A molecular marker for identifying the genetic sex of different populations of largemouth bass, its primer pairs, and their applications.
By designing molecular markers and primer pairs at specific locations in the largemouth bass genome, and combining PCR amplification and gel electrophoresis, the problem of low accuracy in sex identification of Taiwan bass and Sichuan bass was solved, achieving efficient and accurate sex identification and providing technical support for largemouth bass breeding.
Patent Information
- Application Number
- CN202511349944.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-22
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-09-22
AI Technical Summary
Existing technologies are not accurate enough in identifying the genetic sex of different geographical populations of largemouth bass, especially in Taiwan bass and Sichuan bass, where the accuracy rate is less than 80%, and they lack a focus on the differentiation of sex-determining loci.
A molecular marker (SEQ ID NO.1) was designed and located at a specific position in the largemouth bass genome database. Combined with primer pairs MF (SEQ ID NO.2) and MR (SEQ ID NO.3), sex identification of different largemouth bass populations was achieved by PCR amplification and detection by agarose gel electrophoresis.
The method achieved 100% accuracy in sex identification of largemouth bass, including perch, Taiwan perch, and Sichuan perch, and could produce results within one day, providing high repeatability and accuracy, and laying a technical foundation for sex-controlled breeding of largemouth bass.
Smart Images

Figure CN120829979B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker for identifying the genetic sex of different populations of largemouth bass, its primer pairs, and their applications. Background Technology
[0002] Largemouth bass ( Micropterus salmoides Largemouth bass, also known as California bass, originated in North America. Since its introduction to my country in 1980, it has rapidly become an important freshwater aquaculture species in my country due to its delicious meat, lack of intramuscular bones, rapid growth, and short farming cycle. According to the "2024 China Fisheries Statistical Yearbook," the national production of largemouth bass in 2023 reached 888,000 tons, ranking among the top in terms of growth rate among freshwater aquaculture fish in my country. Based on its morphological characteristics and geographical distribution, the largemouth bass is divided into the northern subspecies (…). M. salmoides salmoides ) and Florida subspecies ( M. salmoides floridanus The northern subspecies of largemouth bass is distributed in the central and eastern United States, northeastern Mexico, and southeastern Canada, while the Florida subspecies is distributed in southern Florida. In recent years, due to the limited introduction of new germplasm resources and the practice of self-breeding by farmers, the genetic diversity of largemouth bass has significantly decreased, and desirable traits have degenerated considerably. This is mainly manifested in frequent disease outbreaks, precocious sexual maturity, and slower growth rates during aquaculture. Therefore, targeted breeding of new largemouth bass varieties is urgently needed. Existing research shows that largemouth bass exhibits sexual dimorphism in its early stages. After 60 days of artificial rearing, male fish show better growth performance, and their liver antioxidant capacity, immune indicators, and intestinal physical barrier function are all superior to those of females. Furthermore, largemouth bass exhibits significant sexual dimorphism in shape, net meat yield, and feed conversion ratio, with males showing better shape, higher net meat yield, and lower feed conversion ratio. Therefore, cultivating asexually differentiated superior varieties has significant economic value for the industry's development.
[0003] Before sexual maturity, it is difficult to distinguish the sex of largemouth bass from external morphology. The sex determination type of largemouth bass is XX / XY, and the development and identification of sex molecular markers is one of the key technologies for producing all-male fry. Currently, Chinese patent CN114717301A discloses a molecular marker and its primer pair for identifying the genetic sex of largemouth bass. This marker is located on the X chromosome and is absent on the Y chromosome. Using this primer pair, the sex ratio of largemouth bass embryos, larvae, and adults can be easily, quickly, and stably identified with 100% accuracy. Chinese patent CN113637765A has developed SNP markers for the genetic sex identification of largemouth bass. However, the accuracy of these disclosed molecular markers for the genetic sex of largemouth bass is less than 80% in different geographical populations of Taiwanese and Sichuan perch, possibly due to differentiation in the selection of sex-determining loci. Furthermore, no relevant literature has been published on the genetic sex identification of Taiwanese and Sichuan perch. Summary of the Invention
[0004] To address the problems existing in the prior art, the purpose of this invention is to design and provide a molecular marker, primer pairs, and application method for identifying the genetic sex of largemouth bass in different populations. This invention can accurately identify the genetic sex of largemouth bass in species such as the Pacific perch, Taiwan perch, and Sichuan perch.
[0005] The present invention is implemented using the following technical solutions:
[0006] The first aspect of the present invention provides a molecular marker for identifying the genetic sex of different populations of largemouth bass, as shown in SEQ ID NO.1, which is located between positions 35054224 and 35054476 on linkage group 15 of the genetic sex database (ASM2243578v1).
[0007] A second aspect of the present invention provides a primer pair for identifying the genetic sex of different populations of largemouth bass. The primer pair includes primers MF and MR, wherein the nucleotide sequence of primer MF is shown in SEQ ID NO.2 and the nucleotide sequence of primer MR is shown in SEQ ID NO.3.
[0008] A third aspect of the present invention provides a kit containing the above-described primer pairs.
[0009] The fourth aspect of this invention provides the application of the above-mentioned primer pairs in identifying the genetic sex of different populations of largemouth bass.
[0010] The fifth aspect of the present invention provides a method for identifying molecular markers of genetic sex in different populations of largemouth bass using the above-mentioned primer pairs, wherein the method involves PCR amplification of the DNA to be tested using the above-mentioned primer pairs.
[0011] The sixth aspect of this invention provides a method for identifying the genetic sex of largemouth bass from different populations. This method uses the above-mentioned primer pair for PCR detection. If the PCR amplification fragment has two specific bands of different sizes, 307 bp and 253 bp, then the genetic sex of the largemouth bass to be tested is determined to be male; if the PCR amplification fragment has only one specific band, 253 bp, then the genetic sex of the largemouth bass to be tested is determined to be female.
[0012] Furthermore, the reaction system for the PCR detection is as follows, with a total reaction volume of 20 μL: 10 μL of 2× Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; and 0.5 μL / 0.5 μL of MF / -R.
[0013] Furthermore, the amplification conditions for the PCR detection are: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; extension at 72℃ for 10 min.
[0014] Compared with the prior art, the beneficial effects of the present invention are:
[0015] This invention extracts DNA from largemouth bass samples, performs PCR amplification using primers with sex-specific molecular markers, and then detects the sex using agarose gel electrophoresis. This method accurately identifies the sex of largemouth bass, achieving 100% accuracy compared to previous techniques for sex detection in perch, Taiwan perch, and Sichuan perch, with results available on the same day and high reproducibility. This method lays a technological foundation for sex-controlled breeding and asexual reproduction in largemouth bass. Attached Figure Description
[0016] Figure 1 Agarose gel electrophoresis results of sex-specific molecular markers for largemouth bass;
[0017] Figure 2 Sequencing results of sex-specific molecular marker PCR products for largemouth bass. Detailed Implementation
[0018] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0019] Example 1: Application of primer pairs for identifying the genetic sex of different populations of largemouth bass
[0020] 1. Experimental Materials
[0021] The largemouth bass used in this embodiment were different groups of Taiwan bass, Sichuan bass, and Guangzhou bass collected and preserved by Huzhou Rongsheng Fishery Technology Co., Ltd. in the early stage. Each group was injected with PIT electronic tags and then cultured separately.
[0022] 2. Sample Selection
[0023] Three groups of perch—Taiwan perch, Sichuan perch, and Guangzhou perch—were selected for sampling. Before sampling, the gonads were dissected to determine the sex, and the tail fins were cut off and preserved in 95% ethanol at -80°C for later use.
[0024] 3. Gene DNA extraction
[0025] DNA was extracted from male and female samples of different populations of perch, Taiwan perch, and Guangyu perch using a blood / cell / tissue genomic DNA extraction kit (Cat No. DP304-03). The quality and concentration of genomic DNA were detected by NanoDrop 2000 1.2% agarose gel electrophoresis. Finally, the extracted DNA was diluted to 50 ng / μL and stored for later use.
[0026] 4. PCR amplification and gel electrophoresis detection
[0027] Primer pairs were designed using a molecular marker for the genetic sex of largemouth bass (the molecular marker shown in SEQ ID NO.1, located between positions 35054224 and 35054476 on linkage 15 of the largemouth bass genome database ASM2243578v1). The primer pairs used in this embodiment include:
[0028] MF:GTCCTACGGAGTAGCTCAGTCC (SEQ ID NO.2)
[0029] MR:GTCTGCAGTGTCTAGTCTGAACG (SEQ ID NO.3)
[0030] The above primer pairs were used to perform PCR amplification using DNA samples from male and female largemouth bass as templates.
[0031] The PCR reaction system was as follows: 10 μL of 2× Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; 0.5 μL / 0.5 μL of MF / -R.
[0032] The reaction program was as follows: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; extension at 72℃ for 10 min, followed by storage at 4℃.
[0033] After PCR amplification, the results were detected by 2% agarose gel electrophoresis at V-130V, A-400mA, and T-50 min.
[0034] 5. Results Analysis
[0035] PCR amplification and agarose gel electrophoresis were performed on 18 male and female samples of largemouth bass from three populations (Sichuan perch, Taiwan perch, and Guangdong perch) in China. The results showed that female samples of largemouth bass showed a single band with a size of 253 bp, while male samples showed two bands with sizes of 307 bp and 253 bp, respectively. Figure 1 The test results were consistent with the sampling results, and the detection accuracy rate was 100%.
[0036] 6. Sequencing analysis
[0037] The SanPrep column-based DNA gel extraction kit (Sangon Biotech, Shanghai) was used to extract DNA from the gel. Figure 1 The obtained 253 bp bands from females and 307 bp and 253 bp bands from males were gel-cut and recovered. After confirming the concentration was acceptable, they were ligated into the pESI-T vector, transformed into DH5α competent cells, and positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results are as follows: Figure 2 As shown, X represents the 253 bp band in females and Y represents the 307 bp band in males.
Claims
1. A molecular marker for identifying the genetic sex of largemouth bass in different populations, characterized in that, The molecular markers are shown in SEQ ID NO.1 and SEQ ID NO.
4.
2. A primer pair for identifying the genetic sex of different populations of largemouth bass, characterized in that, The primer pair includes primers MF and MR, the nucleotide sequence of primer MF is shown in SEQ ID NO.2, and the nucleotide sequence of primer MR is shown in SEQ ID NO.
3.
3. A kit containing the primer pair as described in claim 2.
4. The application of the primer pair as described in claim 2 or the kit as described in claim 3 in identifying the genetic sex of different populations of largemouth bass.
5. A method for identifying the molecular marker shown in claim 1 using the primer pair described in claim 2, characterized in that, PCR amplification of the DNA to be tested was performed using the primers of claim 2.
6. A method for identifying the genetic sex of largemouth bass from different populations, characterized in that, Using the primer pair of claim 2 for PCR detection, if the PCR amplification fragment has two specific bands of different sizes, 307 bp and 253 bp, then the genetic sex of the largemouth bass to be tested is determined to be male. If the PCR amplification fragment has only one specific band of 253 bp, then the genetic sex of the largemouth bass being tested is determined to be female.
7. The method as described in claim 6, characterized in that, The reaction system for the PCR detection was as follows: with a total reaction volume of 20 μL, 10 μL of 2× Taq PCR mix; 8 μL of Depc H2O; 1 μL of DNA template; and 0.5 μL / 0.5 μL of MF / -R.
8. The method as described in claim 6, characterized in that, The amplification conditions for the PCR detection were: 94℃, 5 min; 94℃, 30 s; 60℃, 40 s; 72℃, 30 s; 35 cycles; extension at 72℃ for 10 min.
Citation Information
Patent Citations
Molecular marker for identifying genetic sex of micropterus salmoides and application
CN113637765A
InDel molecular marker related to genetic sex identification of micropterus salmoides and application of InDel molecular marker
CN113637766A
Molecular marker for identifying genetic sex of micropterus salmoides and primer pair thereof
CN114717301A