Anti-tetanus toxin antibody as well as preparation method and application thereof

Abstract

The invention belongs to the field of immunology and genetic engineering, and particularly relates to an anti-tetanus toxin antibody as well as a preparation method and application thereof. The antibody or the antigen binding fragment thereof can specifically recognize and bind tetanus toxin, tetanus toxoid and / or tetanus toxin C fragment, and has good affinity with the tetanus toxin, tetanus toxoid and / or tetanus toxin C fragment; meanwhile, the traditional Chinese medicine composition has a remarkable neutralizing effect on tetanus toxin; the compound can be used for preparing products for diagnosing, preventing and / or treating clostridium tetani infection or diseases caused by clostridium tetani infection, detecting the existence or level of clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin C fragment in a sample, and screening drugs for preventing and / or treating clostridium tetani infection or diseases caused by clostridium tetani infection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of immunology and genetic engineering, and particularly relates to an anti-tetanus toxin antibody and a preparation method and application thereof. BACKGROUND

[0002] Tetanus is a potentially fatal disease, which is a bacterial infection caused by Clostridium tetani. Clostridium tetani widely exists in the natural environment. Clostridium tetani invades the human body through skin or mucosal breaks, breeds in an anaerobic environment, and produces exotoxin, causing an acute and toxic disease characterized by sustained rigidity and convulsive spasm of skeletal muscles throughout the body. Severe patients can develop laryngeal spasm, asphyxia, pulmonary infection, and organ failure. Without medical intervention, the mortality rate of severe patients is close to 100%. Even after active comprehensive treatment, the mortality rate worldwide is still 30% to 50%.

[0003] The passive immunization preparations currently used in clinical practice to prevent and treat tetanus mainly include tetanus antitoxin (TAT), equine tetanus immunoglobulin F(ab')2, and human tetanus immunoglobulin (HTIG). However, the above passive immunization preparations have great defects: due to the different physical conditions of the human body and the different acceptance of TAT from horse serum, many people will have adverse reactions such as allergic reaction, anaphylactic shock, or serum sickness. Therefore, TAT from horse serum is not suitable for all people. HTIG can overcome the adverse reactions of TAT from horse serum in clinical use, but due to the difficulty in obtaining human blood sources, the high price, and the risk of contamination by foreign viruses, the industrialized production and clinical application of HTIG have been greatly limited. There is an urgent need in clinical practice for passive immunization preparations for tetanus that are safer, less expensive, and can be industrially produced. SUMMARY

[0004] The first aspect of the present application aims to provide an anti-tetanus toxin antibody or an antigen-binding fragment thereof.

[0005] The second aspect of the present application aims to provide a biomaterial.

[0006] The third aspect of the present application aims to provide a method for preparing the antibody or antigen-binding fragment thereof of the first aspect of the present application.

[0007] The fourth aspect of the present application aims to provide a conjugate.

[0008] The fifth aspect of the present application aims to provide a pharmaceutical composition.

[0009] The sixth aspect of the present application aims to provide a diagnostic or therapeutic kit.

[0010] The seventh aspect of the present application aims to provide use of the antibody or antigen binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect.

[0011] The eighth aspect of the present application aims to provide a method for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0012] The ninth aspect of the present application aims to provide a method.

[0013] To achieve the above-mentioned object, the technical solution adopted by the present application is as follows: The first aspect of the present application provides an anti-tetanus toxin antibody or antigen binding fragment thereof, which comprises: a1) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 7; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 8; (Ab141) a2) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 15; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 16; (Ab142) a3) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 23; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 24; (Ab144) a4) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 31; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 32; (Ab147) a5) HCDR1, HCDR2 and HCDR3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 39; and / or LCDR1, LCDR2 and LCDR3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 40; (Ab163) or a6) HCDR1, HCDR2 and HCDR3 having one or more amino acid substitutions, deletions, or additions compared to the HCDR1, HCDR2 and HCDR3 as shown in any of al) - a5); and / or, LCDR1, LCDR2 and LCDR3 having one or more amino acid substitutions, deletions, or additions compared to the LCDR1, LCDR2 and LCDR3 as shown in any of al) - a5).

[0014] In some embodiments, the CDRs are defined according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system.

[0015] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises: b1) a VH comprising a HCDR1 of the amino acid sequence as shown in SEQ ID NO: 1, a HCDR2 of the amino acid sequence as shown in SEQ ID NO: 2, and a HCDR3 of the amino acid sequence as shown in SEQ ID NO: 3; and / or, a VL comprising a LCDR1 of the amino acid sequence as shown in SEQ ID NO: 4, a LCDR2 of the amino acid sequence as shown in SEQ ID NO: 5, and a LCDR3 of the amino acid sequence as shown in SEQ ID NO: 6; (Ab141) b2) a VH comprising a HCDR1 of the amino acid sequence as shown in SEQ ID NO: 9, a HCDR2 of the amino acid sequence as shown in SEQ ID NO: 10, and a HCDR3 of the amino acid sequence as shown in SEQ ID NO: 11; and / or, a VL comprising a LCDR1 of the amino acid sequence as shown in SEQ ID NO: 12, a LCDR2 of the amino acid sequence as shown in SEQ ID NO: 13, and a LCDR3 of the amino acid sequence as shown in SEQ ID NO: 14; (Ab142) b3) a VH comprising a HCDR1 of the amino acid sequence as shown in SEQ ID NO: 17, a HCDR2 of the amino acid sequence as shown in SEQ ID NO: 18, and a HCDR3 of the amino acid sequence as shown in SEQ ID NO: 19; and / or, a VL comprising a LCDR1 of the amino acid sequence as shown in SEQ ID NO: 20, a LCDR2 of the amino acid sequence as shown in SEQ ID NO: 21, and a LCDR3 of the amino acid sequence as shown in SEQ ID NO: 22; (Ab144) b4) a VH comprising a HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 25, a HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 26, and a HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 27; and / or, a VL comprising a LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 28, a LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 29, and a LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 30; (Ab147) b5) a VH comprising a HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 33, a HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 34, and a HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 35; and / or, a VL comprising a LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 36, a LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 37, and a LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 38; (Ab163) or b6) a VH comprising a HCDR1, a HCDR2, and a HCDR3 having one or more amino acid substitutions, deletions, or additions compared to the HCDR1, HCDR2, and HCDR3 as set forth in any of b1) - b5); and / or, a VL comprising a LCDR1, a LCDR2, and a LCDR3 having one or more amino acid substitutions, deletions, or additions compared to the LCDR1, LCDR2, and LCDR3 as set forth in any of b1) - b5); wherein the CDRs are defined according to the Kabat numbering system.

[0016] It is understood by those skilled in the art that the above amino acid substitutions are conservative substitutions.

[0017] In some embodiments, the heavy chain variable region of the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a framework region of the heavy chain variable region.

[0018] In some embodiments, the framework region of the heavy chain variable region comprises a framework region of a heavy chain variable region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, mink, chicken, duck, or goose, or a mutant thereof; further comprising a framework region of a heavy chain variable region of an immunoglobulin derived from a human, or a mutant thereof.

[0019] In some embodiments, the light chain variable region of the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a framework region of the light chain variable region.

[0020] In some embodiments, the framework region of the light chain variable region comprises a framework region of a light chain variable region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, mink, chicken, duck, or goose, or a mutant thereof; further comprising a framework region of a light chain variable region of an immunoglobulin derived from a human, or a mutant thereof.

[0021] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises: c1) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 7, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 8, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto (Ab141); c2) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 15, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 16, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto (Ab142); c3) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 23, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 24, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab144); c4) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 31, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 32, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab147); or c5) a heavy chain variable region (VH) comprising an amino acid sequence as set forth in SEQ ID NO: 39, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto; and / or, a light chain variable region (VL) comprising an amino acid sequence as set forth in SEQ ID NO: 40, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical thereto (Ab163).

[0022] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region.

[0023] In some embodiments, the heavy chain constant region comprises at least a portion of a heavy chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, marten, chicken, duck, or goose, or a mutant thereof; further comprising at least a portion of a heavy chain constant region of an immunoglobulin derived from a human, or a mutant thereof.

[0024] In some embodiments, the light chain constant region comprises at least a portion of a light chain constant region of an immunoglobulin derived from a murine, primate, bovine, equine, porcine, ovine, caprine, canine, feline, leporine, camelid, donkey, cervine, marten, chicken, duck, or goose, or a mutant thereof; further comprising a light chain constant region of an immunoglobulin derived from a human, or a mutant thereof.

[0025] In some embodiments, the heavy chain constant region comprises a heavy chain constant region derived from an IgAl, IgA2, IgD, IgE, IgGl, IgG2, IgG3, IgG4, or IgM immunoglobulin; further comprising a heavy chain constant region derived from an IgGl immunoglobulin.

[0026] In some embodiments, the heavy chain constant region comprises an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 51, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0027] In some embodiments, the light chain constant region comprises a light chain constant region derived from a kappa and lambda type immunoglobulin.

[0028] In some embodiments, the light chain constant region comprises an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 52 or 53, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0029] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof is a murine, chimeric, humanized, or fully human antibody; further a fully human antibody.

[0030] In some embodiments, the anti-tetanus toxin antibody or antigen-binding fragment thereof can include, but is not limited to, a monoclonal antibody, a bispecific antibody, a multispecific antibody, a nanobody, a Fab fragment, a Fab’ fragment, a Fab’-SH fragment, a F(ab’)2 fragment, a Fv fragment, a single chain Fv (scFv), a dsFv, or a Fd fragment.

[0031] In a second aspect of the application, there is provided a biological material comprising any one of n1 )-n9): n1 ) a nucleic acid molecule encoding an antibody, or antigen-binding fragment thereof, of the first aspect of the application; n2) an expression cassette comprising the nucleic acid molecule of n1 ); n3) a vector comprising the nucleic acid molecule of n1 ); n4) a vector comprising the expression cassette of n2); n5) a cell comprising the nucleic acid molecule of n1 ); n6) a cell comprising the expression cassette of n2); n7) a cell comprising the vector of n3); n8) a cell comprising the vector of n4); n9) a cell comprising an antibody, or antigen-binding fragment thereof, of the first aspect of the application; Any cell described in n5)-n9) does not comprise reproductive material.

[0032] It will be understood by a person skilled in the art that nucleotides in a nucleic acid molecule can be substituted according to codon degeneracy. In some embodiments, the nucleotide sequence of the nucleic acid molecule is codon optimised.

[0033] In some embodiments, the nucleic acid molecule encoding an antibody, or antigen-binding fragment thereof, of the first aspect of the application comprises a nucleic acid molecule encoding a heavy chain variable region of an antibody, or antigen-binding fragment thereof, of the first aspect of the application and a nucleic acid molecule encoding a light chain variable region of an antibody, or antigen-binding fragment thereof, of the first aspect of the application.

[0034] In some embodiments, the nucleic acid molecule encoding a heavy chain variable region of an antibody, or antigen-binding fragment thereof, of the first aspect of the application comprises a nucleotide sequence set forth in SEQ ID NO: 41, 43, 45, 47 or 49, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0035] In some embodiments, the nucleic acid molecule encoding the heavy chain variable region of the antibody or antigen-binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 41, 43, 45, 47, or 49, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0036] In some embodiments, the nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of the first aspect of the application comprises a nucleic acid molecule encoding the heavy chain constant region of the antibody or antigen-binding fragment thereof of the first aspect of the application and a nucleic acid molecule encoding the light chain constant region of the antibody or antigen-binding fragment thereof of the first aspect of the application.

[0037] In some embodiments, the nucleic acid molecule encoding the heavy chain constant region of the antibody or antigen-binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 51, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0038] In some embodiments, the nucleic acid molecule encoding the light chain constant region of the antibody or antigen-binding fragment thereof of the first aspect of the application comprises the nucleotide sequence set forth in SEQ ID NO: 52 or 53, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0039] In some embodiments, any of the vectors of n3) - n4) can be an expression vector. In some embodiments, the expression vector can comprise a eukaryotic expression vector and / or a prokaryotic expression vector. In some embodiments, the eukaryotic expression vector comprises, for example, but is not limited to, a yeast expression vector, a mammalian expression vector, and an insect expression vector. For example, the expression vector can comprise, but is not limited to, a plasmid, a retroviral vector, a lentiviral vector, a bacteriophage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector.

[0040] In some embodiments, the vector can be selected from a nanoparticle, a liposome, an exosome, a microvesicle, or a gene gun.

[0041] In some embodiments, the cell of any one of n5) to n9) can be a host cell routinely used in the art, as long as the expression vector can stably express the nucleic acid molecule carried thereby as the above-mentioned antibody or antigen-binding fragment thereof of the present application. In some embodiments, the host cell can be a prokaryotic cell, for example, which can include E. coli, and / or a eukaryotic cell, for example, which can include CHO cell, HEK293 cell, BHK cell, NSO cell, SP2 / 0 cell, YO myeloma cell, P3X63 mouse myeloma cell, PER cell, PER.C6 cell, HeLa cell, Vero cell, Expi293 cell, hybridoma cell, yeast cell, and insect cell.

[0042] In some embodiments, the cell of any one of n5) to n9) can be an immune cell. In some embodiments, the immune cell can include, but is not limited to, T cell, NK cell, DC cell, and macrophage cell.

[0043] In a third aspect of the present application, there is provided a method for preparing the antibody or antigen-binding fragment thereof of the first aspect of the present application, by culturing the cell of the second aspect of the present application.

[0044] In a fourth aspect of the present application, there is provided a conjugate, which comprises the antibody or antigen-binding fragment thereof of the first aspect of the present application; and, a conjugating moiety.

[0045] In some embodiments, the conjugating moiety can include, but is not limited to, a detectable label or a therapeutic agent.

[0046] In some embodiments, the detectable label can be any substance that can be detected by fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electricity, optics, chemistry, etc. Such labels are well known in the art and examples include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, beta-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g.,3H,125I,35S,14C, or32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas Red, rhodamine, quantum dot, or a cyanine dye derivative (e.g., Cy7, Alexa 750)), acridinium esters, magnetic beads, calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) microbeads, and biotin for use with avidin (e.g., streptavidin) modified to bind the above labels. In some embodiments, such labels can be suitable for use in immunological detection methods (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescence immunoassay, etc.). In some embodiments, the detectable label is selected from the group consisting of a radioisotope, a fluorescent substance, a luminescent substance, a colored substance, or an enzyme. In some embodiments, the detectable label can be attached to the antibody or antigen-binding fragment thereof of the present application via linkers of varying lengths to reduce potential steric hindrance.

[0047] In some embodiments, the detectable label can include, but is not limited to, an enzyme (e.g., horseradish peroxidase), a radionuclide, a fluorescent dye, a luminescent substance (e.g., a chemiluminescent substance), a colored substance, biotin, etc.

[0048] In some embodiments, the therapeutic agent can include, for example, but is not limited to, a drug that prevents and / or treats Clostridium tetani (C. tetani, tetanus bacillus, Clostridium tetani ) infection or a disease caused thereby.

[0049] In some embodiments, the conjugating moiety can be selected from a substance that can improve the biological properties of the antibody (e.g., increase the serum half-life), such as a chemical group, e.g., polyethylene glycol (PEG), methyl, ethyl, or a sugar group.

[0050] In a fifth aspect of the present application, a pharmaceutical composition is provided, which comprises: the antibody or antigen-binding fragment thereof of the first aspect, the biomaterial of the second aspect, or the conjugate of the fourth aspect; and a pharmaceutically acceptable carrier.

[0051] In some embodiments, the pharmaceutical composition can further comprise an additional pharmaceutically active agent.

[0052] In some embodiments, the additional pharmaceutically active agent can be a biologically active agent, such as an agent capable of preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0053] In some embodiments, the antibody or antigen-binding fragment thereof is provided as a separate component or as a mixed component with the additional pharmaceutically active agent.

[0054] In some embodiments, the pharmaceutical composition can be administered by, for example, parenteral, subcutaneous injection, sublingual, rectal, nasal, intravenous injection, intramuscular injection, oral, ocular, topical, etc.

[0055] In some embodiments, the pharmaceutical composition is in the form of, for example, an aqueous solution, a suspension, a powder, a tablet, a capsule, a granule, a powder, a pill, a disintegrant, a syrup, a spray, a gel, an emulsion, an injection, an elixir, a lozenge, a suppository, etc.

[0056] In a sixth aspect of the present application, there is provided a diagnostic or therapeutic kit comprising: the antibody or antigen-binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect.

[0057] In some embodiments, the kit can further comprise an instruction and / or a device for administration.

[0058] In some embodiments, the kit can be used for diagnosing Clostridium tetani infection or a disease caused thereby, detecting Clostridium tetani, tetanus toxin, tetanus toxoid, or tetanolysin C fragment in a sample, or drug screening for an agent for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0059] In some embodiments, the kit can be used for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0060] In the present application, the disease caused by Clostridium tetani infection includes tetanus.

[0061] In a seventh aspect of the present application, there is provided use of the antibody or antigen-binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect in any one of c1) - c6): c1) for the manufacture of a product for diagnosing Clostridium tetani infection or a disease caused thereby; c2) for the manufacture of a product for preventing and / or treating Clostridium tetani infection or a disease caused thereby; c3) preparing a product for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin fragment C in a sample; c4) detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanus toxin fragment C; c5) preparing a product for drug screening, the drug being used for preventing and / or treating Clostridium tetani infection or diseases caused thereby; c6) drug screening, the drug being used for preventing and / or treating Clostridium tetani infection or diseases caused thereby.

[0062] In some embodiments, the use of c4), c6) does not involve diagnosis or treatment of a disease.

[0063] In some embodiments, the sample is selected from at least one of body fluid, tissue, cell, excretion of a subject to be tested.

[0064] In some embodiments, the body fluid comprises at least one of blood, lymph.

[0065] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spot, whole blood.

[0066] In some embodiments, the excretion comprises at least one of urine, feces, tears.

[0067] In some embodiments, the subject to be tested comprises a mammal, such as a human, a non-human primate (e.g., chimpanzee, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a livestock (e.g., horse, cow, sheep, pig, rabbit).

[0068] In some embodiments, the subject to be tested comprises a human.

[0069] In some embodiments, the product is a pharmaceutical product, a reagent or a kit.

[0070] In an eighth aspect of the present application, there is provided a method for preventing and / or treating Clostridium tetani infection or diseases caused thereby, the method comprising administering to a subject in need thereof an effective amount of the antibody or antigen-binding fragment thereof of the first aspect of the present application, the biomaterial of the second aspect of the present application, the conjugate of the fourth aspect of the present application or the pharmaceutical composition of the fifth aspect of the present application.

[0071] In a ninth aspect of the present application, there is provided a method, the method comprising contacting a sample with the antibody or antigen-binding fragment thereof of the first aspect of the present application under conditions that allow the antibody or antigen-binding fragment thereof of the first aspect of the present application to form a complex with tetanus toxin, tetanus toxoid or tetanus toxin fragment C, and detecting the formation of the complex. The method is used in any one of f1) - f3): f1) diagnosing Clostridium tetani infection or a disease caused thereby; f2) detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysin C fragment in a sample; f3) screening a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0072] In some embodiments, the sample is the sample in the seventh aspect of the present application.

[0073] The present application has the following advantages: The present application provides an anti-tetanus toxin antibody or antigen-binding fragment thereof, which can specifically recognize and bind to tetanus toxin, tetanus toxoid and / or tetanolysin C fragment, and has good affinity therewith; at the same time, it has a significant neutralizing effect on tetanus toxin; it can be used for preparing a product for diagnosing, preventing and / or treating Clostridium tetani infection or a disease caused thereby, detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid or tetanolysin C fragment in a sample, and screening a drug for preventing and / or treating Clostridium tetani infection or a disease caused thereby.

[0074] Further, the fully humanized anti-tetanus toxin antibody or antigen-binding fragment thereof has the characteristics of high affinity, high specificity and small toxic side effects, avoids the problems of large adverse reactions and short half-life of animal-derived monoclonal antibodies, and can be prepared in large quantities by mammalian cells, has clear and stable components, is free of allergens and exogenous virus pollution, is safe, and can be widely used in various populations; it can be used as a new generation of passive immunization preparation for tetanus, and has important medical value. BRIEF DESCRIPTION OF DRAWINGS

[0075] Figure 1 The binding curve of the antibody to tetanus toxoid or tetanolysin C fragment is shown.

[0076] Figure 2 The results of the mouse challenge protection experiment are shown. DETAILED DESCRIPTION

[0077] In order to make the purpose, technical solutions and advantages of the present application clearer, the following embodiments are further described in detail. The specific embodiments described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.

[0078] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0079] Unless the context clearly dictates otherwise, as used herein, the expressions "a" and "an" include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0080] Tetanus toxin ( Tetanospasmin TeNT (TeNT) is a neurotoxin with an extremely high toxicity, second only to botulinum toxin (BoNT). This toxin has a unique affinity for the central nervous system, preventing the release of inhibitory neurotransmitters from inhibitory synaptic terminals. This leads to a disharmony between excitation and inhibition of muscle activity, resulting in simultaneous and intense contraction of both extensor and flexor muscles, causing muscle rigidity and spasms, and the characteristic tetanus symptoms of trismus and opisthotonos. TeNT is a 150 kDa polypeptide chain. Post-translational cleavage by bacterial or host proteases into an active two-chain form linked by a single disulfide bond: a light chain (fragment A) and heavy chains (fragments B and C), each 50 kDa and 100 kDa, respectively. Fragment A is a zinc metalloprotease that cleaves membrane proteins involved in neurotransmitter transmission on nerve cell membranes, inhibiting neurotransmitter release and allowing uninterrupted excitation. Fragment B encodes the translocation domain, mediating the entry of the toxin's active site into cells. Fragment C is the receptor-binding domain, enabling retrograde axonal transport into the central nervous system. Numerous studies have demonstrated that antibodies targeting fragment C have a high probability of neutralizing activity.

[0081] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows. In examples, the term "about" refers to a range of ±1% of the value that follows.

[0082] The term "specific binding" as used herein refers to binding selectivity for an antigen and can be distinguished from unwanted or non-specific binding. The ability of an antigen-binding molecule to bind to a specific antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art (e.g., surface plasmon resonance (SPR) technology and traditional binding assays).

[0083] The term "affinity" or "binding affinity" as used herein refers to the strength of the noncovalent interaction between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Binding affinity can generally be expressed as an affinity constant (KD), which is the ratio of the dissociation rate constant (kd) to the association rate constant (ka). Thus, equivalent affinities can include different rate constants, as long as the ratio of the rate constants remains the same. Affinity can be measured by conventional methods known in the art, such as surface plasmon resonance (SPR). In some embodiments, the antibody binds with an equilibrium dissociation constant (KD) of about less than 10 -6 M, about less than 10 -7 M, about less than 10 -8 M, about less than 10 -9 M, about less than 10 -10 M, and the affinity of binding to the predetermined antigen is at least twice the affinity of binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely related antigen.

[0084] The term "antibody" as used herein encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies or trispecific antibodies), single chain molecules, and antibody fragments, as long as they exhibit the desired antigen-binding activity. Within the light and heavy chains of an antibody, the variable and constant regions are connected by a "J" region of about 12 or more amino acids, and the heavy chain also contains a "D" region of about 3 or more amino acids. Each heavy chain is composed of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region is comprised of one domain, CL. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0085] Unless otherwise indicated, "antibody active fragment," "antibody fragment," "target binding fragment," and "antigen binding fragment" are interchangeable in the context of the present application and mean an antibody fragment that is capable of specifically binding to an antigen, such as a fragment that retains one or more CDR regions. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fab'-SH, and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, such as single-chain Fv (ScFv); nanobodies formed from antibody fragments; dsFv, Fd fragments, and multispecific antibodies.

[0086] The term "variable region" or "variable domain" as used herein refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs). A single VH or VL domain can be sufficient to confer antigen-binding specificity. The term "variable" refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies, and are used in the binding and specifity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of a given subunit, it is concentrated in three segments called hypervariable regions (HVRs) both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FRs). The variable domains of the heavy chain and light chain each comprise four FR regions, largely adopting a beta-sheet configuration, connected by three HVRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The HVRs in each chain are held together in part by the FR regions of each chain and, in part, by interactions with the HVRs of the other chain. The constant domains are not involved directly in binding an antibody to an antigen, but exhibit other effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity.

[0087] The term "hypervariable region" or "HVR", as used herein, refers to the regions of an antibody variable domain in which the sequence varies extensively between antibodies, and / or forms a structure that is compact and constrained. Generally, native four-chain antibodies comprise six HVRs: three in the VHand three in the VL. HVRs generally comprise amino acid residues from a "complementarity determining region" (CDR) and / or from a "hypervariable loop" that have the highest inter- antibody sequence variability and / or that are involved in antigen recognition. The skilled artisan will understand that, unless otherwise specified, "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., a variable region) are understood to encompass CDRs and complementarity determining regions as defined by any one of the art-recognized schemes. It is well understood in the art that CDRs of an antibody can be defined in a variety of ways, e.g., according to the Kabat, Chothia, IMGT, Contact, or AbM numbering systems. The skilled artisan will understand that, unless otherwise specified, the term "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., a variable region) are understood to encompass CDRs as defined by any one of the above-mentioned art-recognized schemes as described herein, and that the corresponding amino acid sequences defined by the rules of the defined CDRs are also intended to be within the scope of the present invention.

[0088] The term "chimeric antibody" as used herein refers to an antibody that combines antibody fragments from different species. Specifically, for example, a monoclonal antibody from one species (e.g., mouse) whose Fc constant region is replaced by a Fc constant region from a different species (e.g., human) via DNA recombination technology.

[0089] The term "humanized antibody" as used herein refers to an antibody that comprises a human immunoglobulin framework region and one or more CDRs from a non-human (e.g., mouse, rat, rabbit, or synthetic) immunoglobulin. Except in the CDRs, all other parts of a humanized antibody are essentially identical to corresponding parts of natural human immunoglobulin sequences.

[0090] The term "fully human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. As used herein, the term "fully human antibody" refers to a protein molecule having essentially each portion (e.g., CDRs, FRs, CL, HC domains (e.g., CH1, CH2, CH3), hinge, VL, VH) of its protein molecule essentially non-immunogenic in humans, having only minor sequence changes or variations relative to a human natural immunoglobulin. Thus, a fully human antibody is distinct from a chimeric or humanized antibody. It is noted that a fully human antibody can be produced by a human cell, a non-human animal, or a prokaryotic or eukaryotic cell that is capable of expressing a functionally rearranged human immunoglobulin (e.g., heavy and / or light chain) gene.

[0091] The term "nucleic acid molecule" as used herein refers to any one or more nucleic acid segments of a polynucleotide, e.g., a DNA or RNA segment.

[0092] "Percent homology," "% homology," or "% sequence identity," as used herein in the context of the present application are used in the same sense as "percent identity" to describe the degree of similarity between two nucleotide sequences or two amino acid sequences. The percent homology of two sequences can be calculated as follows: after aligning the two sequences, divide the number of positions at which the residues are identical by the total number of positions in the aligned sequences and multiply the result by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, e.g., the BLAST suite available on the NCBI website. As used herein, having "at least 80% sequence identity" to a sequence means having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence.

[0093] The terms "vector" or "expression vector" as used herein can be used interchangeably with "expression construct" and refers to a DNA molecule that directs the introduction of a particular gene with which it is operably linked into a target cell and directs expression. The vector includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. The expression vectors of the present application comprise an expression cassette. The expression vector can be transcribed to produce a large amount of stable mRNA. Once the expression vector is within the target cell, the ribonucleic acid molecule or protein encoded by the gene is produced by the cellular transcription and / or translation machinery.

[0094] The terms "cell" and "host cell" as used herein are used interchangeably and refer to a cell into which an exogenous nucleic acid has been introduced, and also includes the progeny of such a cell. Host cells include "transformants" and "transformed cells" including primary transformed cells as well as progeny derived therefrom. The nucleic acid of the progeny can not be identical to the parent cell due to mutations. Host cells include cultured cells, for example, cultured mammalian cells such as CHO cells, 293 cells, Vero cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, insect cells, and plant cells. Host cells of the present disclosure also include cells contained within a transgenic animal, transgenic plant, or cultured plant or animal tissue.

[0095] The term "pharmaceutical composition" as used herein includes an antibody or antigen binding fragment thereof of the present application and a pharmaceutically acceptable carrier. The pharmaceutical composition can be in various oral or parenteral formulation forms. The pharmaceutical composition is formulated using conventional diluents or excipients including fillers, extenders, binders, humectants, disintegrants, and surfactants. Solid oral formulations include tablets, pills, powders, granules, capsules, and the like. These solid formulations can be prepared by mixing at least one compound with one or more excipients, for example, starch, calcium carbonate, sucrose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate or talc can also be used. In addition, liquid oral formulations include suspensions, solutions, emulsions, and syrups, and the like. In addition to water and liquid paraffin, which are generally used as simple diluents, various excipients such as wetting agents, sweeteners, flavorings, preservatives, and the like can be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized agents, suppositories, and the like. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used as non-aqueous solutions and suspensions. The main components of suppositories can include semi-synthetic fatty acid esters, polyethylene glycols, Tween 61, cocoa butter, lauric butter, glycerol gelatin, and the like.

[0096] The pharmaceutical composition of the present application can be administered in a pharmaceutically effective amount. The "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to any medical treatment. The effective dose level of the composition can be determined according to the type of subject, the severity of the disease, the age and gender of the subject, the drug activity, the sensitivity to the drug, the administration time, the administration route, the excretion rate, the treatment time, the drug used in combination with the composition, and other known factors in the medical field. The pharmaceutical composition of the present application can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms. It is important to administer the composition at the minimum amount capable of exhibiting the maximum effect without causing side effects, which can be easily determined by those skilled in the art, taking into account all the above factors.

[0097] The term "pharmaceutically acceptable carrier" as used herein refers to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. The pharmaceutically acceptable carriers that can be used to formulate the composition of the present application in the form of a liquid solution include physiological saline, sterile water, Ringer's solution, buffered salt solution, glucose solution, maltodextrin solution, glycerol, ethanol, and a mixture of two or more thereof. If necessary, the composition of the present application can also contain other conventional additives such as antioxidants, buffers, and bacteriostats. In addition, the composition of the present application can also include diluents, dispersants, surfactants, binders, and lubricants to configure it into injectable formulations such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, and tablets.

[0098] The term "treatment" of a disease in a subject or "treating" a subject having or suspected of having a disease, as used herein, means administering a drug therapy to the subject, e.g., administering one or more agents, to thereby reduce or prevent the worsening of at least one symptom of the disease. Thus, in one embodiment, "treatment" refers to, inter alia, delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing efficacy of alternative therapies, or decreasing resistance to alternative therapies, or combinations thereof.

[0099] The term "diagnosing" or "detecting" as used herein includes judging whether a subject or a sample to be tested has tetanus toxin. Accordingly, it is possible to judge whether the subject or the subject from which the sample is derived is infected with Clostridium tetani.

[0100] The term "prevent," as used herein, means the application or administration of a drug to a subject at risk of contracting a disease, with the purpose to prevent the onset of the disease in the future, to reduce, alleviate, ameliorate, slow, inhibit, or stop its development, to reduce its severity and / or to reduce one or more symptoms or features of the disease. The compositions of the present application can be administered as a food, such as a nutritional supplement. Generally, the compositions of the present application are used to treat humans, although they can be used to treat animals, such as poultry, swine, cats, dogs, horses, or rabbits. If administered to an animal, oral gavage can be used.

[0101] The term "conservative substitution," as used herein, means an amino acid substitution that does not adversely affect or alter the intended properties of a protein / polypeptide comprising the amino acid sequence. Conservative substitutions can be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis, for example. Conservative amino acid substitutions include substitutions of an amino acid residue for another with similar side chains, e.g., substitutions that take place within a family of amino acid residues that are physicochemically or functionally similar (e.g., have similar size, shape, charge, chemical properties, including ability to form covalent or hydrogen bonds, etc.). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a conservative substitution is one in which the replacement amino acid residue is of another amino acid residue from the same side chain family. Methods of identifying conservative amino acid substitutions are well known in the art (see, e.g., Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl Acad. Set USA 94:412-417 (1997), which are incorporated herein by reference).

[0102] Examples and figures are provided below to assist in the understanding of the present application. It is understood that the examples and figures are intended to be illustrative only and that no limitations of the present application are to be implied therefrom. The actual scope of the application is set forth in the claims. It should be understood that any modifications might be made by those skilled in the art without departing from the spirit of the application. The reagents and / or kits used in the following examples are either commercially available or can be synthesized by known methods.

[0103] Note that, in the examples, the specific conditions not specified are carried out according to the conventional conditions, manufacturer's recommendations or publicly reported experimental conditions. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be purchased on the market. The reagents used are specified by the manufacturer, and similar products from other manufacturers have substitutability.

[0104] Example 1. Flow cytometry sorting of B cells and screening and preparation of anti-tetanus toxin antibodies Peripheral blood mononuclear cells (PBMCs) were isolated from the blood of volunteers who had been immunized with a commercial tetanus vaccine and had produced protective antibodies, and monoclonal antibodies that specifically bind to the full-length tetanus toxin and its C fragment were screened. Five antibodies were further screened, and the sequences are shown in Table 1.

[0105] Table 1. CDR regions and variable region sequences of five antibodies

[0106] Note: The CDRs in the table are defined according to the Kabat numbering system.

[0107] The screening and preparation method of the antibodies is as follows: 1. PBMC isolation and memory B cell sorting 10 mL of venous blood was collected from a volunteer who had been immunized with a commercial tetanus vaccine (from Chengdu Oulian Biotechnology Co., Ltd.) and had produced protective antibodies, and placed in an anticoagulant tube containing sodium citrate. The 10 mL blood sample was separated by Ficoll (polyfructose) to obtain PBMCs. After counting the PBMCs, tetanus toxoid (from: Kangxin Zhongwei, obtained by fermentation culture, purification and detoxification of Clostridium tetani CMCC 64008, which has the same immunogenicity as tetanus toxin) and tetanus toxin C fragment (synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., sequence shown as SEQ ID NO: 54) were used as sorting antigens, and SONY SH800 flow cytometry was used to sort single antigen-specific memory B cells from PBMCs into 96-well PCR (Polymerase Chain Reaction) plates, so that each well contained 1 B cell. The 96-well plate containing the B cells was placed in a -80 °C refrigerator for storage.

[0108] 2. Single-cell PCR amplification of fully human monoclonal antibodies 1) Reverse transcription PCR: Add all IgG1 subtype specific primers for heavy chain, kappa light chain and Maxima H Minus Reverse Transcriptase (Thermo) to the 96-well PCR plate containing single B cells, reverse transcription at 50°C for 30 min, and inactivate the reverse transcriptase at 85°C for 5 min. The obtained cDNA product is stored at -80°C.

[0109] 2) Nested PCR: First round reaction: Take 2 μL cDNA product as template, add hot start ultra-high-fidelity DNA polymerase for rapid PCR (TransStart(®) FastPfu DNA Polymerase, Zhanzhijin Biological), dNTPs and nested PCR primers. Reaction conditions: pre-denaturation at 98°C for 5 min, then 40 cycles of PCR, each cycle at 98°C for 30 s, 55°C (heavy chain VH, kappa light chain VK) for 1 min, 72°C for 1 min, and finally extension at 72°C for 5 min.

[0110] Second round reaction: Take the PCR product of the first round reaction as template, add hot start ultra-high-fidelity DNA polymerase for rapid PCR (TransStart(®) FastPfu DNA Polymerase, Zhanzhijin Biological), dNTPs and nested PCR primers. Reaction conditions: pre-denaturation at 98°C for 5 min, then 35 cycles of PCR, each cycle at 98°C for 30 s, 58°C (heavy chain VH) / 60°C (kappa light chain VK) for 1 min, 72°C for 1 min, and finally extension at 72°C for 5 min to obtain the nested PCR amplification product containing heavy chain and light chain variable region sequences.

[0111] The sequences of IgG1 subtype specific primers for heavy chain, kappa light chain and lambda light chain, and the sequences of the above nested PCR primers are described in Liao HX, Levesque MC, Nagel A, et al. High-throughput isolation of immunoglobulin genes from single human B cells and expression as monoclonal antibodies. J Virol Methods. 2009; 158(1-2): 171-179.

[0112] 3) Agarose gel electrophoresis Take 5 μL of the nested PCR amplification product for 1.5% agarose gel electrophoresis detection, take paired positive clones for sequencing, obtain antibody variable region sequences, and construct linear expression frame for the sequences.

[0113] 3. Constructing linear expression frame of recombinant antibody to express antibody With commercial pcDNA3.4 vector as a skeleton, signal peptide (ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC, SEQ ID NO: 55) and heavy chain constant region sequence (SEQ ID NO: 51, heavy chain constant region of IgG1 immunoglobulin), signal peptide (SEQ ID NO: 55) and kappa light chain constant region sequence (SEQ ID NO: 52), signal peptide (SEQ ID NO: 55) and lambda light chain constant region sequence (SEQ ID NO: 53) were respectively introduced in the form of homologous recombination before XbaI site, and three expression plasmids were constructed, namely pcDNA3.4-H, pcDNA3.4-κ and pcDNA3.4-λ, which were synthesized by Baiying Biotechnology Co., Ltd.

[0114] Using CMV primer-F: GGCTTGACCGACAATTGCATGAAGAATC (SEQ ID NO: 57) and CMV primer-R: GGCCCTCACCCCAGTCAG (SEQ ID NO: 58), and using any of the above plasmids (pcDNA3.4-H, pcDNA3.4-κ or pcDNA3.4-λ) as a template, the enhancer sequence, the promoter sequence and the signal peptide fragment were obtained by PCR amplification.

[0115] Using heavy chain constant region primer-F: GCTAGCACCAAGGGCCCA (SEQ ID NO: 59) and poly(A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60), and using pcDNA3.4-H plasmid as a template, the heavy chain constant region sequence, WPRE and Poly(A) fragment were obtained by PCR amplification.

[0116] Using kappa light chain constant region primer-F: CGTACGGTGGCTGCACCAT (SEQ ID NO: 61) and poly(A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60), and using pcDNA3.4-κ plasmid as a template, the kappa light chain constant region sequence, WPRE and Poly(A) fragment were obtained by PCR amplification.

[0117] The λ light chain constant region primer-F: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 62) and poly (A) primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 60) were used as primers, and the pcDNA3.4-λ plasmid was used as a template to amplify the λ light chain constant region sequence, WPRE and Poly (A) fragments by PCR.

[0118] All the above amplified fragments were purified by magnetic bead purification method. The nested PCR amplification product containing the heavy chain and light chain variable region sequence was used to construct a linear expression frame with the above expression elements (enhancer + promoter + signal peptide), constant region (heavy chain, κ light chain, λ light chain), WPRE and Poly (A) fragments using overlapping PCR technology: the light chain constant region of Ab141, Ab142, Ab147 and Ab163 is the κ light chain constant region, and the light chain constant region of Ab144 is the λ light chain constant region. After completion, 5 μL of the linear expression frame amplification product was detected by 1% agarose gel electrophoresis, and sequencing was performed to identify that the constructed antibody linear expression frame was correct.

[0119] The correctly constructed and purified heavy chain and light chain linear expression frames were co-transfected into 293 cells using transfection reagent PEI. The cells were cultured in a 37 ℃ 5% CO2 incubator for 72 h, and the cell supernatant was collected for detection.

[0120] 4. ELISA screening of candidate antibodies with binding activity The tetanus toxoid or tetanus toxin C fragment (wherein the tetanus toxoid is derived from: Kexing Zhongwei uses Clostridium tetani CMCC 64008 for fermentation culture, purification and detoxification, and has the same immunogenicity as tetanus toxin; the tetanus toxin C fragment is synthesized and expressed by Wuhan Huamei Biological Engineering Co., Ltd., and the sequence is: KNLDCWVDNEEDIDVILKKSTILNLDINNDIISDISGFNSSVITYPDAQLVPGINGKAIHLVNNESSEVIVHKAMDIEYNDMFNNFTVSFWLRVPKVSASHLEQYDTNEYSIISSMKKYSLSIGSGWSVSLKGNNLIWTLKDSAGEVRQITFRDLSDKFNAYLANKWVFITITNDRLSSANLYINGVLMGSAEITGLGAIREDNNITLKLDRCNNNNQYVSIDKFRIFCKALNPKEIEKLYTSYLSITFLRDFWGNPLRYDTEYYLIPVAYSSKDVQLKNITDYMYLTNAPSYTNGKLNIYYRRLYSGLKFIIKRYTPNNEIDSFVRSGDFIKLYVSYNNNEHIVGYPKDGNAFNNLDRILRVGYNAPGIPLYKKMEAVKLRDLKTYSVQLKLYDDKDASLGLVGTHNGQIGNDPNRDILIASNWYFNHLKDKTLTCDWYFVPTDEGWIN, SEQ ID NO: 54) is used as an antigen, and the antigen is diluted to 2 μg / mL with a coating solution to coat a 96-well ELISA plate, each well containing 100 μL of overnight coating at 4°C, and then blocked with a blocking solution at 37°C for 2 h. The collected supernatant containing the antibody is used as a primary antibody and incubated at 37°C for 1 h, a goat anti-human IgG-HRP (1:20,000 dilution) is used as a secondary antibody and incubated at 37°C for 1 h, a substrate developing solution is added after color development, and the reaction is stopped with 2M sulfuric acid after incubation at room temperature for 10 min. Detection and analysis are performed at a wavelength of 450 nm. The results show that no less than 100 strains of monoclonal antibodies can specifically bind to tetanus toxoid and / or tetanus toxin C fragment.

[0121] 5. Expression plasmid construction and antibody preparation After sequence alignment, repeated sequences and similar sequences are removed, and finally five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 are selected for further study. The CDR region and variable region sequences of the five antibodies are shown in Table 1.

[0122] The above 5 candidate antibodies were constructed into expression plasmids, and the antibodies were prepared. The specific method is as follows: using One Step Seamless Cloning Mix, the linear expression frame amplification product (obtained in step 3) containing the heavy chain and light chain of the 5 antibodies was respectively connected with the reverse PCR amplified pcDNA3.4-H, pcDNA3.4-κ and pcDNA3.4-λ expression vector framework, and the vector framework amplification primers were as follows: H-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 63), and heavy chain reverse primer 3.4-R: GCTAGCACCAAGGGCCCA (SEQ ID NO: 64) (pcDNA3.4-H vector framework); the amplification template was pcDNA3.4-H; L-κ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 65), and κ light chain reverse primer 3.4-R: CGTACGGTGGCTGCACCAT (SEQ ID NO: 66) (pcDNA3.4-κ vector framework); the amplification template was pcDNA3.4-κ; L-λ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 67), and λ light chain reverse primer 3.4-R: GGTCAGCCCAAGGCTGCCCCC (SEQ ID NO: 56) (pcDNA3.4-λ vector framework). The amplification template was pcDNA3.4-λ.

[0123] 1 μL of the linear expression frame fragment and 2 μL of the vector framework corresponding to the linear expression frame fragment (for example: 1 μL of the heavy chain linear expression frame fragment and 2 μL of the pcDNA3.4-H expression vector framework; 1 μL of the κ light chain linear expression frame fragment and 2 μL of the pcDNA3.4-κ expression vector framework) were taken, 5 μL of 2×cloning premix enzyme was added, and water was added to make the reaction system 10 μL. The reaction conditions were as follows: 50°C PCR instrument reaction for 15 min, after the reaction, the reaction system was cooled on ice and then transformed into DH5α competent cells to obtain the expression plasmid. The PEI transfection reagent was added to the plasmid DNA tube diluted with OPM-293 CD05 culture medium (containing heavy chain plasmid and light chain plasmid), mixed, and then the complex was incubated at room temperature for 20 min, and cultured at 37°C, 120 rpm, 6% CO2 for 5-7 days. The supernatant was collected by centrifugation at 300g for 5 min, filtered with a 0.2 μm filter, purified by protein A affinity, the collected antibody was exchanged with PBS, and the antibody concentration was detected.

[0124] Example 2. ELISA detection of antibody binding activity 1. Experimental process 1. Experimental process

[0125] 2. Results The results, as shown in Table 1, show that the expression and purification of the antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 in Example 1 all have strong binding activity. Figure 1

[0126] Example 3. SPR detection of antibody affinity constant and affinity kinetics analysis 1. Capture method test ​Antibody affinity testing was performed using a capture method. Using the Biacore T200 (Situofan) biomacromolecule interaction system and 1×HBS-EP+ buffer (Situofan), the five antibodies Ab141, Ab142, Ab144, Ab147, and Ab163 prepared in Example 1 were diluted to a concentration of 2 μg / mL and injected into the experimental channel (Fc2) of the Protein A capture chip (Situofan) at a flow rate of 10 μl / min. Capture was performed for 15 seconds, resulting in a capture level of approximately 70 RU. Ligand capture was not required in the reference channel (Fc1). Tetanus toxoid (derived from Sinovac Biotech using Clostridium tetani CMCC64008 through fermentation, purification, and detoxification, and possessing the same immunogenicity as tetanus toxin) was sequentially passed through the chip at increasing concentrations, and signal curves were obtained. Each concentration was considered a cycle. After completing one cycle, the chip was regenerated with regeneration solution to restore it to its original, uncaptured state. The regeneration time was 60 seconds. The resulting signal curves were analyzed using the BiaCore T-200 system software to obtain affinity activity test results for the five antibodies Ab141, Ab142, Ab144, Ab147, and Ab163 prepared in Example 1, against tetanus toxoid.

[0127] 2. Results As shown in Table 2, the affinity of each antibody to tetanus toxoid is 10 -9 The order of magnitude of M indicates that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 have very high affinity activity, and the antibody binding / complex has good stability.

[0128] Table 2. Results of affinity activity test between antibodies and tetanus toxoid

[0129] Example 4. Neutralization protection efficacy determination in mice 1. Tetanus toxin L+ determination Take a tetanus toxin (from China Institute for Drug Control), using sterile glycerol and borate buffer diluent (from Shanghai Shangbao Biological Technology Co., Ltd.) mixed with an equal amount (volume) of solution prepared into a toxin storage solution. When using, add an appropriate amount of borate buffer diluent to a brown bottle, take an appropriate amount of toxin storage solution and add it to the brown bottle, prepare a toxin application solution, each test dose solution volume 1 mL. Take the tetanus human immunoglobulin (Homologous tetanus immune globulin, hTIG) standard (from China Institute for Drug Control), add borate buffer diluent to dilute to 0.5 IU / mL, take 1 mL and add to each toxin application solution brown bottle, mix well, seal, 37 ℃ water bath combined with 1 hour. Immediately subcutaneously inject NIH mice on the abdomen, 3 mice per test dose, each mouse injected with 0.4 mL, observed for 5 days, morning and afternoon each 1 time, according to the minimum toxin amount of 72 hours~120 hours mice all died as the test dose (1 / 10L+).

[0130] 2. In vivo neutralization protection experiment The experiment is divided into negative control group, hTIG group (0.5 IU / mL) and 5 antibody groups (10 μg / mL, Ab141, Ab142, Ab144, Ab147 and Ab163 five antibodies prepared in Example 1). The toxin is diluted with borate buffer to contain 5 test amounts (1 / 10L+) per 1 ml, the hTIG group is diluted with borate buffer to 0.5 IU / mL, the 5 antibody groups are diluted with borate buffer to 10 μg / mL, and the negative control group is borate buffer. Diluted toxin and diluted negative control group, hTIG group and 5 antibody groups are mixed in equal volume, incubated at 37℃ for 1h, the incubated sample is injected subcutaneously on the abdomen of mice with 0.4ml, i.e. hTIG group, each mouse injected with 0.2 mL toxin+0.2 mL hTIG; antibody group, each mouse injected with 0.2 mL toxin+0.2 mL antibody; negative control group, each mouse injected with 0.2 mL toxin+0.2 mL borate buffer. Each group of 6 mice.

[0131] 3. Results The results are as follows Figure 2As shown, under the same conditions, when challenged by tetanus toxin, all mice in the negative control group died within 48 h, and all mice in the hTIG group (0.5 IU / ml) and each antibody group (10 μg / mL) survived within 14 days, indicating that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 can effectively protect animals against lethal dose of tetanus toxin challenge at 2 μg, and the effect is equivalent to 0.1 IU hTIG. Thus, it can be shown that the five antibodies Ab141, Ab142, Ab144, Ab147 and Ab163 prepared in Example 1 can effectively neutralize tetanus toxin and protect mice.

[0132] The technical solutions of the present application are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present application fall within the protection scope of the present application.

Claims

1. An anti-tetanus toxin antibody or antigen-binding fragment thereof, comprising: a1) HCDR1, HCDR2 and HCDR3 comprised in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 7; and LCDR1, LCDR2 and LCDR3 comprised in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO: 8; a2) HCDR1, HCDR2 and HCDR3 comprised in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 15; and LCDR1, LCDR2 and LCDR3 comprised in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO: 16; a3) HCDR1, HCDR2 and HCDR3 comprised in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 23; and LCDR1, LCDR2 and LCDR3 comprised in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO: 24; a4) HCDR1, HCDR2 and HCDR3 comprised in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 31; and LCDR1, LCDR2 and LCDR3 comprised in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO: 32; or a5) HCDR1, HCDR2 and HCDR3 comprised in a heavy chain variable region (VH) of an amino acid sequence set forth in SEQ ID NO: 39; and LCDR1, LCDR2 and LCDR3 comprised in a light chain variable region (VL) of an amino acid sequence set forth in SEQ ID NO:

40.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises: b1) a VH comprising HCDR1 of an amino acid sequence set forth in SEQ ID NO: 1, HCDR2 of an amino acid sequence set forth in SEQ ID NO: 2 and HCDR3 of an amino acid sequence set forth in SEQ ID NO: 3; and / or, a VL comprising LCDR1 of an amino acid sequence set forth in SEQ ID NO: 4, LCDR2 of an amino acid sequence set forth in SEQ ID NO: 5 and LCDR3 of an amino acid sequence set forth in SEQ ID NO:

6. ​ b2) a VHcomprising HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 9, HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 10, and HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 11; and / or, a VLcomprising LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 12, LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 13, and LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 14; b3) a VHcomprising HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 17, HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 18, and HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 19; and / or, a VLcomprising LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 20, LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 21, and LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 22; b4) a VHcomprising HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 25, HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 26, and HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 27; and / or, a VLcomprising LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 28, LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 29, and LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 30; or b5) a VHcomprising HCDR1 of an amino acid sequence as set forth in SEQ ID NO: 33, HCDR2 of an amino acid sequence as set forth in SEQ ID NO: 34, and HCDR3 of an amino acid sequence as set forth in SEQ ID NO: 35; and / or, a VLcomprising LCDR1 of an amino acid sequence as set forth in SEQ ID NO: 36, LCDR2 of an amino acid sequence as set forth in SEQ ID NO: 37, and LCDR3 of an amino acid sequence as set forth in SEQ ID NO: 38; wherein the CDRs are defined according to the Kabat numbering system.

3. The antibody or antigen binding fragment thereof of claim 2, wherein, the heavy chain variable region of the anti-tetanus toxin antibody or antigen binding fragment thereof further comprises a framework region of the heavy chain variable region; or the light chain variable region of the anti-tetanus toxin antibody or antigen binding fragment thereof further comprises a framework region of the light chain variable region; or the anti-tetanus toxin antibody or antigen binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region.

4. The antibody or antigen binding fragment thereof of claim 3, wherein, the framework region of the heavy chain variable region comprises a framework region of a heavy chain variable region of an immunoglobulin derived from a mouse, a primate, a bovine, a horse, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck, or a goose, or a mutant thereof; or the framework region of the light chain variable region comprises a framework region of a light chain variable region of an immunoglobulin derived from a mouse, a primate, a bovine, a horse, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck, or a goose, or a mutant thereof; or the anti-tetanus toxin antibody or antigen-binding fragment thereof comprises: c1) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 7; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 8; c2) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 15; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 16; c3) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 23; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 24; c4) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 31; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 32; or c5) a heavy chain variable region (VH) comprising an amino acid sequence set forth in SEQ ID NO: 39; and / or, a light chain variable region (VL) comprising an amino acid sequence set forth in SEQ ID NO: 40; or the heavy chain constant region comprises at least a portion of a heavy chain constant region of an immunoglobulin derived from a mouse, a primate, a bovine, a horse, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck, or a goose, or a mutant thereof; or the light chain constant region comprises at least a portion of a light chain constant region of an immunoglobulin derived from a mouse, a primate, a bovine, a horse, a pig, a sheep, a goat, a dog, a cat, a rabbit, a camel, a donkey, a deer, a mink, a chicken, a duck, or a goose, or a mutant thereof; or the heavy chain constant region comprises a heavy chain constant region derived from an IgAl, IgA2, IgD, IgE, IgGl, IgG2, IgG3, IgG4, or IgM immunoglobulin; or the heavy chain constant region comprises an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 51; or the light chain constant region comprises a light chain constant region derived from a kappa and lambda type immunoglobulin; or the light chain constant region comprises an amino acid sequence encoded by a nucleotide sequence set forth in SEQ ID NO: 52 or 53; or the anti-tetanus toxin antibody or antigen-binding fragment thereof is a mouse-derived antibody, a chimeric antibody, a humanized antibody, or a fully human antibody; or The anti-tetanus toxin antibody or antigen-binding fragment thereof comprises a monoclonal antibody, a bispecific antibody, a multispecific antibody, a nanobody, a Fab fragment, a Fab' fragment, a Fab'-SH fragment, a F(ab')2 fragment, a Fv fragment, a single chain Fv, a dsFv, or a Fd fragment.

5. A biological material comprising any of n1 ) - n9): n1 ) a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of any of claims 1 -4; n2) an expression cassette comprising the nucleic acid molecule of n1 ); n3) a vector comprising the nucleic acid molecule of n1 ); n4) a vector comprising the expression cassette of n2); n5) a cell comprising the nucleic acid molecule of n1 ); n6) a cell comprising the expression cassette of n2); n7) a cell comprising the vector of n3); n8) a cell comprising the vector of n4); n9) a cell comprising the antibody or antigen-binding fragment thereof of any of claims 1 -4; The cell of any of n5) - n9) does not comprise propagating material.

6. A conjugate comprising: The antibody or antigen-binding fragment thereof of any of claims 1 -4; and a coupling moiety.

7. A pharmaceutical composition comprising: The antibody or antigen-binding fragment thereof of any of claims 1 -4, the biological material of claim 5, or the conjugate of claim 6; and a pharmaceutically acceptable carrier.

8. A diagnostic or therapeutic kit comprising: The antibody or antigen-binding fragment thereof of any of claims 1 -4, the biological material of claim 5, the conjugate of claim 6, or the pharmaceutical composition of claim 7.

9. The antibody or antigen-binding fragment thereof of any of claims 1 -4, the biological material of claim 5, the conjugate of claim 6, or the pharmaceutical composition of claim 7 for use in any of c1 ) - c6): c1 ) the manufacture of a product for the diagnosis of an infection with Clostridium tetani or a disease caused thereby; c2) the manufacture of a product for the prevention and / or treatment of an infection with Clostridium tetani or a disease caused thereby; c3) the manufacture of a product for detecting the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or fragment C of tetanus toxin in a sample; c4) the detection of the presence or level of Clostridium tetani, tetanus toxin, tetanus toxoid, or fragment C of tetanus toxin; c5) the manufacture of a product for drug screening, the drug being for the prevention and / or treatment of an infection with Clostridium tetani or a disease caused thereby; c6) drug screening, the drug being for the prevention and / or treatment of an infection with Clostridium tetani or a disease caused thereby; The use according to c4), c6) does not involve the diagnosis, treatment of a disease.

10. A method for the preparation of the antibody or antigen-binding fragment thereof of any of claims 1 -4 by culturing the cell according to claim 5.

Images