A SNP marker associated with porcine vomitoxin resistance and its application

By detecting SNP markers in the promoter region of the LIG4 gene on the pig genome, pigs with high resistance to vomitoxin were identified, solving the problem of DON contamination harming the pig intestines, realizing molecular marker-assisted breeding, and improving the disease resistance and economic benefits of pigs.

CN118910282BActive Publication Date: 2026-06-30YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-29
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively prevent the harm to pigs caused by deoxynivalenol (DON) contamination in feed, which can lead to intestinal damage and immune system disorders. Furthermore, existing methods for preventing and removing mold are insufficient to completely eliminate the risk of mycotoxins.

Method used

A SNP marker associated with porcine vomitoxin resistance is provided, located at Chromosome 11:75541817 in the porcine genome, with bases C or A. By detecting SNP variations in the promoter region of the LIG4 gene, PCR amplification is performed using sgRNA primer pairs to identify pigs with high vomitoxin resistance, which can be used for marker-assisted breeding.

Benefits of technology

By promoting the expression of the LIG4 gene, the pigs' resistance to DON can be enhanced, the disease resistance of the herd can be improved, and the economic benefits of pig farming enterprises can be maximized.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910282B_ABST
    Figure CN118910282B_ABST
Patent Text Reader

Abstract

This invention discloses a SNP marker for resistance to porcine vomitoxin (DON) and its application. The SNP marker is located at Chromosome 11:75541817 in the porcine genome, and its base is C or A. This SNP can enhance resistance to DON by promoting the expression of the LIG4 gene. The C / A mutation can be used as a molecular marker for breeding porcine mycotoxins. This SNP genetic marker can be used to assist in the selection of AA-type individuals with good DON resistance, which is beneficial to improving the disease resistance of the population and maximizing the economic benefits of pig farming enterprises.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an SNP marker related to porcine vomitoxin resistance and its application, belonging to the field of genetic breeding and gene engineering technology. Background Technology

[0002] Deoxynivalenol (DON) is a toxic secondary metabolite produced by Fusarium spp. Currently, DON contamination in feed ingredients and feed is widespread, seriously threatening livestock and poultry health and human health. DON is a foodborne environmental toxin; pigs are highly sensitive to it, as it can cause intestinal damage and immune system disorders, leading to decreased appetite, stunted growth, and some impact on reproductive development. Our ideal goal is to eliminate mycotoxins from the feed source and throughout all stages of production; however, this is difficult to achieve completely in practice. Existing methods for preventing and removing mycotoxins have limitations and cannot completely eliminate the risk of livestock and poultry exposure to mycotoxins in livestock farming.

[0003] DNA ligase 4 (LIG4) is a core protein in the nonhomologous endjoining (NHEJ) repair pathway, playing a crucial role in DNA replication and repair. Studies have found that LIG4 expression is significantly upregulated in porcine intestinal cytotoxicity after DON exposure. LIG4 counteracts DON-induced porcine intestinal cell damage by regulating cell proliferation, oxidative stress, DNA damage, and apoptosis. Therefore, investigating SNP variations in the LIG4 promoter region is of great significance for breeding pig breeds resistant to vomitoxin.

[0004] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. SNPs exhibit polymorphism involving only a single base variation, manifesting as transitions, transversions, insertions, and deletions. SNPs possess genetic stability and are easily detected, making them suitable as genetic markers for gene mapping, cloning, genetic breeding, and diversity research.

[0005] Molecular marker-assisted selection breeding utilizes DNA molecular markers to select breeding materials and comprehensively improve important economic traits in livestock and poultry. Molecular breeding has opened up a completely new avenue for livestock breeding. With the development of modern molecular biotechnology, molecular markers are widely used in livestock breeding, significantly improving the genetic progress of important economic traits and disease resistance in livestock, and greatly promoting the development of modern animal husbandry. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a SNP marker related to porcine vomitoxin resistance and its application, which can be used to assist in the selection of individuals with good DON resistance.

[0007] Technical solution: To solve the above technical problems, the present invention provides an SNP marker related to porcine vomitoxin resistance, wherein the SNP marker is located at Chromosome 11:75541817 in the porcine genome and its base is C or A.

[0008] Among them, the SNP marker contains a polymorphic site with genotype A in individual pigs with significantly higher resistance to vomitoxin than genotype C.

[0009] The present invention also provides an sgRNA primer pair for detecting the SNP marker, the nucleotide sequence of which is shown in SEQ ID NO. 3-4.

[0010] The present invention also provides a detection reagent or kit containing the primer pair.

[0011] The kit also includes template DNA, the primer pair or PCR mix as described in claim 3.

[0012] The present invention also provides a method for identifying or breeding pigs with vomitoxin resistance, comprising the following steps:

[0013] (1) Extract genomic DNA from the pigs to be tested;

[0014] (2) Using the genomic DNA of the pig to be tested as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.34;

[0015] (3) Analyze the PCR amplification products; when the PCR amplification products contain the SNP marker, the pigs to be tested are pigs with high resistance to vomitoxin; when the PCR amplification products do not contain the SNP marker, the pigs to be tested are pigs with low resistance to vomitoxin.

[0016] The PCR amplification reaction system in step (2) includes template DNA, the primer pair or PCR mix.

[0017] The PCR amplification reaction procedure in step (2) is as follows: 95℃ for 3 minutes; 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 15 seconds, 30 cycles; 72℃ for 5 minutes.

[0018] Step (3) involves detecting the genotype located at 479 bp upstream of the LIG4 gene promoter region. Individual pigs with genotype A have significantly higher resistance to vomitoxin than those with genotype C.

[0019] This invention also provides any of the following applications of the SNP marker, the primer pair, or the detection reagent or kit:

[0020] (1) Used for the identification and improvement of pigs with high resistance to vomitoxin;

[0021] (2) Used for early prediction of porcine vomitoxin resistance;

[0022] (3) Used for molecular marker-assisted breeding related to porcine vomitoxin resistance.

[0023] This SNP can be used as a molecular genetic marker to find gene loci that are related to or closely linked to vomitoxin resistance, so as to directly select the genotype of Meishan pigs or mark-assisted selection, thereby accelerating the breeding of new Meishan pig breeds with vomitoxin resistance.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The genetic marker locus provided is located at Chromosome 11:75541817 in the pig genome, and its base is C or A. This SNP can enhance resistance to DON by promoting the expression of the LIG4 gene; (2) The C / A mutation can be used as a molecular marker for disease-resistant breeding of pig mycotoxins. The SNP genetic marker can be used to assist in the selection of AA type individuals with good resistance to DON, which is conducive to improving the disease resistance of the population and maximizing the economic benefits of pig farming enterprises. Attached Figure Description

[0025] Figure 1 SNPs were identified in the core promoter region of the LIG4 gene; where A is a schematic diagram of SNP mutation sites, WT represents wild type and MUT represents mutant type; B shows the detection of SNP mutation sites in different populations.

[0026] Figure 2 To identify the mutation frequency of C / A mutations in the promoter region of the LIG4 gene in a population; where A represents the distribution of CC, CA, and AA genotypes of C / A mutations in the promoter region of the LIG4 gene in Meishan pigs, Dongchuan pigs, Duroc pigs, and Duroc-Landrace-Landrace three-way crossbred pigs; and B represents the detection of LIG4 expression levels in different genotypes in Meishan pigs.

[0027] Figure 3 The changes in LIG4 expression levels before and after DON treatment are shown in Figure 1. A represents the sequencing results of LIG4 before and after DON treatment; B represents the changes in LIG4 transcriptional expression before and after DON treatment; and C represents the changes in LIG4 protein expression before and after DON treatment.

[0028] Figure 4The effect of SNP markers on LIG4 gene expression; A is a schematic diagram of the construction of wild-type and mutant vectors for this SNP site; B is the detection of dual-luciferase activity of wild-type and mutant vectors;

[0029] Figure 5 Small interfering RNA and overexpression vector for the LIG4 gene were constructed; where A is the verification of the interference efficiency of the LIG4 gene; and B is the verification of the overexpression efficiency of the LIG4 gene.

[0030] Figure 6 To investigate the effect of LIG4 overexpression on DON-induced functional impairment in IPEC-J2 cells; A) flow cytometry was used to detect cellular ROS levels; B) indirect immunofluorescence was used to detect γ-H2AX expression; C) Western blotting was used to detect the expression levels of pro-apoptotic factors BAX and Cleaved Caspase 3.

[0031] Figure 7 To detect γ-H2AX expression by Western blotting;

[0032] Figure 8 To detect apoptosis levels using flow cytometry;

[0033] Figure 9 ROS levels were detected using cellular immunofluorescence.

[0034] Figure 10 To detect cell cycle distribution using flow cytometry;

[0035] Figure 11 To investigate the effect of LIG4 knockdown on DON-induced functional impairment in IPEC-J2 cells; A: flow cytometry to detect cellular ROS levels; B: ELISA to detect cellular 8-OHdG secretion levels; C: indirect immunofluorescence assay to detect γ-H2AX expression.

[0036] Figure 12 A represents the detection of γ-H2AX expression by Western blotting; Figure 12 B represents the Western blot assay used to detect the expression levels of pro-apoptotic factors BAX and Cleaved Caspase3.

[0037] Figure 13 To detect apoptosis levels using flow cytometry;

[0038] Figure 14 ROS levels were detected using cellular immunofluorescence.

[0039] Figure 15 To detect cell cycle distribution by flow cytometry. Detailed Implementation

[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0041] The cells, viruses, and main reagents used in this invention are as follows:

[0042] Cell line: Porcine small intestinal epithelial cells (IPEC-J2 cells, preserved in our laboratory) were cultured in DMEM (BasalMedia, Shanghai, China) containing 10% fetal bovine serum (Ozfan, Nanjing, China).

[0043] Main reagents: DON powder was purchased from Pribolab (Qingdao, China), cell cycle assay kit was purchased from Beyotime (Shanghai, China), reactive oxygen species assay kit and apoptosis assay kit were purchased from Solarbio (Beijing, China).

[0044] The reagents not described in detail in the examples are all conventional reagents and can be obtained commercially; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0045] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0046] Example 1: Identification of SNPs in the LIG4 gene promoter region

[0047] Ear samples were collected from 144 Meishan pigs, 124 Dongchuan pigs, 253 Duroc-Landrace-Landrace three-way crossbred pigs, and 56 Duroc pigs, respectively. DNA was extracted using the Cell / Tissue DNA Isolation Mini Kit (Nanjing Novizan Biotechnology Co., Ltd., DC102-01), with an equal amount of DNA taken from each individual for pooling.

[0048] Primers were designed based on the porcine LIG4 gene (GeneID: 100155891) sequence indexed in the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, including forward primer F: SEQ ID NO.3: 5'-AAGCGACAGTAAACACAGTCA-3' and reverse primer R: SEQ ID NO.4: 5'-GCAATACTGAAATGAATCAGTT-3'. Using the genomic DNA in the above mixed pool as a template, the nucleotide fragment containing the SNP to be tested was amplified. The genotypes of the Meishan pigs to be tested were detected using Sanger sequencing. Based on the sequencing information of the samples, the genotypes can be divided into wild type (base C, sequence as shown in SEQ ID NO.1: AAGCAGTAAACACAGTCAGAGGCTTTGTCTGGAAGAAGAAGTTACCTGTTTTGTGGGAAAGGTCCTTATCCGTGTAGGAGTTCAGTTCAGCCAAATTTCAATTCAGTGAGCTGGTGACTTGTTCAAAACATCATTCTAAGAAGTTTGTTTCTGGTGCTGGGTGGCAGTCTGAAAGAAAAAAGAGGAGAAATATAAGAAAAGACCTTACCGCAAAAGCCCCGAAATGAAGTGAATTGAGCCTTGTTTTTCTGTCATCATTAGCAACAATATTCTTTTGCACTGAGTCATTGTTTCAAGGAAAGTTGGAAGTTAGAAGTCGGTTGAACTGATTCATTTCAGTATTGC) and mutant type (base A, sequence as shown in SEQ ID NO.1). Shown in NO.2: AAGCGACAGTAAACACAGTCAGAGGCTTTGTCTGGAAGAAGAAGTTACCTGTTTTGTGGGAAAGGTCCTTATCCGTGTAGGAGTTCAGTTCAGCCAAATTTCAATTCAGTGAGCTGGTGACTTGTTCAAAACATCATTCTAAGAAGTTTGTTTCTGGTGCTGGGTGGCAGT CTGAAAGAAAAAAGAGGAGAAATATAAGAAAAGACCTTACCGCAAAAGCCCCGAAATGAAGTGAATTGAGCCTTGTTTTTCTGTCATCATTAGCAACAAATATTTCTTTTGCACTGAGTCATTGTTTCAAGGAAAGTTGGAAGTTAGAAGTAGGTTGAACTGATTCATTTCAGTATTGC).The PCR reaction system (20 μl) consisted of: 1 μl of 50 ng / μl template DNA, 1 μl each of primers F and R (10 μM), 10 μl of SYBR Green Master Mix, and 7 μl of double-distilled water. The PCR reaction program was: 95℃ for 3 minutes; 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 15 seconds, for 30 cycles; 72℃ for 5 minutes.

[0049] The results are as follows Figure 1 As shown in A, the SNP site is located 479 bp upstream of the promoter region of the LIG4 gene, with the bases being C or A. Its location on the pig genome is Chromosome 11:75541817.

[0050] Example 2: Identification of the mutation frequency of the C / A mutation in different populations and intestinal LIG4 expression.

[0051] To further determine the mutation status of the C / A mutation in the LIG4 gene promoter region among different pig breeds (populations), this invention selected 144 Meishan pigs and 124 Dongchuan pigs (both local breeds), 56 Duroc pigs (imported from abroad), and 253 Duroc-Landrace-Landrace three-way crossbred pigs (DLY pigs). Following the conditions described in Example 1, the core promoter region of the LIG4 gene was amplified by PCR and sequenced. The genotype frequency and allele frequency at this site were calculated. The results showed ( Figure 1 B) C / A mutations were detected in pig samples from different populations, with three genotypes detected: CC, CA, and AA. The dominant allele for all four pig breeds was A. The frequency of the A allele was highest in Meishan pigs and Duroc-Landrace-Landrace three-way crossbred pigs, at 93% and 88% respectively, significantly higher than that of Dongchuan pigs (66%) and Duroc pigs (71%). The results are as follows... Figure 2 As shown in Figure A.

[0052] Table 1

[0053]

[0054]

[0055] The genotype frequencies and allele frequencies of the four pig breeds were analyzed using a chi-square test, which confirmed that all pig breeds except Meishan pig conformed to the Hardy-Weinberg law. The genotype frequencies and allele frequencies of the C / A loci are shown in Table 1.

[0056] Meanwhile, to further verify the effect of C / A on LIG4 expression in the intestinal tissue of individual pigs, intestinal tissues were collected from 18 Meishan pigs. After genotyping, RT-qPCR was used to detect LIG4 gene expression. The reverse transcription reaction system consisted of 20 μl: 2000 ng cDNA, 4 μl of 5x HiScriptⅢqRT SuperMix, and ddH2O to make up to 20 μl. The reaction program was: 37℃, 15 min; 85℃, 5 s; stored at 4℃ for later use. The RT-qPCR reaction system consisted of 20 μl: 1 μl cDNA, 1 μl LIG4-F (SEQ ID NO. 3), 1 μl LIG4-R (SEQ ID NO. 4), 10 μl SYBR Green Master Mix, and 7 μl ddH2O. The reaction program was: 95℃, 5 min; 95℃, 10 s; 60℃, 30 s, 40 cycles. The results are as follows: Figure 2 As shown in Figure B, LIG4 expression was significantly increased in the intestinal tissues of individuals with CA and AA genotypes.

[0057] Example 3: Changes in LIG4 expression levels before and after DON treatment

[0058] This invention, using RT-qPCR detection, revealed a significant increase in LIG4 mRNA levels after DON exposure, as shown in the following results. Figure 3 As shown in Figure A. Therefore, this invention further examined the changes in LIG4 expression after treating IPEC-J2 cells with different DON concentrations. With increasing DON concentration and treatment time, LIG4 expression levels showed a significant upward trend. At 2 μg / mL DON exposure for 48 h, its expression reached its peak; while at 3 μg / mL DON exposure for 48 h, LIG4 expression significantly decreased compared to other concentrations, as shown in Figure A. Figure 3 As shown in Figure B. Western blot analysis showed that LIG4 protein expression levels increased in a dose-dependent manner after 48 hours of DON exposure, as indicated in Figure B. Figure 3 As shown in Figure C (with GAPDH as an internal control). RNA and proteins were extracted from IPEC-J2 cells in the DON-treated group and the control group using TRIzol and cell lysis buffer, respectively.

[0059] Cellular RNA was extracted using the TRIzol method, and the RNA was reverse transcribed into cDNA using a reverse transcription kit. The mRNA expression levels of siRNA and the overexpressed target gene (LIG4) were detected using an RT-qPCR kit. The reverse transcription reaction mixture (20 μl) consisted of 2000 ng cDNA, 4 μl of 5x HiScriptⅢqRT SuperMix, and ddH2O to a final volume of 20 μl. The reaction program was 37℃ for 15 min, 85℃ for 5 s, and stored at 4℃ for later use. The qPCR reaction mixture (20 μl) consisted of 1 μl cDNA, 1 μl LIG4-F, 1 μl LIG4-R, 10 μl SYBR Green Master Mix, and 7 μl ddH2O. The reaction program was 95℃ for 5 min, 95℃ for 10 s, and 60℃ for 30 s, for 40 cycles. Among them, quantitative qPCR amplification primers were designed, including forward primer LIG4-F: SEQ ID NO.3: 5'-CCTACAATCCGAACACGCAG-3' and reverse primer LIG4-R: SEQ ID NO.4: 5'-TTCTTCAGGGTCTCGTGTCC-3'.

[0060] The Western blot detection procedure is as follows: Add 200 μl of RIPA lysis buffer (containing 1% PMSF) to each well, incubate on ice for 20 min for lysis, collect cells into 1.5 mL centrifuge tubes, centrifuge at 4 °C for 20 min, add 5× loading buffer, denature in a 98 °C metal bath for 10 min, and store the samples at -20 °C. Samples were transferred to PVDF membranes via polyacrylamide gel electrophoresis, blocked with 5% skim milk (1×TBST dilution) at room temperature for 2 h, washed three times with PBST, and incubated overnight at 4°C with LIG4 antibody (proteintech, 12695-1-AP) diluted 1:1000 and GAPDH antibody (proteintech, 10494-1-AP) diluted 1:5000, followed by three washes with PBST. LIG4 antibody was incubated with horseradish peroxidase-labeled goat anti-rabbit IgG antibody (abcam, ab205718) diluted 1:10000 for 1 h on a shaker, and GAPDH antibody was incubated with horseradish peroxidase-labeled goat anti-mouse IgG antibody diluted 1:10000 for 1 h on a shaker. After three washes with PBST, ECL chemiluminescence reagent was added. All antibodies were diluted using universal antibody diluent (Suzhou Xinsaimei Biotechnology Co., Ltd.).

[0061] Example 4: Effect of the above SNP markers on LIG4 gene expression

[0062] The mutant sequence (SEQ ID NO.2) and the original sequence (SEQ ID NO.1) containing the above SNP marker were ligated into the PGL3-Basic plasmid to obtain the recombinant plasmid expressing the SNP marker (PGL3-LIG4-mut) and the control recombinant plasmid (PGL3-LIG4-wt). The double enzyme digestion system consisted of: 1 μg PGL3-Basic plasmid, 2.5 μL 10× buffer, 1 μL each of HindIII and EcoR I enzymes, and ddH2O to a final volume of 25 μL (37℃ for 3 h). The ligation system (10 μL) included: 1 μL PGL3-Basic plasmid, 1 μL T4 DNA ligase, 1 μL ligation buffer, and 7 μL DNA fragment. The reaction program was 16℃, overnight ligation. The two recombinant plasmids were transfected into porcine small intestinal epithelial cells IPEC-J2 (preserved by our research group), and luciferase activity was measured after 48 hours. The results are as follows: Figure 4 As shown, the recombinant plasmid expressing the SNP marker significantly enhanced LIG4 gene transcription, indicating that the SNP marker can promote the transcriptional activity of the LIG4 gene.

[0063] Example 5: Construction of siRNA interference and overexpression vector for the LIG4 gene

[0064] Based on the porcine LIG4 coding sequence in the NCBI database, small interfering RNA (siRNA) was designed using Thermo Fisher Scientific's online software Invitrogen RNAiDesigner, and the Oligo sequence was synthesized at Suzhou Gemma Gene Co., Ltd. The interfering sequences are: positive strand: SEQ ID NO.5: GCAGACUU AUGUUCAACUUTT, negative strand: SEQ ID NO.6: AAGUUGAACAUAAGUCUGCTT; the negative control sequences are: positive strand: SEQ ID NO.7: UUCUCCGAACGUGUCACGUTT, negative strand: SEQ ID NO.8: ACGUGACACGUUCGGAGAATT.

[0065] An overexpression vector was constructed based on the porcine LIG4 gene mRNA sequence. Primers were designed for the CDS region of the LIG4 gene: forward primer CDS-LIG4-F: SEQ ID NO.9: 5'-ATGGCTGCCTCACAAGCTTCAA-3' and reverse primer CDS-LIG4-R: SEQ ID NO.10: 5'-TTAAACCCAATATTGATTTTCCTCC-3'. The pcDNA3.1 vector was linearized using restriction endonucleases HindIII and EcoRI. The digestion system consisted of 1 μg of vector, 1 μL of BsaI enzyme, 2 μL of rCutSmarBuffer, and enzyme-free water to a final volume of 20 μL. Digestion was performed at 37°C for 2 h, followed by 2% agarose gel electrophoresis for 20 min. The linearized vector (Omega Bio-tek, D2500-01) was purified and recovered using a gel extraction kit. The purified and recovered target DNA fragment (CDS region of the LIG4 gene) was homologously ligated into a linearized vector. The reaction mixture consisted of 144 ng DNA, 160 ng vector, 5 μL 2×ClonExpress Mix, and ddH2O to a final volume of 10 μL. The ligation product was transformed into DH5α competent cells, plated on antibiotic-free LB medium, and incubated at 37°C for 14 h. Positive clones were then picked and cultured in a culture medium for expansion, and plasmids were extracted. Sanger sequencing was performed using universal primer U6 (Sangon Biotech (Shanghai) Co., Ltd.) to screen for positive recombinant plasmids. The positive recombinant plasmids, which were then extracted using an endotoxin-free kit (Tiangen Biotech (Beijing) Co., Ltd.), became the overexpression plasmids.

[0066] LIG4 gene siRNA small interference and overexpression vector were transfected into porcine small intestinal epithelial cells IPEC-J2, and cellular RNA and cellular proteins were extracted using TRIzol and cell lysis buffer, respectively.

[0067] Cellular RNA was extracted using the TRIzol method, and the RNA was reverse transcribed into cDNA using a reverse transcription kit. The mRNA expression levels of siRNA and the overexpressed target gene (LIG4) were detected using an RT-qPCR kit. The reverse transcription reaction mixture (20 μl) consisted of 2000 ng cDNA, 4 μl of 5x HiScriptⅢqRT SuperMix, and ddH2O to a final volume of 20 μl. The reaction program was 37℃ for 15 min, 85℃ for 5 s, and stored at 4℃ for later use. The qPCR reaction mixture (20 μl) consisted of 1 μl cDNA, 1 μl LIG4-F, 1 μl LIG4-R, 10 μl SYBR Green Master Mix, and 7 μl ddH2O. The reaction program was 95℃ for 5 min, 95℃ for 10 s, and 60℃ for 30 s, for 40 cycles. Among them, quantitative qPCR amplification primers were designed, including forward primer LIG4-F: SEQ ID NO.3: 5'-CCTACAATCCGAACACGCAG-3' and reverse primer LIG4-R: SEQ ID NO.4: 5'-TTCTTCAGGGTCTCGTGTCC-3'.

[0068] The Western blot detection procedure is as follows: Add 200 μl of RIPA lysis buffer (containing 1% PMSF) to each well, incubate on ice for 20 min for lysis, collect cells into 1.5 mL centrifuge tubes, centrifuge at 4 °C for 20 min, add 5× loading buffer, denature in a 98 °C metal bath for 10 min, and store the samples at -20 °C. Samples were transferred to a PVDF membrane via polyacrylamide gel electrophoresis, blocked with 5% skim milk (1×TBST dilution) at room temperature for 2 h, and washed three times with PBST. The membrane was then incubated overnight at 4°C with the following antibodies: LIG4 antibody (Proteintech, 12695-1-AP), γ-H2AX antibody (Abcam, AB81299), BAX antibody (Proteintech, 50599-2-Ig), Cleaved Caspase-3 antibody (CellSignaling Technology, 9661), HSP90 antibody (Proteintech, 13171-1-AP), and GAPDH antibody (Proteintech, 10494-1-AP) diluted 1:1000. The membrane was then washed three times with PBST. Caspase-3 antibody was incubated with horseradish peroxidase-labeled goat anti-rabbit IgG antibody (abcam, ab205718) diluted 1:10000 on a shaker for 1 h. GAPDH antibody and HSP90 antibody were incubated with horseradish peroxidase-labeled goat anti-mouse IgG antibody (HuaAn, HA1006) diluted 1:10000 on a shaker for 1 h. After washing three times with PBST, ECL chemiluminescent colorimetric solution was added.

[0069] The results are as follows Figure 5 As shown in Figure A, the LIG4-siRNA interference efficiency was 62.5%, and both LIG4 gene transcription and protein levels were significantly decreased. Conversely, LIG4 overexpression significantly upregulated the mRNA level of this gene and significantly increased the expression level of LIG4 protein, as shown in Figure A. Figure 5 As shown in B.

[0070] Example 6: Resistance of the LIG4 gene to vomitoxin

[0071] The study found that LIG4 expression significantly increased after exposure to DON at a concentration of 2 μL / mL, as shown in the results. Figure 3As shown, this invention involves exposing IPEC-J2 cells of wild-type (WT), LIG4 interference group (SI), and LIG4 overexpression group (OE) to 2 μL / mL DON for 48 h, followed by indirect immunofluorescence and Western blot experiments. Figure 11 B and Figure 12 A) It was observed that LIG4 knockdown significantly increased the content of the DNA double-strand break marker γ-H2AX. However, after LIG4 overexpression treatment, DON-induced DNA damage was partially restored. Figure 6 C and Figure 12 A). Simultaneously, ELISA detection ( Figure 11 B) The results also showed that the content of 8-OHdG in cells increased significantly after LIG4 knockdown.

[0072] The indirect immunofluorescence assay was performed as follows: Cells were washed with PBS and fixed with 4% paraformaldehyde for 30 min, then bovine serum albumin (BSA) (Solarbio, Beijing, China) was added and the cells were blocked at 37°C for 2 h. Using γ-H2AX antibody (abcam, ab81299) as the primary antibody, the cells were incubated overnight at 4°C. Cells were then gently washed three times with PBST, followed by fluorescent labeling with horseradish peroxidase-labeled goat anti-rabbit IgG antibody (abcam, ab205718) and incubated in the dark. After gently washing the cells three times with PBST, DAPI (Solarbio, Beijing, China) was added for nuclear staining. The fluorescence of cells treated with different methods was then observed using a microscope (Leica Microsystems, Wetzlar, Germany).

[0073] The Western blot assay procedure was as follows: 200 μl of RIPA lysis buffer (containing 1% PMSF) was added to each well, and the cells were incubated on ice for 20 min. Cells were collected into 1.5 mL centrifuge tubes, centrifuged at 4 °C for 20 min, and then 5× loading buffer was added. The cells were denatured in a 98 °C metal bath for 10 min, and the samples were stored at -20 °C. Samples were subjected to polyacrylamide gel electrophoresis, transferred to a PVDF membrane, blocked with 5% skim milk (1×TBST dilution) at room temperature for 2 h, washed three times with PBST, and incubated overnight at 4 °C with γ-H2AX antibody (abcam, ab81299) diluted 1:1000. After washing three times with PBST, the cells were incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (Beijing Kangwei Century Biotechnology Co., Ltd.) diluted 1:10000, on a shaker for 1 h, washed three times with PBST, and then ECL chemiluminescent reagent was added.

[0074] Furthermore, this invention utilizes flow cytometry to investigate the effects of LIG4 knockdown or overexpression on apoptosis, cell cycle, and oxidative stress. After 48 hours of DON treatment, wild-type (WT), LIG4 interference (SI), and LIG4 overexpression (OE) IPEC-J2 cells were collected and analyzed by flow cytometry according to the instructions of the cell cycle assay kit (Beyotime, Shanghai, China), reactive oxygen species assay kit, and apoptosis assay kit (Solarbio, Beijing, China).

[0075] The results are as follows Figure 6-15 As shown, high expression of LIG4 can effectively resist DON-induced cellular DNA damage. LIG4 knockdown exacerbated DON-induced total apoptosis and oxidative stress levels, while LIG4 overexpression significantly restored apoptosis and oxidative stress levels. Figure 6 A, Figure 8 , Figure 9 and Figure 11 A, Figure 13 , Figure 14 On the other hand, high expression of LIG4 can enhance DNA damage repair capacity and reduce the expression level of the DNA damage marker γ-H2AX protein, while knockdown of LIG4 further inhibits DNA damage repair capacity. Figure 6 B. Figure 7 , Figure 11 B. Figure 11 C and Figure 12 A). Furthermore, Western blot analysis was used to detect the protein levels of the key pro-apoptotic factors BAX and Cleaved caspase 3. After LIG4 knockdown, the expression of Cleaved-caspase 3 and BAX proteins further increased (A). Figure 12 B); however, LIG4 overexpression significantly restored its expression level. Figure 6 C). Furthermore, LIG4 knockdown resulted in cell cycle arrest at the DNA synthesis phase (S), with a significant decrease in the proportion of cells in the pre-DNA synthesis (G1) and post-DNA synthesis (G2) phases. Figure 15 However, LIG4 overexpression can restore cell cycle arrest induced by DON (…). Figure 10 In summary, high expression of LIG4 can effectively resist cell damage caused by DON.

Claims

1. A method for identifying or breeding pigs resistant to vomitoxin, characterized in that, Includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the genomic DNA of the pig to be tested as a template, PCR amplification reaction was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO.3-4; (3) Analyze the PCR amplification product; when the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO.2, the pig to be tested is a pig with high resistance to vomitoxin; when the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO.1, the pig to be tested is a pig with low resistance to vomitoxin; the vomitoxin is deoxynivalenol.

2. The method according to claim 1, characterized in that, The PCR amplification reaction system described in step (2) includes template DNA, the primer pair or PCR mix.

3. The method according to claim 1, characterized in that, The PCR amplification reaction procedure in step (2) is as follows: 95℃ for 3 minutes; 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 15 seconds, 30 cycles; 72℃ for 5 minutes.

4. Any of the following applications of reagents or kits containing primer pairs with nucleotide sequences as shown in SEQ ID NO. 3-4: (1) Used for the identification and improvement of pigs with high vomitoxin resistance; (2) Used for early prediction of porcine vomitoxin resistance; (3) Used for marker-assisted breeding related to porcine vomitoxin resistance; The SNP marker was obtained by PCR amplification using the primer pair; the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1 or SEQ ID NO.2; the vomitoxin is deoxynivalenol.