the diseased parts of rice leaves.

[0022] Figure 4 The diagram shows the disease development of OsPSKR10 gene knockout mutant and wild-type rice after inoculation with rice blast fungus. Figure (A) shows the appearance of diseased rice leaves, Figure (B) shows the statistical results of the lesion area of ​​rice leaves, and Figure (C) shows the statistical results of the relative fungal biomass of the diseased parts of rice leaves.

[0023] Figure 5 Figure 6 shows the disease development of OsPSKR10 gene knockout mutant and wild-type rice after inoculation with bacterial blight pathogen. Figure (A) shows the appearance of diseased rice leaves, and Figure (B) shows the statistical results of the relative lesion area of ​​rice leaves.

[0024] Figure 6 Figure 7 shows the disease development of OsPSKR10 gene knockout mutant and wild-type rice after inoculation with Sheath blight pathogen. Figure (A) shows the appearance of diseased rice leaves, Figure (B) shows the statistical results of the relative fungal biomass of the diseased parts of rice leaves, and Figure (C) shows the appearance of diseased rice leaf sheaths.

[0025] Figure 7 This is a schematic diagram of the analysis results of defense-related gene expression levels in Example 9. Figure (A) shows the relative expression level of OsPAL1, Figure (B) shows the relative expression level of OsPBZ1, Figure (C) shows the relative expression level of OsChitinase1, and Figure (D) shows the relative expression level of OsChitinase3.

[0026] Figure 8 Figure 10 shows the results of reactive oxygen species burst detection in Example 10. Figure (A) shows the statistical results of the dynamic content of reactive oxygen species in OsPSKR10 gene knockout mutant and wild-type rice, and Figure (B) shows the statistical results of the total reactive oxygen species content in OsPSKR10 gene knockout mutant and wild-type rice over 61 minutes. Detailed Implementation

[0027] Exemplary embodiments of this application will now be described in more detail. However, it should be understood that this application may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of this application and to fully convey the scope of this application to those skilled in the art.

[0028] This invention discloses many different embodiments or examples for implementing different structures of the invention. To simplify the disclosure, specific examples of components and arrangements are described herein. These are merely examples and are not intended to limit the invention. Furthermore, reference numerals and / or letters may be repeated in different examples; such repetition is for simplification and clarity and does not in itself indicate a relationship between the various embodiments and / or arrangements discussed. In addition, examples of various specific processes and materials are provided in this invention, but those skilled in the art will recognize the application of other processes and / or the use of other materials.

[0029] Generally, terms can be understood at least in part according to the usage of the present invention. For example, the term "one or more" as used herein, at least in part according to the present invention, can be used to describe any component, structure, or feature in the singular, or in the plural, to describe a combination of components, structures, or features. Similarly, terms such as "a," "an," or "the" can also be understood, at least in part according to the present invention, to convey either singular or plural usage. Furthermore, the term "based on..." can be understood not necessarily to convey an exclusive set of factors, but can instead, at least in part, depend on the context, allowing for additional factors that do not necessarily have to be explicitly described.

[0030] This invention constructs rice OsPSKR10 gene knockout mutants, inoculates them with rice blast fungus, bacterial blight fungus, and sheath blight fungus respectively, and compares them with wild type. The results show that the OsPSKR10 gene has a negative regulatory effect on the resistance of rice to various diseases, and can be effectively applied to molecular improvement breeding of rice disease resistance.

[0031] Example 1: Bioinformatics Analysis of OsPSKR10 Protein

[0032] The OsPSKR10 protein is a rice protein belonging to the LRR-RLK family, located on chromosome 2 of rice. Its accession number in the Japanese Rice Annotation Project Database (RAP-DB) is Os02g0629400, and its accession number in the MSU Rice Genome Project Database (RGAP7) is LOC_Os02g41890.

[0033] The amino acid sequence of the OsPSKR10 protein is shown in SEQ ID No. 4. The DNA sequence of the OsPSKR10 gene in the rice genome is shown in SEQ ID No. 1, its cDNA sequence is shown in SEQ ID No. 2, and its CDS sequence is shown in SEQ ID No. 3.

[0034] Example 2: Construction of OsPSKR10 gene knockout lines

[0035] 1. Construction of the OsPSKR10 gene knockout vector.

[0036] OsPSKR10 gene knockout mutant plants were constructed using CRISPR / Cas9 gene editing technology. First, the target design function of the CRISPR-GE website (http: / / skl.scau.edu.cn) was used to determine the gRNA sequences targeting the OsPSKR10 gene. gRNA1, as shown in SEQ ID NO.5, has the sequence: AACTCACCACCACATGGCCA; gRNA2, as shown in SEQ ID NO.6, has the sequence: CAGTGCACTAGCATCACCA. Subsequently, the website's primer design function was used to design dual-target knockout primers OsPSKR10-OsU6aT1F / R and OsPSKR10-OsU6aT2F / R, with sequences shown in Table 1. Using overlapping PCR and enzyme digestion-ligation method, gRNA1 and gRNA2 were ligated to the Bsa I site of the intermediate vectors pYLgRNA-OsU6a and pYLgRNA-OsU6b, respectively. Then, the pYLgRNA-OsU6a and pYLgRNA-OsU6b vectors containing gRNA1 and gRNA2 sequences, respectively, were digested with Bsa I and assembled into the pYLCRISPR / Cas9Pubi-H vector using the "Kinmen" cloning-ligation method, thus obtaining the OsPSKR10 gene knockout vector.

[0037] Table 1:

[0038] name Sequence (5'-3') OsPSKR10-OsU6aT1F gccgAACTCACCACCACATGGCCA OsPSKR10-OsU6aT1R aaacTGGCCATGTGGTGGTGAGTT OsPSKR10-OsU6aT2F gttgCAGTGCACTAGCATCACCA OsPSKR10-OsU6aT2R aaacTGGTGATGCTAGTGCACTG

[0039] 2. Genetic transformation of transgenic rice.

[0040] The gene knockout vector pYLCRISPR / Cas9Pubi-H-OsPSKR10-gRNA was transformed into Agrobacterium tumefaciens EHA105. Agrobacterium tumefaciens transformation was performed using callus tissue of Nipponbare rice variety as the recipient. After screening, differentiation and regeneration processes, T0 generation transgenic plants were obtained.

[0041] Example 3: Screening and identification of OsPSKR10 gene knockout mutants

[0042] T0 generation rice seedlings with healthy root systems were individually planted in a greenhouse. After two weeks of greenhouse cultivation, genomic DNA was extracted from leaves of each plant. Using the genomic DNA as a template, primers OsPSKR10-KO-F / R were designed upstream and downstream of the target site, and their sequences are shown in Table 2.

[0043] Table 2:

[0044]

[0045] PCR amplification and agarose gel electrophoresis were performed, and the results are as follows: Figure 1 As shown. In Figure 1 In the text, ospskr10-1 to ospskr10-20 represent different transgenic positive lines of the T0 generation.

[0046] The PCR products were subjected to first-generation sequencing analysis, and the sequencing results were compared with the gDNA sequence of OsPSKR10 using Geneious software. Two homozygous knockout lines, ospskr10-1 and ospskr10-2, were obtained. The results are as follows: Figure 2 As shown.

[0047] The amino acid sequence of the OsPSKR10 protein in the ospskr10-1 mutant line is shown in SEQ ID NO.7, and is: MVCSLMMQLTTTW*, where * indicates that the deletion of a nucleotide causes premature termination of translation after frameshift. The amino acid sequence of the OsPSKR10 protein in the ospskr10-2 mutant line is shown in SEQ ID NO.8, and is: MVCSLMMQLTTTWTMAFLFLLVFP PAVPLPNQLLESKLL*; where * indicates that the deletion of a nucleotide causes premature termination of translation after frameshift.

[0048] T0 generation homozygous plants were propagated to obtain T1 generation mutant rice. Genomic DNA was extracted from the leaves of T1 generation mutant plants, and they were screened and identified using PCR and sequencing technologies. The sequencing results were aligned using Geneious sequencing. The results were compared with... Figure 2 Through consistent research, two mutant lines, ospskr10-1 and ospskr10-2, which are stably heritable, were ultimately obtained.

[0049] Example 4: Disease incidence of rice blast fungus after spray inoculation with wild-type and OsPSKR10 gene knockout mutant rice.

[0050] Rice seedlings that were 18 days old (three-leaf stage, when the third leaf was fully expanded) were used for spray inoculation with a suspension of rice blast fungus spores. 10 mL of a 2×10⁻⁶ spore concentration was used. 5 A suspension of spores of the rice blast fungus strain Guy11 (containing 0.25% gelatin) at CFU / mL was sprayed onto the leaves of seedlings of ospskr10-1 mutant, ospskr10-2 mutant, and wild-type Nipponbare rice. After inoculation, the rice plants were cultured in an incubator until disease development occurred. The incubator was set with humidity above 90% and temperature at 25℃; after inoculation, the plants were kept in darkness for 24 hours, followed by alternating light and dark periods of 12 hours each. The growth and disease status of the rice plants were observed daily after inoculation. Three days after inoculation, small lesions were observed on the surface of the rice leaves, and these lesions gradually expanded. On the 7th day after inoculation, diseased leaves were harvested for disease resistance analysis.

[0051] Figure 3 This diagram illustrates the disease development of OsPSKR10 gene knockout mutant and wild-type rice after spray inoculation with rice blast fungus. Figure 3 Figures (A) and (B) show that the number of lesions on leaves of the ospskr10-1 and ospskr10-2 mutants was significantly reduced compared to the wild type.

[0052] Ten diseased plants of each species were selected, and an equal number of diseased leaves were cut from each plant. Total DNA was extracted from the leaves, and qPCR analysis was performed using specific primers for the MgPot2 gene of rice blast fungus and the OsUbq gene of rice, respectively. The primers MgPot2-qPCR-F / R and Ubq-qPCR-F / R were detected, and their sequences are shown in Table 3. Then, according to Formula 2... [CT(OsUbq)-CT(MoPot2)] The relative growth of rice blast fungus in rice leaves was calculated. Figure 3 Figure (C) shows that the biomass of rice blast fungus in the leaves of the ospskr10-1 mutant and the ospskr10-2 mutant is significantly lower than that of the wild type, indicating that OsPSKR10 negatively regulates rice blast resistance.

[0053] Table 3:

[0054]

[0055]

[0056] Example 5: Disease incidence of rice blast fungus inoculated into wild-type and OsPSKR10 gene knockout mutant rice using the perforation method.

[0057] One-and-a-half-month-old *ospskr10-1* mutants, *ospskr10-2* mutants, and wild-type mature *Nipponbare* rice were used for leaf ablation inoculation experiments with *Guy11* blast fungus. First, rice leaves were damaged using a perforation device. Then, mycelial blocks containing spores of *Guy11* blast fungus were collected using a sterilized perforator with a diameter of 3 mm. The mycelial blocks were fixed to the leaf wounds with transparent tape. At least 60 mycelial blocks were inoculated for each strain. After inoculation, the rice plants were placed in a greenhouse at 25℃, a photoperiod of 12L:12D, and 80% humidity to continue growing. The inoculated plants were sprayed with water twice daily, morning and evening, to maintain humidity, until disease development occurred. On the 7th day after inoculation, diseased leaves were cut off, and the tape and mycelial blocks were carefully removed. Photos were taken, the affected area was tallied, and the biomass of *Guy11* blast fungus at the affected sites was measured.

[0058] Figure 4 This diagram illustrates the disease development of OsPSKR10 gene knockout mutant and wild-type rice after perforation inoculation with rice blast fungus. Figure 4 Figures (A) and (B) show that, compared with the wild type, the lesions on the leaves of the ospskr10-1 mutant and the ospskr10-2 mutant were significantly reduced. The diseased area of ​​all leaves was counted using ImageJ software, and the results were consistent with the phenotype, that is, the diseased area of ​​the wild type was significantly larger than that of the OsPSKR10 gene knockout mutant line.

[0059] Ten diseased leaves were selected for each type, and equal amounts of leaves from the diseased parts were cut off. Total DNA was extracted from each leaf. The pathogen biomass at the diseased sites was analyzed using the qPCR detection method described in Example 4. Figure 4 Figure (C) shows that the biomass of rice blast fungus in the leaves of the ospskr10-1 mutant and the ospskr10-2 mutant is significantly lower than that of the wild type, which once again proves that OsPSKR10 has a negative regulatory effect on rice blast resistance.

[0060] Example 6: Disease incidence of bacterial blight in wild-type and OsPSKR10 gene knockout mutant rice after inoculation with bacterial blight pathogen.

[0061] PXO99, a race of bacterial blight pathogen stored at -80℃, was activated and cultured on NB medium at 28℃ for 3 days. Colonies were then picked and inoculated into 20 ml of liquid NB medium and cultured overnight at 28℃ for 16 h. The bacteria were then collected by centrifugation at 5000 rpm for 5 min, resuspended in 5 mL of sterile water, and the OD600 value of the bacterial suspension was measured using a spectrophotometer. The OD600 value was adjusted to OD1.0 with sterile water. Bacterial blight pathogens were inoculated using the leaf-cutting method during the booting stage of ospskr10-1 mutant, ospskr10-2 mutant, and wild-type Nipponbare rice. Clean scissors were dipped in the bacterial suspension, and a 2-3 cm section from the tip of the flag leaf was cut off. Two flag leaves were cut for each dip in the suspension, and at least five flag leaves were cut from each plant. Photos were taken 21 days after inoculation, and the average lesion area was recorded.

[0062] Figure 5 A schematic diagram showing the disease incidence of OsPSKR10 gene knockout mutant and wild-type rice after inoculation with bacterial blight pathogen. Figure 5 Figure (A) shows that, compared with the wild type, the lesions on the leaves of the ospskr10-1 mutant and the ospskr10-2 mutant were significantly reduced.

[0063] Measure the length of the dead leaf (lesion length) and the length of the entire sword leaf, and calculate the relative lesion area [(lesion length / total leaf length) × 100%]. Figure 5 Figure (B) shows that the relative lesion area of ​​the ospskr10-1 mutant and the ospskr10-2 mutant knockout lines was significantly lower than that of the wild type, indicating that OsPSKR10 negatively regulates rice bacterial blight resistance.

[0064] Example 7: Disease incidence of wild-type and OsPSKR10 gene knockout mutant rice after inoculation with sheath blight pathogen.

[0065] 1. Activation of the sheath blight pathogen

[0066] The laboratory-preserved *Rhizoctonia solani* strain YN-7 was inoculated onto PDA medium and cultured in the dark at 28°C for 2-3 days. Then, the mycelial blocks were inoculated onto PDA medium and cultured again in the dark at 28°C for 2-3 days to activate the mycelium.

[0067] 2. Inoculation of detached leaves with *Rhizoctonia solani*

[0068] Take 1.5-month-old ospskr10-1 mutant, ospskr10-2 mutant, and wild-type Nipponbare rice plants. Cut 10 leaves of equal size and condition from each rice line, lay them flat on moist filter paper in a tray, and cover the cut ends with moist gauze to maintain humidity. Use a sterilized 4mm diameter sampler to cut equal-sized mycelial blocks from activated Rhizoctonia solani culture medium, invert them and place them on the central surface of the rice leaves. Cover the tray with plastic wrap to maintain humidity. Place the inoculated leaves in an incubator at 28℃, photoperiod 16L:8D, and humidity 90% for 2-3 days, then photograph and analyze the disease development of the leaves.

[0069] Figure 6 A schematic diagram showing the disease incidence of OsPSKR10 gene knockout mutant and wild-type rice after inoculation with Sheath blight pathogen. Figure 6 Figure (A) shows that the disease incidence on leaves of the ospskr10-1 mutant and ospskr10-2 mutant was significantly milder compared to the wild type.

[0070] Five diseased leaves were selected from each material, and equal amounts of leaves from the diseased parts were cut off. Total DNA was extracted from each leaf. Then, qPCR analysis was performed using specific primers for the RsGAPDH gene of *Rhizoctonia solani* and the OsUbq gene of rice. The primer RsGAPDH-qPCR-F / R was detected, and the sequence is shown in Table 4. Finally, according to Formula 2... [CT(OsUbq)-CT(RsGAPDH)] The relative growth of *Rhizoctonia solani* in rice leaves was calculated.

[0071] Table 4:

[0072]

[0073]

[0074] Figure 6 Figure (B) shows that the pathogen biomass in the diseased parts of the leaves of the ospskr10-1 mutant and the ospskr10-2 mutant was significantly lower than that in the leaves of wild-type plants, indicating that OsPSKR10 negatively regulates rice sheath blight resistance.

[0075] 3. Inoculation of *Rhizoctonia solani* using the live leaf sheath embedding method

[0076] 0.8mm thick, 2mm × 10mm wood chips were evenly spread in a 9cm diameter glass petri dish and sterilized by high temperature and high pressure. 6mL of PDB culture medium was added to the sterilized petri dish to submerge the wood chips. An 8mm diameter activated mycelial block was picked and placed in the center of the culture medium. The dish was incubated at 28℃ in the dark for 3 days until the surface of the wood chips was covered with mycelia, at which point it could be used as inoculum. The ospskr10-1 mutant, ospskr10-2 mutant, and wild-type Nipponbare were inoculated with *Rhizoctonia solani* wood chips using the embedding method before the end of the tillering stage of rice. The wood chip inoculum was embedded into the leaf sheath (the third leaf sheath from the bottom) 1cm below the pulvinus of the third leaf from the top of the main stem of the rice plant using tweezers. At this point, the leaf sheath of the second leaf from the bottom no longer elongated, and the wood chip inoculum was fixed there. Three main tillers were inoculated per rice plant, and five seedlings of each material were inoculated. Maintaining humidity above 90% after inoculation allowed for disease development. Symptoms can be seen 24-48 hours after inoculation, and mycelia are present at the affected sites. Take photos to analyze the disease situation.

[0077] Figure 6 Figure (C) shows that, compared with the wild type, the leaf sheaths of the ospskr10-1 mutant and the ospskr10-2 mutant were smaller, which once again proves that OsPSKR10 has a negative regulatory effect on rice sheath blight resistance.

[0078] Example 8: Culture of wild-type and OsPSKR10 gene knockout mutant rice suspension cell lines

[0079] 1. Induction of rice callus

[0080] After dehulling, seeds of wild-type Nipponbare and those identified as homozygous mutants of ospskr10-1 and ospskr10-2 were placed in 50 mL centrifuge tubes and rinsed once with distilled water, then the waste liquid was discarded. The seeds were then rinsed with 75% ethanol for 1 min, and the waste liquid was discarded. A 10% sodium hypochlorite solution was added, and the tubes were sterilized at room temperature for 1 h on a four-dimensional rotating apparatus. The waste liquid was then discarded on a clean bench, and the seeds were rinsed five times with sterile water. The seeds were then transferred to 2N6P induction medium and cultured in the dark at 30°C for one month.

[0081] 2. Culture of rice suspension cell lines

[0082] Select healthy callus tissue and transfer it to a 100mL sterile Erlenmeyer flask. Add 25mL of R2S culture medium and incubate on a shaker at 30℃ and 110rpm under light. Change the culture medium weekly, discarding any large cell clusters, and maintain aseptic technique during subculturing.

[0083] Example 9: Chitin treatment of wild-type Nipponbare and OsPSKR10 gene knockout rice suspension cell lines to detect PR gene expression.

[0084] Wild-type Nipponbare rice cells and ospskr10-1 and ospskr10-2 gene knockout suspension cell lines were cultured and the culture medium was aspirated. At each time point, two 0.05g aliquots of each cell line were weighed and placed in 12-well cell culture plates pre-filled with 1 mL of LR2S medium. One aliquot of cells was then discarded and replaced with 1 mL of medium containing 5 μg / mL Chitin, serving as the treatment group; the other aliquot of cells treated with only the culture medium served as the control group. Cells were collected at 0h, 1h, 3h, 6h, and 9h after Chitin treatment, and total RNA was extracted from the samples. Using qRT-PCR with OsUbq as an internal reference gene, the relative expression levels of the PR genes OsPAL1, OsPBZ1, OsChitinase1, and OsChitinase3 in rice cells were quantitatively detected. The sequences of the primers for PR gene detection, OsPAL1-qPCR-F / R, OsPBZ1-qPCR-F / R, OsChitinase1-qPCR-F / R, and OsChitinase3-qPCR-F / R, are shown in Table 5.

[0085] Table 5:

[0086] name Sequence (5'-3') OsPAL1-qPCR-F TGAATAACAGTGGAGTGTGGAG OsPAL1-qPCR-R AACCTGCCACTCGTACCAAG OsPBZ1-qPCR-F GGTGTGGGAAGCACATACAA OsPBZ1-qPCR-R GTCTCCGTCGAGTGTGACTTG OsChitinase1-qPCR-F GCACTGATAACCACTGATCGG OsChitinase1-qPCR-R TGTGGGCATTACTGATGATTG OsChitinase3-qPCR-F GCGATAACCTGGATTGCTACAACC OsChitinase3-qPCR-R GTATTTTATTCGTCTGCTCGG

[0087] Figure 7 This is a schematic diagram illustrating the results of the analysis of defense-related gene expression levels. After chitin treatment of rice cells, the relative expression level of OsPAL1 in wild-type Nipponbare and OsPSKR10 knockout rice suspension cell lines reached a peak at 1 hour, and then gradually decreased over time. The relative expression levels of OsPBZ1, OsChitinase1, and OsChitinase3 all reached a peak at 3 hours, and then began to decrease. The expression levels of the PR gene in the ospskr10-1 and ospskr10-2 knockout suspension cell lines were significantly higher than those in wild-type Nipponbare cells. These results indicate that OsPSKR10 acts as a negative regulator of immunity, inhibiting the expression of genes related to plant defense responses.

[0088] Example 10: Chitin treatment of wild-type Nipponbare and OsPSKR10 gene knockout rice suspension cell lines to detect ROS accumulation.

[0089] Wild-type Nipponbare cells and ospskr10-1 and ospskr10-2 gene knockout suspension cell lines were cultured and the culture medium was aspirated. Using white 96-well microplates, 100 μl of R2S culture medium was added to each well. 6.4 mg of cells were weighed and added to each well. Eight replicates were prepared for each material, representing biological replicates, for both the control and treatment groups. The weighed cells were incubated at 30°C in the dark for 16 h. Then, all culture medium was aspirated using a pipette. 100 μl of R2S culture medium containing 0.5 mM L-012, 20 μg / mL horseradish peroxidase, and 5 μg / mL Chitin was added to the treatment group cells, while 100 μl of R2S culture medium containing 0.5 mM L-012 and 20 μg / mL horseradish peroxidase was added to the control group cells. Immediately place the sample into a BioTek Synergy 2 instrument for ROS measurement. Use the kinetic detection function to measure every 1 minute for 61 minutes.

[0090] Figure 8 This is a schematic diagram of the reactive oxygen species (ROS) burst detection results. Compared with wild-type Nipponbare cells, the ROS accumulation in the ospskr10-1 gene knockout suspension cell line and the ospskr10-2 gene knockout suspension cell line was significantly increased, indicating that OsPSKR10 negatively regulates the innate immune response of rice by inhibiting the ROS burst.

[0091] The above description is merely a specific embodiment of this application. Under the guidance of the above teachings, those skilled in the art can make other improvements or modifications based on the above embodiments. Those skilled in the art should understand that the above specific description is only to better explain the purpose of this application, and the scope of protection of this application should be determined by the scope of the claims.

[0092] Furthermore, those skilled in the art will understand that although some embodiments described herein include certain features but not others included in other embodiments, combinations of features from different embodiments are intended to be within the scope of this application and form different embodiments. For example, in the following claims, any of the claimed embodiments can be used in any combination.

Claims

1. A method for improving the broad-spectrum disease resistance of rice, characterized in that, Rice plants were obtained by knocking out the rice immune negative regulatory gene OsPSKR10 in rice. The cDNA sequence of OsPSKR10 is shown in SEQ ID NO.2; OsPSKR10 negatively regulates the innate immune response in rice by inhibiting the expression of genes related to plant defense responses and suppressing the burst of reactive oxygen species. The rice plants are simultaneously resistant to rice blast caused by *Pseudomonas aeruginosa*, bacterial blight caused by *Bacillus thuringiensis*, and sheath blight caused by *Rhizoctonia solani*.

2. The method according to claim 1, characterized in that, The amino acid sequence of OsPSKR10, the rice immune negative regulatory protein encoded by OsPSKR10, is shown in SEQ ID NO.

4.

3. The method according to claim 1, characterized in that, The gRNA sequence targeting the rice immune negative regulatory gene OsPSKR10 was ligated to the Bsa I site of the pYLgRNA-OsU6a vector. The pYLgRNA-OsU6a vector with the ligated gRNA sequence was then digested with Bsa I and assembled into the pYLCRISPR / Cas9Pubi-H vector using the Jinmen cloning ligation method, thereby obtaining the gene knockout vector of the rice immune negative regulatory gene OsPSKR10.

Images