Application of reagent for detecting gene expression level of SAE1 gene in tumor tissue in preparation of kit for predicting prognosis of intrahepatic cholangiocarcinoma

By detecting SAE1 gene expression in tumor tissue and using SAE1 siRNA and its inhibitor ML-792 to target and regulate SAE1, the problems of poor treatment efficacy and difficult prognosis prediction of intrahepatic cholangiocarcinoma have been solved. This provides a new method for the treatment and prognosis prediction of intrahepatic cholangiocarcinoma, and achieves the inhibition of intrahepatic cholangiocarcinoma cells and prognostic assessment.

CN120829974APending Publication Date: 2025-10-24ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511041030.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-25
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

Intrahepatic cholangiocarcinoma has poor treatment outcomes and difficult prognosis prediction. There is a lack of effective molecular targets and biomarkers. The application of SAE1 siRNA and SAE1 protein inhibitor ML-792 in the treatment and disease progression prediction of intrahepatic cholangiocarcinoma has not been reported in the current technology.

Method used

By detecting the expression level of the SAE1 gene in tumor tissue, and using SAE1 siRNA and the SAE1 protein inhibitor ML-792 to target and regulate SAE1, a prognostic kit for intrahepatic cholangiocarcinoma was prepared. High expression of SAE1 indicates a poor prognosis for patients, and this kit can be applied to the treatment and prognostic prediction of intrahepatic cholangiocarcinoma.

Benefits of technology

It significantly inhibits the activity, proliferation, migration and invasion of intrahepatic cholangiocarcinoma cells, providing a new therapeutic target and prognostic prediction method for intrahepatic cholangiocarcinoma. ML-792 can effectively reverse the progression of intrahepatic cholangiocarcinoma in vitro and in vivo, and the expression level of SAE1 can reflect the patient's prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120829974A_ABST
    Figure CN120829974A_ABST
Patent Text Reader

Abstract

The invention discloses application of a reagent for detecting the gene expression level of an SAE1 gene in tumor tissue in preparation of a kit for predicting prognosis of intrahepatic cholangiocarcinoma. According to the application of the reagent for detecting the gene expression level of the SAE1 gene in the tumor tissue in preparation of the kit for predicting the prognosis of the intrahepatic cholangiocarcinoma, the higher the level of the SAE1 in a sample of the to-be-detected tumor tissue from the intrahepatic cholangiocarcinoma, the higher the malignancy degree of the intrahepatic cholangiocarcinoma is, the higher the malignancy degree of the intrahepatic cholangiocarcinoma is. The SAE1 biomarker is found to be a brand new intrahepatic cholangiocarcinoma treatment and prognosis prediction target for the first time, and in-vitro experiments prove that SiRNA of SAE1 and a protein inhibitor ML-792 can remarkably inhibit the viability, proliferation ability, migration and invasion ability of intrahepatic cholangiocarcinoma cells. Meanwhile, the compound ML-792 can effectively kill intrahepatic bile duct cancer cells in vivo and inhibit tumor growth, and can be applied to preparation of antitumor drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to application of SAE1 SiRNA and SAE1 protein inhibitor ML-792 in treatment of intrahepatic cholangiocarcinoma and application of SAE1 gene in tumor tissue in preparation of a prognosis kit for intrahepatic cholangiocarcinoma. BACKGROUND

[0002] Intrahepatic cholangiocarcinoma (ICC) is a malignant tumor derived from intrahepatic bile duct epithelial cells, and is the second most common pathological type of primary liver cancer, with an incidence rate second only to hepatocellular carcinoma (HCC), accounting for 10-15% of all primary liver cancers. The incidence of intrahepatic cholangiocarcinoma varies significantly among different regions, races and genders. Specifically, the incidence in Asian populations is significantly higher than that in European and American populations. In recent years, some progress has been made in the diagnosis and treatment of intrahepatic cholangiocarcinoma, but due to its high invasiveness, high recurrence rate and easy distant metastasis, intrahepatic cholangiocarcinoma is still a poor prognosis and fatal disease. Therefore, screening new molecular targets is of vital importance for better exploring the pathogenesis of intrahepatic cholangiocarcinoma and delaying tumor progression.

[0003] SAE1 is one of the key enzymes in the SUMOylation process, which, together with another subunit SAE2, forms the E1 activating enzyme of SUMO, catalyzing the activation process of SUMO. The SUMOylation process is carried out through an enzyme cascade catalytic process similar to protein ubiquitination. SUMO protein, as a reversible post-translational protein modifier, can be covalently linked to substrate lysine residues to change the molecular modification of target proteins. This change can affect the protein interaction, activity and cellular localization of the target. Currently, an increase in SUMO levels has been observed in several malignancies, and its elevated state is associated with poor prognosis in patients.

[0004] The expression level of SAE1 tends to change in various tumors, suggesting that it can be involved in the occurrence and development process of tumors. For example, multiple studies have shown that the expression level of SAE1 is increased in some cancer types, including hepatocellular carcinoma, breast cancer, gastric cancer, pancreatic cancer, and lung cancer. Therefore, SAE1 is a protein worthy of research, and studying it can help better understand the suromodification process and the mechanism of tumor occurrence and development. In hepatocellular carcinoma, the expression of SAE1 has been shown to be closely related to tumor stage, metastatic phenotype, and survival rate, indicating that SAE1 has good diagnostic value in hepatocellular carcinoma. Functionally, SAE1 promotes the proliferation and invasion of HCC cells and inhibits apoptosis, while the lack of SAE1 blocks the cell cycle. The inventors' previous research found that circular RNA Circ-RAPGEF5 can promote the occurrence and development of intrahepatic cholangiocarcinoma, and its carcinogenic mechanism is achieved by regulating the stability of SAE1. This finding suggests that SAE1 plays an important role in tumor progression and can be used as a tumor student biomarker and therapeutic target for intrahepatic cholangiocarcinoma.

[0005] ML-792 is a specific small ubiquitin-like modifier (SUMO) activating enzyme (SAE) inhibitor. ML-792 inhibits SAE activity by forming an adduct with SUMO in an ATP-dependent mechanism catalyzed by the enzyme itself, and can selectively inhibit SAE / SUMO1 and SAE / SUMO2.

[0006] However, so far, there has been no relevant research and reports on the application of SAE1 SiRNA and SAE1 protein inhibitor ML-792 in the treatment and disease progression prediction of intrahepatic cholangiocarcinoma. SUMMARY

[0007] The purpose of the present application is to provide a reagent for detecting the gene expression level of SAE1 in tumor tissue in the preparation of a prognosis kit for intrahepatic cholangiocarcinoma.

[0008] The purpose of the present application is to provide a reagent for detecting the gene expression level of SAE1 in tumor tissue in the preparation of a prognosis kit for intrahepatic cholangiocarcinoma.

[0009] The present application provides a method for treating intrahepatic cholangiocarcinoma by targeting SAE1, which is specific to the poor treatment effect of intrahepatic cholangiocarcinoma and the difficulty in prognosis prediction. It relates to the application of SAE1 SiRNA and SAE1 protein inhibitor ML-792 in the preparation of a drug for reversing intrahepatic cholangiocarcinoma.

[0010] Meanwhile, the present application also provides a biomarker SAE1 for judging the prognosis of intrahepatic cholangiocarcinoma. The expression of SAE1 in tissues can reflect the prognosis of patients with intrahepatic cholangiocarcinoma. High expression of SAE1 in tissues indicates poor prognosis of patients with intrahepatic cholangiocarcinoma.

[0011] To achieve the above object, the present application adopts the following technical solutions:

[0012] The present inventors have confirmed in previous work that Circ-RAPGEF5 is a circular RNA specifically expressed in intrahepatic cholangiocarcinoma and is significantly related to the prognosis of intrahepatic cholangiocarcinoma. In the present application, the expression of SAE1 in Circ-RAPGEF5 down-regulated cell lines RBE, CCLP1 and 9810 of intrahepatic cholangiocarcinoma was found to be significantly low by second-generation sequencing. It is indicated that SAE1 may be a downstream effector molecule of Circ-RAPGEF5. Then, an expression inhibitor SiRNA of SAE1 was designed, and the SiRNA was transfected into intrahepatic cholangiocarcinoma cell lines, and the knockdown efficiency of SiRNA on SAE1 was detected by qRT-PCR. The changes of cell viability, cell cycle, apoptosis, migration ability and invasion ability of cells before and after transfection were detected by CCK8 experiment, flow cytometry and Transwell experiment. It is clear that the expression inhibition of SAE1 can reverse the progression of intrahepatic cholangiocarcinoma. Subsequently, an inhibitor compound ML-792 of SAE1 was anchored, which is a selective SAE / SUMO inhibitor. The half-inhibitory concentration of ML-792 on intrahepatic cholangiocarcinoma cells was determined by CCK8 experiment and IC50 analysis, and it was proved that ML-792 can effectively inhibit the progression of intrahepatic cholangiocarcinoma. In addition, in the animal model of PDX tumor-bearing mice, the PDX tumor volume and growth curve were detected under the treatment of peritumoral injection of ML-792, and it was proved in the preclinical model that ML-792 can reverse the progression of intrahepatic cholangiocarcinoma in vivo. Next, it was determined that the high expression of SAE1 is related to the poor prognosis of patients with intrahepatic cholangiocarcinoma by detecting the expression amount of SAE1 in the tissue chip prepared from clinical tumor samples of patients with intrahepatic cholangiocarcinoma, and the prognosis of patients with intrahepatic cholangiocarcinoma can be predicted by detecting the expression level of SAE1.

[0013] On the basis of the above research, the present application finds that SAE1 is a specific biomarker for intrahepatic cholangiocarcinoma, and the Ensembl number of the SAE1 biomarker is ENSG00000142230.

[0014] Further, the present application also proposes the application of SiRNA and inhibitor ML-792 of SAE1 in the preparation of drugs for reversing intrahepatic cholangiocarcinoma. The SAE SiRNA includes Si-SAE1#1 and Si-SAE1#2. Si-SAE1#1: CAGAAGATCCCGGAGCTCA; Si-SAE1#2: CAGGGATGTCATAGTTAAA.

[0015] The ML-792 CAS number is 1644342-14-2.

[0016] Preferably, the intrahepatic cholangiocarcinoma includes an intrahepatic cholangiocarcinoma cell line and an intrahepatic cholangiocarcinoma tumor-bearing mouse.

[0017] More preferably, the intrahepatic cholangiocarcinoma cell line is RBE or CCLP1.

[0018] In the application, the drug inhibits the expression and activity of SAE1 to achieve the purpose of treating intrahepatic cholangiocarcinoma.

[0019] Further, the application also provides a use of a reagent for detecting the expression level of SAE1 in the preparation of a disease progression prediction reagent for an intrahepatic cholangiocarcinoma patient.

[0020] Preferably, the reagent for detecting the expression level of SAE1 is a primer, which is composed of an upstream primer and a downstream primer.

[0021] Preferably, the sequence of the upstream primer is CACTCAATTCGATGCTGTGTGT, and the sequence of the downstream primer is CCATGGTAGCCAAAAACATCTCC.

[0022] Compared with the prior art, the application has the advantages and beneficial effects:

[0023] The SAE1 biomarker discovered for the first time in the application is a brand-new intrahepatic cholangiocarcinoma treatment and prognosis prediction target. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Fig. 1 is a sequencing result diagram of three intrahepatic cholangiocarcinoma cells RBE, CCLP1 and 9810 after knockdown of Circ-RAPGEF5.

[0025] Figure 2 Fig. 2 is a qRT-PCR detection result diagram of the mRNA level of SAE1 in cells after knockdown of the circular RNA Circ-RAPGEF5.

[0026] Figure 3: The verification of the knockdown efficiency of Si-SAE1#1, Si-SAE1#2 in RBE, CCLP1 cell lines. A: The verification of the knockdown efficiency in RBE cells; B: The verification of the knockdown efficiency in CCLP1 cells.

[0027] Figure 4 : CCK8 experiment to detect the effect of SiRNA of SAE1 on the growth activity of intrahepatic cholangiocarcinoma cell lines. A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0028] Figure 5 : Flow cytometry to detect the changes of cell cycle after Si-SAE1#1, Si-SAE1#2 treatment. A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0029] Figure 6 : Flow cytometry to detect the changes of apoptosis rate after Si-SAE1#1, Si-SAE1#2 treatment. A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0030] Figure 7 : Transwell experiment to detect the changes of cell migration ability after SAE1 knockdown treatment. A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0031] Figure 8 : Transwell experiment to detect the changes of cell invasion ability after SAE1 knockdown treatment. A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0032] Figure 9 : CCK8 experiment to detect the drug half-inhibitory concentration (IC50) of ML-792 in cells

[0033] Figure 10 : CCK8 experiment to detect the drug half-inhibitory concentration (IC50) of ML-792 in intrahepatic cholangiocarcinoma cells. Figure A: Experimental results in RBE cells; B: Experimental results in CCLP1 cells.

[0034] Figure 11 : Transwell experiment with Matrigel to evaluate the effect of different concentration gradients of ML-792 on the invasion function of intrahepatic cholangiocarcinoma cells.

[0035] Figure 12 : Flowchart of ML-792 in vivo experiment of PDX tumor-bearing mice.

[0036] Figure 13: The tumor growth of the four groups of tumor-bearing mice after 18 days of ML-792 treatment.

[0037] Figure 14 : The tumor growth curve of each group of tumor-bearing mice in vivo after ML-792 treatment.

[0038] Figure 15 : Representative FISH images (20X) of SAE1 high and low expression in the tissue chip made from tumor tissues of 91 patients with intrahepatic cholangiocarcinoma.

[0039] Figure 16 : Survival curve of patients with high and low expression of SAE1 based on tissue chip, log-rank test was used for survival analysis and comparison. DETAILED DESCRIPTION

[0040] Example 1. SAE1 is significantly associated with the expression of Circ-RAPGEF5 in intrahepatic cholangiocarcinoma cells

[0041] 1. Human intrahepatic cholangiocarcinoma cell lines (RBE, CCLP1, 9810) were from the American Type Culture Collection (ATCC, Manassas, VA). RBE and CCLP1 cell lines were cultured in high glucose Dulbecco's Modified Eagle's Medium (DMEM, Gibco, USA) containing 10% fetal bovine serum. The 9810 cell line was cultured in RPMI 1640 (Gibco, USA) medium containing 10% fetal bovine serum. All cell lines were cultured in a humidified incubator at 37°C, 5% CO 2 2. Cell transfection of siRNA was performed using Lipofectamine 3000 reagent (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's instructions. In brief: select adherent cells growing to 25%-50% for transfection. Each six-well plate was prepared according to the ratio of Opti-MEM serum-free culture, siRNA and Lipofectamine 3000 125 μl:7.5 μl:7.5 μl. The experimental group and the control group were added with pretreated siRNA and blank siRNA, respectively, and the medium was added to a total volume of 2 ml per well. The medium was changed 8-24 hours after transfection according to the cell state. After transfection, the transcriptome sequencing analysis of cholangiocarcinoma was performed: first, Si-Circ-RAPGEF5 and negative control siRNA were used to transfect RBE, CCLP1 and 9810 cells. Then, total RNA was extracted from these cells using TRIzol reagent (Invitrogen, Carlsbad, CA). After extraction, the RNA was used to construct a sequencing library, and then sequenced on an Illumina NovaseqTM 6000 platform. Transcriptome sequencing analysis was performed by RiboBio Biotechnology Co., Ltd. in Guangzhou, China.

[0042] 2. qRT-PCR verification of transcriptome sequencing results

[0043] After transfecting Si-RAPGEF5 into intrahepatic cholangiocarcinoma cells using Lipofectamine 3000 reagent and culturing for 2 days, total RNA in the cells was extracted using TRIzol reagent. The extracted RNA was subjected to qRT-PCR experiment to detect the expression level of the gene. The qRT-PCR experiment procedure was as follows: 1 microgram of total RNA was reversely transcribed into complementary DNA by Hifair II 1st Strand cDNA Synthesis Kit (YEASEN, Shanghai, China). Then, SYBR Green Master Mix (YEASEN, Shanghai, China) was used to perform quantitative real-time polymerase chain reaction (qRT-PCR) analysis in a LightCycler 480 (Roche, Basel, Switzerland) machine. The relative expression of RNA was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for statistical comparison, and three repeated wells were designed for each sample. T-test was used for comparison between groups, and P<0.05 was considered to have statistically significant difference. (*P<0.05, **P<0.01, ***P<0.001). Statistical analysis and mapping were performed using GraphPad Prism 9 software (San Diego, CA).

[0044] Results: The inventors' previous studies found that circular RNA Circ-RAPGEF5 was significantly increased in intrahepatic cholangiocarcinoma tissues and was associated with poor prognosis of patients. In order to find specific intervention targets for intrahepatic cholangiocarcinoma and study the specific mechanism of Circ-RAPGEF5 promoting invasion and migration of intrahepatic cholangiocarcinoma cells, the inventors performed transcriptome RNA sequencing analysis on RBE, CCLP1 and 9810 cells transfected with Si-Circ-RAPGEF5 and negative control. The sequencing results showed that compared with the negative control group, the expression of 11 kinds of mRNA in the Si-Circ-RAPGEF5 group had significant differences in the three intrahepatic cholangiocarcinoma cell lines (P<0.05), among which the expression levels of 6 kinds of mRNA were significantly down-regulated, and the expression levels of 5 kinds of mRNA were significantly up-regulated. Figure 1 Subsequently, the inventors verified the expression of the 6 down-regulated mRNAs through cell culture, transfection and qRT-PCR experiment, and found that in intrahepatic cholangiocarcinoma cells, Circ-RAPGEF5 was knocked down, and the down-regulation amplitude of SAE1 was the largest. Figure 2), which suggests that SAE1 can be an important target for intrahepatic cholangiocarcinoma and has important significance for the occurrence and development of tumors.

[0045] Example 2. SAE1 expression inhibitor SiRNA inhibits the proliferation and metastasis of intrahepatic cholangiocarcinoma in vitro

[0046] 1. qRT-PCR experiment verifies the SiRNA knockdown efficiency of SAE1

[0047] The present application designs and synthesizes two small interfering RNAs (SiRNA) Si-SAE1#1 and Si-SAE1#2 for SAE1. The SAE1 SiRNA sequence is: Si-SAE1#1: CAGAAGATCCCGGAGCTCA; Si-SAE1#2: CAGGGATGTCATAGTTAAA.

[0048] SiRNA cell transfection is performed according to the manufacturer's instructions using Lipofectamine 3000 reagent (Thermo Fisher Scientific, Waltham, MA). The qRT-PCR experiment is used to verify the knockdown efficiency of Si-SAE1#1 and Si-SAE1# on the expression level of SAE1 gene. The experimental steps of qRT-PCR are as described above. The expression level of SAE1 is detected using SAE1 primers. The SAE1 primers consist of an upstream primer and a downstream primer, the upstream primer sequence is: CACTCAATTCGATGCTGTGTGT; and the downstream primer sequence is: CCATGGTAGCCAAAAACATCTCC.

[0049] 2. CCK-8 cell activity detection experiment

[0050] Intrahepatic cholangiocarcinoma cells in the logarithmic growth phase were taken, digested with trypsin / EDTA (Gibco by Life Technologies, Grand Island, NY, USA), and prepared into a single cell suspension. The 96-well plate was inoculated at a cell concentration of 5000 cells per well, with 3 repeated holes. Incubate at 37°C, 5% CO 2 in the incubator for 5 days, and detect the cell viability every day to draw the growth curve of cell viability. The detection method is: discard the culture medium in the hole, add 100 μl of fresh culture medium and 10 μl of CCK8 solution to each hole, and incubate at 37°C for 90 minutes. After the culture is completed, place the 96-well plate in the enzyme marker, and detect the absorbance value of each hole at OD450 nm wavelength.

[0051] 3. Apoptosis analysis

[0052] For the determination of apoptosis, logarithmically growing intrahepatic cholangiocarcinoma cells were digested with trypsin / EDTA and prepared into single cell suspension, washed with PBS and stained with Annexin V-APC / 7-AAD apoptosis kit (MULTI SCIENCES, Hangzhou, China). The stained cells were subjected to apoptosis analysis on BD LSR II flow cytometer (MULTI SCIENCES, Hangzhou, China).

[0053] 4. Cell cycle analysis

[0054] For the determination of cell cycle, logarithmically growing intrahepatic cholangiocarcinoma cells were digested with trypsin / EDTA and prepared into single cell suspension, washed with PBS and fixed in 75% alcohol at -20°C overnight. Then, the cells were subjected to propidium iodide (PI) staining using cell cycle staining kit (MULTI SCIENCES, Hangzhou, China). The stained cells were subjected to analysis of percentage of cell cycle distribution on BD LSR II flow cytometer (MULTI SCIENCES, Hangzhou, China).

[0055] 5. Transwell assay for cell migration and invasion

[0056] Transwell assay was performed using 24-well cell culture plates with 8-μm pore size transwell membrane chambers (transwell TM Permeable Polyester Membrane Inserts from Corning Inc.). The invasion and migration abilities of the cells were determined with or without Matrigel coating. Specifically, logarithmically growing intrahepatic cholangiocarcinoma cells were digested with trypsin / EDTA and prepared into single cell suspension. According to the cell status, 2-6*10 4 cells were added into each transwell chamber in 150 ul medium without fetal bovine serum, and 600 ul medium with 10% fetal bovine serum was added into the lower chamber. After 48 h of incubation, the cells migrated to the bottom surface of the chamber. The migrated cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet, and then photographed under a microscope. ImageJ software (National Institutes of Health) was used for cell counting.

[0057] Results: The role of SAE1 in the progression of intrahepatic cholangiocarcinoma has not been reported previously. Therefore, the present application investigates whether the expression inhibitor of SAE1 affects the biological behavior of intrahepatic cholangiocarcinoma cells. The inventors designed two SiRNAs (Si-SAE1#1 and Si-SAE1#2) of SAE1 as expression inhibitors of SAE1. After transfecting SiRNA into intrahepatic cholangiocarcinoma cells, the efficiency of knockdown of SiRNA was verified by qRT-PCR experiment Figure 3 ). After transfecting Si-SAE1#1 or Si-SAE1#2, the mRNA expression level of SAE1 was significantly reduced. Then, the present application detects the effect of the expression inhibitor of SAE1 on the proliferation and invasion ability of intrahepatic cholangiocarcinoma cells. CCK-8 experiment shows that SAE1 SiRNA significantly inhibits the proliferation ability of RBE and CCLP1 cells Figure 4 ). The results of flow cytometry for cell cycle detection show that SAE1 SiRNA significantly increases the proportion of RBE and CCLP1 cells in G0 / G1 phase, and inhibits the transition of cell cycle to S phase Figure 5 ). The results of flow cytometry for cell apoptosis detection show that SAE1 SiRNA can significantly promote the apoptosis of intrahepatic cholangiocarcinoma cells Figure 6 ). The results of Transwell experiment for detecting the migration and invasion ability of cells show that the two SiRNAs of SAE1 can inhibit the migration and invasion of RBE and CCLP1 cells. In summary, the expression inhibitor of SAE1 significantly inhibits cell proliferation, migration and invasion and inhibits cell apoptosis in vitro.

[0058] Example 3. SAE1 inhibitor ML-792 inhibits the activity of intrahepatic cholangiocarcinoma in vivo and in vitro

[0059] 1. CCK8 method for detecting the half-inhibitory concentration (IC50) of cells to ML-792.

[0060] ML-792 is purchased from MCE website, with CAS number 1644342-14-2, and the chemical structural formula is as shown in the following figure:

[0061]

[0062] The concentration gradient of ML-792 solution was configured as 0 μmol / L, 0.001 μmol / L, 0.01 μmol / L, 0.1 μmol / L, 1 μmol / L, and 10 μmol / L. Three sub-wells were set for each concentration, and the corresponding drug was added to the 96-well plate. Then, the CCK8 experiment was performed according to the foregoing method. After 48 hours of culture, the absorbance values of the control wells (0 μmol / L of ML-792 solution was added) and the drug-added wells were used to analyze and calculate the growth inhibition rate of the cells by the statistical method, and then the IC50 of ML-792 on the cells was calculated.

[0063] The concentration of ML-792 solution was configured as 3.2 μmol / L, 1.6 μmol / L, 0.8 μmol / L, 0.4 μmol / L, 0.2 μmol / L, and 0 μmol / L (no ML-792 was added as a control group) by a two-fold dilution method, and the CCK8 experiment was performed in RBE and CCLP1 cells to determine the more specific IC-50 value of ML-792 on different intrahepatic cholangiocarcinoma cell lines.

[0064] Results: In the intrahepatic cholangiocarcinoma cells, ML-792 showed a dose-dependent cell viability inhibition effect. As shown in the table, the cell IC50 of ML-792 was about 0.1 μmol / L to 10 μmol / L. Further experiments confirmed that the IC50 of RBE cells was about 1.7 μmol / L; the IC50 of CCLP1 cells was about 1.1 μmol / L. Figure 9 Figure 10 ) This result suggests that ML-792 can effectively inhibit the proliferation of intrahepatic cholangiocarcinoma.

[0065] The Transwell experiment for cell invasion was performed according to the foregoing concentration gradient of ML-792, and the results are shown in the table. Figure 11 As can be observed, the invasion of RBE and CCLP1 cells gradually decreased with the increase of the concentration of ML-792. Figure 11

[0066] 2. Inhibition of intrahepatic cholangiocarcinoma activity by SAE1 inhibitor ML-792 in vivo

[0067] The inventors used a 59-year-old male patient with intrahepatic cholangiocarcinoma from the Department of General Surgery of the Shao Yifu Hospital of Zhejiang University School of Medicine to construct a subcutaneous xenotransplantation model. After obtaining the informed consent of the patient, the patient underwent radical resection of intrahepatic cholangiocarcinoma, and the intrahepatic cholangiocarcinoma tumor tissue was obtained for subsequent research. The research protocol was also approved by the Ethics Committee of the Shao Yifu Hospital.

[0068] ​​The specific method of constructing the animal model is as follows: the inventors implanted fresh ICC tumor tissue pieces removed from patients into the subcutaneous tissue of male NOD / SCID mice aged 4-6 weeks. After two months of growth, when the tumor grew to 1 cm in diameter, the first generation PDX tumor was harvested and broken down into approximately 1 mm 3 Then, these small tissue blocks were subcutaneously transplanted into 20 (5 per group) 4 to 6-week-old male BALB / c nude mice to establish a second-generation PDX model. The inventors prepared ML-792 solution dissolved in a mixture of DMSO, PEG300, Tween-80 and normal saline and its control solution (without ML-792); Circ-RAPGEF5 overexpression plasmid virus solution and its control empty plasmid virus solution according to the instructions of the reagent manufacturer. When the tumor grew to 3 mm, the area surrounding the tumor was injected with drugs every two days, and the growth of the tumor in the nude mice was observed regularly. After 18 days of treatment, the mice were euthanized and the tumor tissue was removed for analysis. This animal study followed the guidelines of the American Association for Assessment and Accreditation of Laboratory Animal Laboratories and the Animal Ethics Committee of this center.

[0069] Results: In order to study the role of ML-792 in inhibiting the progression of intrahepatic cholangiocarcinoma in a model closer to the clinical situation, the inventors selected a patient-derived tumor xenograft (PDX) model for in vivo experiments. The mice were randomly divided into 4 groups. After the second-generation tumors grew for 1 month, the treatment was injected around the tumor every two days. The first group of mice were injected with empty plasmid virus solution and blank control solution of ML-792 peritumorally; the second group of mice were injected with Circ-RAPGEF5 overexpression virus solution and blank control solution of ML-792 peritumorally; the third group of mice were injected with empty plasmid virus solution and ML-792 solution peritumorally; the fourth group of mice were injected with Circ-RAPGEF5 overexpression virus solution and ML-792 solution. After 18 days of treatment, we euthanized the mice ( Figure 12 Tumor photos after treatment showed that the tumor size of mice treated with ML-792 (Group 3) was significantly smaller than that of the blank control group (Group 1), and ML-792 could rescue the tumor enlargement caused by Circ-RAPGEF5 (Group 4). Figure 13 ). The growth curve of tumor volume is as follows Figure 14 As shown, the tumor growth rate was significantly slowed down after ML-792 treatment.

[0070] The above results indicate that the SAE1 inhibitor ML-792 can effectively inhibit the growth of intrahepatic cholangiocarcinoma in vivo.

[0071] Example 4. High expression of SAE1 may predict poor prognosis in patients with intrahepatic cholangiocarcinoma

[0072] Ninety-one intrahepatic cholangiocarcinoma tumor tissues and paracancerous samples were collected and made into tissue chips to verify the clinical effects of SAE1 high / low expression patients. To detect the expression level of SAE1 in patient samples and tissue chips, the inventors performed immunofluorescence experiments. Briefly: 4% formalin-fixed tissue slides were incubated with SAE1 antibody after blocking with 5% goat serum. SAE1 was stained with a fluorescent secondary antibody, and the nucleus was counterstained with DAPI stain. Fluorescent images were visualized by EVOS microscope (Thermo Fisher Scientific, Waltham, MA). Gene expression levels were evaluated by staining cell percentage (0-100%) and staining intensity (0=negative, 1=weak, 2=moderate, 3=strong). Semi-quantitative evaluation was performed using histochemical score (H-SCORE), which was calculated by multiplying the percentage of stained cells (ranging from 0% to 100%) by the staining intensity (ranging from 0 to 3). All H-SCOREs were normalized to a range of 0 to 100. Less than or equal to 50 points were considered the low expression group, and more than 50 points were considered the high expression group. Count data were expressed as absolute numbers. The inventors used the Kaplan-Meier method to evaluate cumulative survival time and used the log-rank test to compare cumulative survival time between groups.

[0073] Results: To further investigate the relationship between SAE1 and Circ-RAPGEF5, the inventors collected 91 intrahepatic cholangiocarcinoma tumor tissues and made them into tissue chips for FISH detection. According to the expression level of SAE1, patients were divided into SAE1 high expression group and SAE1 low expression group. Figure 15 Table 1 shows the analysis of clinical outcome indicators in SAE1 high and low expression groups. It can be seen that the incidence of distant metastasis (p=0.001) and TNM stage (p=0.019) in patients with high expression of SAE1 were significantly worse than those in patients with low expression of SAE1. In addition, the log-rank test found that the overall survival of patients with high expression of SAE1 was also significantly worse than that of patients with low expression of SAE1. Figure 16 The above results suggest that high expression of SAE1 biomarker level predicts poor prognosis of intrahepatic cholangiocarcinoma patients, and high and low expression levels of SAE1 biomarker can predict the prognosis of intrahepatic cholangiocarcinoma patients.

[0074] Table 1

[0075]

Claims

1. Use of a reagent for detecting the gene expression level of SAE1 gene in tumor tissue in the preparation of a kit for predicting the prognosis of intrahepatic cholangiocarcinoma.

2. Use of a reagent for detecting the gene expression level of SAE1 gene in tumor tissue in the manufacture of a kit for predicting the prognosis of intrahepatic cholangiocarcinoma, characterized in that, The higher the level of SAE1 in the sample from the tumor tissue to be tested of intrahepatic cholangiocarcinoma, the higher the malignancy of intrahepatic cholangiocarcinoma.

3. Use according to claim 1, characterized in that, The reagent for detecting the gene expression level of SAE1 gene in tumor tissue comprises an upstream primer sequence and a downstream primer sequence: The upstream primer sequence is CACTCAATTCGATGCTGTGTGT; The downstream primer sequence is CCATGGTAGCCAAAAACATCTCC.

4. Use according to claim 1, characterized in that, The SAE1 protein inhibitor is ML-792, and the structure is as follows: