Chimeric antigen receptor macrophage as well as preparation method and application thereof

Abstract

According to the invention, the chimeric antigen receptor macrophage constructed by using the nano-liposome is used for targeted treatment of pulmonary fibrosis. The invention provides a macrophage membrane bionic nano-liposome which is used for coding a chimeric antigen receptor gene targeting a fibroblast related protein FAP and loading a Toll-like receptor 7 agonist drug. The bionic nano-liposome is specifically composed of a liposome, PLL-CA, a macrophage membrane, mannose, an agonist drug and pCAR. Based on the bionic nano-liposome, pCAR and agonist drugs can be specifically delivered into macrophages. Wherein the pCAR promotes high expression of FAP receptor protein on a macrophage membrane so as to specifically target abnormal cells of pulmonary fibrosis lesion tissues; the agonist medicine can enhance the specific phagocytic function of macrophages so as to remove abnormal cells and pathological tissues, regulate the immune microenvironment and promote tissue repair and regeneration. And a new strategy is provided for breaking through the limitation of traditional treatment for treating pulmonary fibrosis.

Description

Technical Field

[0001] This invention generally relates to the fields of biomedicine and molecular biology, and more specifically, to a chimeric antigen receptor macrophage and its preparation method, and its application in the preparation of drugs for pulmonary fibrosis. Background Technology

[0002] Pulmonary fibrosis (PF) is a chronic disease characterized by scarring of lung tissue and progressive loss of lung function. One of its core pathological mechanisms is the abnormal proliferation and activation of myofibroblasts. These cells excessively secrete extracellular matrix (ECM) and pro-fibrotic factors, triggering tissue contraction and ultimately leading to lung structural destruction and functional failure. However, due to the lack of specific biomarkers between myofibroblasts and normal fibroblasts or other interstitial cells, precise targeted therapy faces challenges and may inadvertently damage normal tissue, limiting the application of traditional therapies.

[0003] Chimeric antigen receptor (CAR) technology is a revolutionary therapy that uses genetic engineering to modify immune cells, enabling them to specifically recognize and attack target cells. Currently, chimeric antigen receptor T-cell (CAR-T) therapy has achieved significant success in the treatment of hematologic malignancies, but its application in solid tumors and fibrotic diseases is limited by several factors, including insufficient target antigen specificity, low efficiency of T-cell transport and infiltration in tissues, and the hindering effect of an immunosuppressive microenvironment. Summary of the Invention

[0004] According to embodiments of the present invention, a scheme is provided for preparing nanoliposomes encoding chimeric antigen receptors into macrophages that express chimeric antigen receptors.

[0005] In a first aspect of the invention, a nanoliposome encoding a chimeric antigen receptor is provided, the liposome comprising: a liposome, a PLL-CA, a macrophage membrane, mannose, and a pCAR recombinant plasmid, wherein the PLL-CA is generated by reacting polylysine with citrate anhydride; and the pCAR recombinant plasmid contains a sequence that edits a specific chimeric antigen receptor targeting FAP, as shown in SEQ ID NO. 1.

[0006] Furthermore, the pCAR recombinant plasmid also contains the pCD8a-41BB-CD3ζ portion, as shown in SEQ ID NO.2.

[0007] Furthermore, this also includes Toll-like receptor 7 agonist drugs.

[0008] Furthermore, the Toll-like receptor 7 agonist drug is selected from at least one of imiquimod, resiquimod, gardiquimod, loxoribine, 852A (PF-4878691), motolimod, 3M-052, CL075, and vesatolimod.

[0009] In a second aspect of the present invention, a method for preparing nanoliposomes encoding chimeric antigen receptors is provided. The specific steps of this preparation method are as follows: a. Prepare liposomes by fully dissolving cationic lipid CL and auxiliary lipid AL, or by adding Toll-like receptor 7 agonist drugs, in an organic solvent and injecting them. b. After adding PLL-CA, mannose, and macrophage cell membrane, the cell membrane is coated by co-extrusion and then homogenized by sonication to form a suspension. c. Dissolve pCAR in enzyme-free ultrapure water, add it to the suspension and mix thoroughly. Then let it stand at room temperature to obtain nanoliposomes encoding chimeric antigen receptors.

[0010] Furthermore, by mass ratio, the ratio of cationic lipid CL : accessory lipid AL : macrophage membrane : mannose : PLL-CA : hydrophilic Toll-like receptor 7 agonist drug is 20 : 10 : 30 : 6 : 3 : 3.

[0011] Furthermore, the cationic lipid CL is selected from at least one of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), dioleoylpropyltrimethylammonium chloride (DOTMA), dioleoyloxypropyltrimethylammonium chloride (DOSPA), DC cholesterol (DC-Chol), dimethyloctadecylammonium bromide (DODAB), 1,2-dimyristoyloxypropyl-3-dimethylaminoethyl ester hydrochloride (DMRIE-C), 1,2-dimyristoyl-sn-glycerol-3-ethylphosphatidylcholine (EDMPC), and (9Z,12Z)-octadecyl-9,12-dien-1-yloxypropyl-1-amine (CLinDMA).

[0012] Furthermore, the auxiliary lipid AL is selected from at least one of dioleoylphosphatidylcholine (DOPC), cholesterol (CHOL), dioleoylphosphatidylglycerol (DOPG), distearylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dioleoylphosphatidylserine (DOPS), 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), distearylphosphatidylcholine (DSPC), dimyristoylphosphatidylcholine (DMPC), and 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE).

[0013] Furthermore, the Toll-like receptor 7 agonist drug is selected from at least one of imiquimod, requimod, gadequimod, loxolibin, 852A, motolimod, 3M-052, CL075, and vesatomod.

[0014] In a third aspect of the invention, a chimeric antigen receptor macrophage is also provided, said chimeric antigen receptor macrophage being obtained from the nanoliposome-programmed macrophage described in the first aspect of the invention.

[0015] Furthermore, the specific preparation method of the chimeric antigen receptor macrophage is as follows: add nanoliposomes to M2 macrophages in serum-free culture medium, incubate for 4-8 hours, and then continue to culture in culture medium containing 10% serum for 24 hours to collect the chimeric antigen receptor macrophages.

[0016] In a fourth aspect of the invention, the application of the nanoliposomes described in the first aspect and the macrophages described in the third aspect of the invention in the preparation of drugs for pulmonary fibrosis is discussed.

[0017] Beneficial Effects: This invention provides a macrophage membrane biomimetic nanoliposome (LNP) encoding a chimeric antigen receptor gene and loading a Toll-like receptor 7 agonist drug. This biomimetic nanoliposome can specifically deliver the chimeric antigen receptor gene pCAR and the Toll-like receptor 7 agonist drug into macrophages. Highly efficient chimeric antigen receptor macrophages (CARs) expressing fibroblast activation protein (FAP) were synthesized in vitro or in situ. FAP -M), where pCAR promotes high expression of FAP receptor protein on macrophage membranes, thereby specifically targeting abnormal cells in pulmonary fibrosis lesions; Toll-like receptor 7 agonist drugs can enhance macrophage phagocytic function, enabling macrophages to specifically recognize and clear abnormal cells and pathological tissues in pulmonary fibrosis lesions, while regulating the immune microenvironment and promoting tissue repair and regeneration. Furthermore, CAR FAP-M can also inhibit the growth and metastasis of myofibroblasts by releasing cytokines, significantly improving the fibrotic microenvironment. Compared with other carriers, nanoliposomes have the advantages of wide applicability and simple preparation. In addition, nanoliposomes usually have the characteristics of precise targeting, efficient transfection and biocompatibility, resulting in fewer adverse reactions during treatment and making treatment easier for patients. This invention utilizes nanoliposomes to deliver drugs and genes in macrophages, showing significant advantages in engineered macrophages, and providing a new strategy for overcoming the limitations of traditional treatments for pulmonary fibrosis.

[0018] In contrast, macrophages exhibit unique advantages: they can directly clear abnormal cells through phagocytosis, recognize target cell surface antigens via CARs without being restricted by the Major Histocompatibility Complex (MHC), and efficiently infiltrate immunosuppressive microenvironments. Furthermore, macrophages possess high phenotypic and functional plasticity, dynamically adjusting their activity according to the microenvironment. From a safety perspective, macrophages pose a lower risk of inducing graft-versus-host disease (GVHD), have a limited circulation time in vivo, and exhibit lower toxicity. These characteristics make macrophages ideal candidates for developing chimeric antigen receptor macrophages, providing new research directions and application prospects for the treatment of pulmonary fibrosis.

[0019] It should be understood that the description in the Summary of the Invention is not intended to limit the key or essential features of the embodiments of the present invention, nor is it intended to restrict the scope of the invention. Other features of the invention will become readily apparent from the following description. Attached Figure Description

[0020] The above and other features, advantages, and aspects of the various embodiments of the present invention will become more apparent from the accompanying drawings and the following detailed description. In the drawings, the same or similar reference numerals denote the same or similar elements, wherein: Figure 1 The plasmid map of the pCAR of the present invention is shown; Figure 2 The particle size and potential of the nanoliposomes MMI-GCL are evaluated. Figure 3 The loading of pCAR by nanoliposomes MMI-GCL is shown; Figure 4 The evaluation of pCAR transfection on macrophages by nanoliposome MMI-GCL is shown; Figure 5 The toxicity evaluation of nanoliposomes MMI-GCL on macrophages is shown; Figure 6 An evaluation of the uptake of nanoliposome MMI-GCL in macrophages was presented; Figure 7 An evaluation of the lysosomal escape of the nanoliposome MMI-GCL in macrophages is presented; Figure 8 The CAR constructed after being administered to nanoliposomes MMI-GCL is shown. FAP -M morphological characterization; Figure 9 The evaluation of macrophage release factors after administration of nanoliposome MMI-GCL is shown; Figure 10 The safety evaluation of nanoliposomes MMI-GCL in vitro or in situ on lung tissue of mice with pulmonary fibrosis is shown. Figure 11 The study demonstrates the therapeutic effects of nanoliposome MMI-GCL on mice with pulmonary fibrosis, both in vitro and in situ. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.

[0022] Furthermore, the term "and / or" in this article is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. Additionally, the character " / " in this article generally indicates that the preceding and following related objects have an "or" relationship.

[0023] Example 1 The specific preparation steps for pFAP-scfv-CD8a-41BB-CD3ζ(pCAR) are as follows: (1) Primer design ① pFAP-scfv forward primer: 5'-TGCTCTAGAGCCACCATGGCCCTGCCAGT-3', SEQ ID No. 3; ② pFAP-scfv reverse primer: 5'- GCGCTCGAGCTTGATTTCCAGCTTGGTGC-3', SEQ ID No. 4; ③ pCD8a-41BB-CD3ζ forward primer: 5'- GCGCTCGAGACCACGACGCCAGCGCCGCG-3', SEQ ID No. 5; ④ pCD8a-41BB-CD3ζ reverse primer: 5'-CGCGGATCCGCGAGGGGGCAGGGCCTGCA-3', SEQ ID No. 6; (2) Directed cloning of pFAP-scfv, pCD8a-41BB-CD3ζ with vectors (XbaI + XhoI + BamHI mediated) ① PCR amplification of pFAP-scfv (containing XbaI + XhoI sites) and pCD8a-41BB-CD3ζ (containing XhoI + BamHI sites) System (50 μL, 1 tube each of pFAP-scfv and pCD8a-41BB-CD3ζ amplified): Template DNA (pFAP-scfv or pCD8a-41BB-CD3ζ) 1 μL + forward primer (10 μM) 2 μL + reverse primer (10 μM) 2 μL + 2 × Taq Mix 25 μL + ddH2O 20 μL.

[0024] Program: 95 ℃ pre-denaturation for 5 min → 35 cycles (95 ℃ for 30 s → annealing for 30 s → 72 ℃ extension, 1 kb / min) → 72 ℃ for 10 min.

[0025] ② Purify the PCR products of pFAP-scfv and pCD8a-41BB-CD3ζ The target band was separated by 1% agarose gel electrophoresis, and the gel was excised and recovered (using the Qiagen Gel Extraction Kit). The elution volume was 30 μL, and the concentration was measured (≥50 ng / μL).

[0026] (3) Double digestion of the vector with pFAP-scfv and pCD8a-41BB-CD3ζ Vector: pCDH-EF1a-MCS-T2A-copGFP ① Vector digestion system (50 μL): Vector plasmid (1 μg) 10 μL + 10×CutSmart Buffer 5 μL + XbaI (10U / μL) 2 μL + BamHI (10U / μL) 2 μL + ddH2O 31 μL.

[0027] ② pFAP-scfv enzyme digestion system (50 μL): 20 μL of purified pFAP-scfv-PCR product + 5 μL of 10×CutSmart Buffer + 2 μL of XbaI + 2 μL of XhoI + 21 μL of ddH2O.

[0028] ③ pCD8a-41BB-CD3ζ restriction enzyme digestion system (50 μL): 20 μL of purified pCD8a-41BB-CD3ζ-PCR product + 5 μL of 10×CutSmart Buffer + 2 μL of XhoI + 2 μL of BamHI + 21 μL of ddH2O ④ Incubate at 37 ℃ for 3 h → Inactivate at 65 ℃ for 20 min → The vector needs to be gel-cleaved and recovered (removing the circular plasmid), and purified by pFAP-scfv and pCD8a-41BB-CD3ζ column purification.

[0029] (4) The linkage reaction between pFAP-scfv, pCD8a-41BB-CD3ζ and the support ① System (20 μL): 3 μL linearized vector (approximately 50 ng) + 3 μL pFAP-scfv + 3 μL pCD8a-41BB-CD3ζ (molar ratio of vector: pFAP-scfv: pCD8a-41BB-CD3ζ is 1:3:3) + 2 μL 10×T4 buffer + 1 μL T4 ligase + ddH2O to make up the difference.

[0030] ② Incubate overnight at 16 ℃ → Obtain the vector-pFAP-scfv-pCD8a-41BB-CD3ζ linkage product.

[0031] (5) Conversion and verification of the ligation product ① Transformed competent cells Add 10 μL of ligation product to 100 μL of DH5α competent cells → incubate on ice for 30 min → heat shock at 42 ℃ for 90 s → incubate on ice for 2 min → add 900 μL of LB → recover on a shaker at 37 ℃ for 1 h → spread on an LB agar plate containing ampicillin → incubate overnight at 37 ℃.

[0032] ② Screening for positive clones Pick a single colony and amplify it using universal primers for the vector (e.g., M13-F / R). The size of the positive clone product = vector primer spacing + pFAP-scfv + pCD8a-41BB-CD3ζ length. Extract the plasmid of the positive clone and digest it with XbaI + BamHI. Electrophoresis should show two bands (vector linearization band + pFAP-scfv-CD8a-41BB-CD3ζ fragment band).

[0033] The primer information and specific sequences for pCAR are as follows: pFAP-scfv base sequence 5'-3' SEQ ID No. 1 (768) GCCACCATGGCCCTGCCAGTGACCGCCCTGCTGCTGCCCCTGGCCCTGCTCCTGCACGCCGCCAGACCTCAGGTGCAGCTGAAGGAATCTGGAGGCCTGGTTCAACCTGGCGGCTCTCTGAAACTGAGCTGTGCTGCTAGCGGCTTCACATTCAGCTCCTACGGCATGAGCTGGGTGCGGCAGACAGCCGACAAGCGGCTGGAGCTGGTCGCCACCACAAACAACAACGGCGGCGTCACATACTACCCCGATAGCGTGAAAGGCAGATTCACCATTAGCCGGGACAACGCCAAGAACACCCTGTACCTGCAGATGAGCAGCCTGCAGAGCGAGGATACCGCTATGTACTACTGCGCCCGCTACGGCTACTACGCCATGGACTACTGGGGACAGGGCATCAGCGTGACAGTGTCCTCCGGCGGAGGCGGTAGCGACGTGCTGATGACCCAGACCCCTCTGTGGCTGCCTGTGTCCCTCGGCGACCAGGCCAGCATCTCTTGCAGAAGCAGCCAGTCTATCGTGCACAGCAATGGCAACACATACCTGGAGTGGTATCTGCAAAAGCCCGGCCAGAGCCCTAAGCTGCTGATCTACAAGGTGTCTAATAGATTCAGCGGCGTGCCTGATAGATTTTCTGGCAGCGGCAGCGGAACCGACTTCACCGTGAAGATCAGCAGAGTGGAAGCCGAGGACCTGGGCGTGTACTATTGCTTCGGAGGCAGCCACGTGCCATACACCTTTGGCGGCGGCACCAAGCTGGAAATCAAG pCD8a-41BB-CD3ζ base sequence 5'-3' SEQ ID No.2 (669) ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC Forward primer sequence of pFAP-scfv 5'-3' SEQ ID No.3 (29) TGCTCTAGAGCCACCATGGCCCTGCCAGT Reverse primer sequence of pFAP-scfv 5'-3' SEQ ID No.4 (29) GCGCTCGAGCTTGATTTCCAGCTTGGTGC Forward sequence of pCD8a-41BB-CD3ζ 5'-3' SEQ ID No.5 (29) GCGCTCGAGACCACGACGCCAGCGCCGCG Reverse primer sequence of pCD8a-41BB-CD3ζ 5'-3' SEQ ID No.6 (29) CGCGGATCCGCGAGGGGGCAGGGCCTGCA pEGFP base sequence 5'-3' SEQ ID No.7 (759) ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCAAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGGTGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGTGCTGGTGGGCAGCTTCGCCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTTCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGCTGCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCCATCGCCTTCGCCAGATCCCGCGCTCAGTCGTCCAATTCTGCCGTGGACGGCACCGCCGGACCCGGCTCCACCGGATCTCGCTAG In some embodiments, cyan fluorescent protein (CFP), blue fluorescent protein (BFP), and yellow fluorescent protein (YFP) can be used instead of GFP. In Example 1, the fluorescent protein sequence is located on the plasmid vector. The addition of the fluorescent protein sequence to the plasmid is for subsequent experimental observation. In actual drug preparation applications, it is not necessary to add the fluorescent protein sequence; only the pFAP-scfv-CD8a-41BB-CD3ζ sequence is required.

[0034] The prepared pCAR plasmid is shown in the figure below. Figure 1 As shown.

[0035] Example 2 Preparation process of nanoliposomes MMI-GCL, MMI-CL and MM-GCL (1) Implementation steps for preparing MMI-GCL using the injection method: a. Accurately weigh 1 mg of DOTAP, 0.5 mg of DOPE and 0.15 mg of Imiquimod (IMQ), dissolve them thoroughly in dimethyl sulfoxide, mix them and inject them into 1 ml of PBS buffer. Leave the mixture open overnight to allow it to evaporate. Then, homogenize it thoroughly using an ultrasonic homogenizer and centrifuge to concentrate it to 0.5 ml. b. Cell membrane coating by co-extrusion: PLL-CA 0.15 mg, mannose (Man) 0.3 mg, and macrophage membrane (RM) 1.5 mg were added sequentially and then homogenized using an ultrasonic homogenizer after passing through a 100 nm extruder to obtain the nano-formulation MMI-CL; Specifically, the preparation of macrophage membranes (RM) is as follows: Remove the incubated macrophage culture dish from the cell culture incubator, aspirate 1 ml of pH 7.0 phosphate buffer (PBS) to detach the cells, collect the detached macrophages, and transfer them to a 15 ml centrifuge tube. Place the centrifuge tube at -20 ℃ for one week, repeatedly freezing and thawing. Add 1 ml of pH 7.0 PBS to the frozen and thawed macrophages, mix well, and centrifuge at 5000 rpm for 10 min. Transfer the supernatant to another clean centrifuge tube, centrifuge at 12000 rpm for 1 h until the supernatant becomes clear, and collect the precipitate, which is the macrophage membrane. Add 1 ml of pH 7.0 PBS buffer to the macrophage membrane, mix well, and place at -80 ℃ overnight. Freeze overnight and freeze-dry the next day.

[0036] Specifically, the preparation of PLL-CA was as follows: 5 mg of poly-l-lysine (PLL) was weighed and placed in a 1 ml EP tube, dissolved in 500 μl of pH 7.0 PBS buffer. Then, 8.74 mg of citric acid anhydrous (CA) was weighed and placed in another 2 ml EP tube, dissolved in 1 ml of pH 7.0 PBS buffer. After complete dissolution, the two samples were mixed, and pH 7.0 PBS was added to a final volume of 5 ml. The pH was then adjusted to neutral by adding 5 M NaOH solution and stirred overnight in the dark. After overnight incubation, PLL-CA was transferred to a dialysis bag with a molecular weight cutoff of 500 and dialyzed for 12 h, changing the ultrapure water every 4 h. After dialysis, the PLL-CA in the dialysis bag was removed and placed at -80 °C overnight, then freeze-dried the following day.

[0037] c. Dissolve 33 μg of pCAR in enzyme-free ultrapure water and quickly add it to the nano-formulation suspension. Mix thoroughly and let stand at room temperature for 2 h to obtain nanoliposomes MMI-GCL encoding chimeric antigen receptors.

[0038] d. RAW264.7 macrophages were induced to become M2 macrophages by IL-4 stimulation. M2 macrophages were then distributed at a density of 8 × 10-10 cells per well. 4 Cells were seeded into 12-well plates and cultured at 37 °C in a 5% CO2 incubator for 24 h. Once the cells reached 80% confluence, the culture medium was discarded. The nanoliposomes MMI-GCL (quantified as pCAR: 2 μg, mass ratio, DOTAP: pCAR = 30:1) were diluted with serum-free medium and added to the culture plates. The plates were incubated at 37 °C in a 5% CO2 incubator for another 4 h. After removing the medium containing the nanoparticles, 1 mL of medium containing 10% serum was added and the cells were cultured for another 24 hours. Chimeric antigen receptor macrophage CARs were then collected. FAP -M.

[0039] (2) Procedure for preparing MMI-CL using the injection method: Accurately weigh 1 mg of DOTAP, 0.5 mg of DOPE, and 0.15 mg of IMQ, dissolve them thoroughly in dimethyl sulfoxide, mix, and inject into 1 ml of PBS buffer. Leave open overnight to evaporate, then homogenize thoroughly using an ultrasonic homogenizer, and centrifuge to concentrate to 0.5 ml. Add 0.15 mg of Pll-Ca, 0.3 mg of Man, and 1.5 mg of RM sequentially. After passing through a 100 nm extruder, homogenize thoroughly again using an ultrasonic homogenizer to obtain the nano-formulation MMI-CL.

[0040] (3) Implementation steps for preparing MM-GCL using the injection method: Accurately weigh 1 mg of DOTAP and 0.5 mg of DOPE, dissolve them thoroughly in dimethyl sulfoxide, mix, and inject into 1 ml of PBS buffer. Leave open overnight to evaporate, then homogenize thoroughly using an ultrasonic homogenizer, and centrifuge to concentrate to 0.5 ml. Add 0.15 mg of Pll-Ca, 0.3 mg of Man, and 1.5 mg of RM sequentially. After passing through a 100 nm extruder, homogenize thoroughly again using an ultrasonic homogenizer to obtain the nano-formulation MM-CL. Dissolve 33 μg of pCAR in enzyme-free ultrapure water and quickly add it to the nano-formulation suspension. Mix thoroughly and let stand at room temperature for 2 h to obtain nanoliposome MM-GCL.

[0041] IMQ is a Toll-like receptor 7 agonist drug. In some embodiments, it may also be one of retinotimod, gadequimod, loxoribine, 852A, MGN1703 (DSP-30), motolimod, 3M-052, CL075, or vesatomod.

[0042] Example 3 Macrophage drug CAR FAP Preparation process of -M MMI-GCLs were prepared according to the method described in Example 2 (1). RAW264.7 macrophages were stimulated with IL-4 to obtain M2 macrophages. The M2 macrophages were then distributed at a density of 8 × 10⁶ cells per well. 4 After seeding RAW264.7 cells into 12-well plates and culturing them at 37°C with 5% CO2 for 24 h, the culture medium was discarded when the cells reached 80% confluence. The nanoliposome MMI-GCL (quantified as pCAR: 2 μg, DOTAP: pCAR = 30:1) was diluted with serum-free medium and added to the culture plate. The cells were incubated at 37°C with 5% CO2 for another 4 h. Then, 1 mL of medium containing 10% serum was added to the culture medium containing the nanoparticles and the cells were cultured for another 24 hours to obtain CAR. FAP -M.

[0043] Example 4 Particle size and potential of nanoliposomes MMI-GCL After obtaining MMI-GCL according to the preparation method described in Example 2 (1), the particle size and Zeta potential were measured using a Malvern nanoparticle size analyzer. Figure 2 The results showed that the size of the nanoliposome MMI-GCL was 321.9 ± 45.4 nm and the potential was 4.49 ± 0.06 mV.

[0044] Example 5 Loading efficiency of pCAR by nanoliposome MMI-CL After obtaining MMI-CL according to the preparation method described in Example 2 (2), MMI-GCLs loaded with different masses of pCAR were obtained with DOTAP to pCAR ratios of 5:1, 10:1, 20:1, 30:1, 40:1, 50:1, and 100:1, respectively. Agarose gel electrophoresis was used to investigate the loading efficiency of MMI-CL for different masses of pCAR, i.e., the ultimate loading capacity of MMI-GCL. Figure 3 The results showed that the loading efficiency of pCAR by the nanoliposome MMI-GCL was still 100% at a ratio of 5:1.

[0045] Example 6 Evaluation of pCAR delivery efficiency by nanoliposomes MMI-CL MMI-CL was prepared according to the preparation method described in Example 2 (2), and RAW264.7 cells were prepared at a density of 8 × 10⁶ cells per well. 4 After seeding into 12-well plates and culturing in a 37 ℃, 5% CO2 incubator for 24 h, RAW264.7 cells were cultured to 80% confluence. The culture medium was then discarded, and nanoliposomes MMI-GCL loaded with different mass ratios of pCAR (2 μg pCAR) were diluted with serum-free medium and added to each well. The cells were incubated for another 4 h at 37 ℃, 5% CO2. Afterward, 1 mL of medium containing 10% serum was added to the nanoliposome-containing medium, and the cells were cultured further. The delivery efficiency of pCAR in RAW264.7 cells at different time points (24 h, 48 h) was evaluated using an inverted fluorescence microscope. The results are as follows: Figure 4 As shown.

[0046] In this embodiment, when the mass ratio of DOTAP to pCAR in MMI-GCL is 30:1, it has a better transfection effect than commercially available transfection reagents. If the ratio is further increased, it will cause some damage to RAW264.7 cells.

[0047] Example 7 Evaluation of the toxicity of nanoliposomes MMI-GCL to macrophages With a density of 1 x 10 4RAW264.7 cells per well were seeded into 96-well plates and cultured overnight at 37 °C and 5% CO2. Different concentrations of MMI-GCL were added to the plates and incubated with the RAW264.7 cells for 24 h. Then, 20 μL of tetramethylammonium bromide was added and incubated with the cells for 4 h. The culture medium was then carefully removed, and 200 μL of dimethyl sulfoxide was added to each well. The absorbance was then determined at 490 nm, and cell viability was calculated using an equation. Results are shown below. Figure 5 As shown, 640 nM was selected as the effective dose for subsequent experiments.

[0048] Example 8 Uptake efficiency of nanoliposome MMI-GCL in macrophages With a density of 5 x 10 4 RAW264.7 cells per cell / well were seeded in glass culture dishes and cultured overnight at 37 °C and 5% CO2. MMI-GCLs were prepared according to the method described in Example 2 (1) and pCARs were labeled with ethidium bromide (EB). EB-labeled MMI-GCLs were incubated with RAW264.7 cells for 1 h and 4 h, then the culture medium was removed and the culture dishes were washed three times with PBS. Cells were fixed with 4% paraformaldehyde for 15 min, and the culture dishes were washed three more times. Cell nuclei were stained with Hoechst at 37 °C for 15 min, and the culture dishes were washed three times. Finally, 1 mL of PBS buffer was added to the culture dishes to maintain cell morphology, and the uptake efficiency of EB-labeled MMI-GCLs was observed by laser scanning confocal microscopy. The results are as follows: Figure 6 As shown, macrophages can take up MMI-GCL after 1 hour of incubation, and the uptake becomes more pronounced over time.

[0049] Example 9 Lysosomal escape ability of nanoliposomes MMI-GCL in macrophages (1) Lysosomal escape ability - gene With a density of 5 x 10 4RAW264.7 cells per cell / well were seeded in glass culture dishes and cultured overnight at 37 °C and 5% CO2. MMI-GCLs were prepared according to the method described in Example 2 (1) and pCARs were labeled with EB. The EB-labeled MMI-GCLs were incubated with RAW264.7 cells for 1 h and 6 h, then the culture medium was removed and the culture dishes were washed three times with PBS. The cells were fixed with 4% paraformaldehyde for 15 min and the culture dishes were washed three more times. The cell nuclei were stained with Hoechst at 37 °C for 15 min and the culture dishes were washed three times. Finally, 1 mL of PBS buffer was added to the culture dishes to maintain cell morphology, and the lysosomal escape ability of genes was observed by laser scanning confocal microscopy. The results are as follows. Figure 7 As shown in G@LNPs, the labeled gene can escape from the lysosome within 6 hours.

[0050] (2) Lysosomal escape ability - drugs In this experiment, DiI replaced IMQ. A density of 5 x 10⁻⁶ was used. 4 RAW264.7 cells per cell / well were seeded in glass culture dishes and cultured overnight at 37 °C and 5% CO2. MMI-GCLs were prepared according to the method described in Example 2 (1) and incubated with RAW264.7 cells for 1 h and 6 h. The culture medium was then removed and the culture dishes were washed three times with PBS. The cells were fixed with 4% paraformaldehyde for 15 min and the culture dishes were washed three more times. The cell nuclei were stained with Hoechst at 37 °C for 15 min and the culture dishes were washed three times. Finally, 1 mL of PBS buffer was added to the culture dishes to maintain cell morphology, and the lysosomal escape ability of the drug was observed by laser scanning confocal microscopy. The results are as follows. Figure 7 As shown in Y@LNPs, the labeled drug can escape from lysosomes within 6 hours.

[0051] Example 10 CAR constructed after administration of nanoliposomes MMI-GCL FAP Morphological characterization of -M CAR was obtained according to the preparation method described in Example 3. FAP -M; RAW264.7 macrophages were stimulated with IL-4 to obtain M2 macrophages. Morphological characterization was performed using scanning electron microscopy, and the results are as follows: Figure 8 As shown, the left side uses M2 macrophages as a control, and the right side uses CARs. FAP -M.

[0052] Example 11 Release factors and content of macrophages after administration of nanoliposome MMI-GCL Biochemical indicators, including tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), transforming growth factor-β (TGF-β), and arginase-1 (Arg-1), were detected using enzyme-linked immunosorbent assay (ELISA). The expression of related factors in macrophages treated with MMI-GCL (LNP(+)) and macrophages not treated with MMI-GCL (LNP(-)) were also measured. The procedure, including sample pretreatment, standard curve plotting, and sample detection, was performed according to the ELISA kit instructions. Results are as follows: Figure 9 As shown, the levels of prophagocytic cytokines TNF-α and iNOS showed an increasing trend, while the levels of anti-inflammatory mediators TGF-β and Arg-1 decreased after LNP(+) treatment, demonstrating that the constructed liposomes can effectively promote the release of prophagocytic cytokines and realize the reprogramming of macrophages.

[0053] Example 12 CARs constructed in vitro or in situ using MMI-GCL FAP Evaluation of the effect of M on reducing fibrosis MMI-GCL, MMI-CL, and MM-GCL were obtained according to the preparation methods described in (1), (2), and (3) of Example 2, respectively. CAR was obtained according to the preparation method described in Example 3. FAP -M. Mice with pulmonary fibrosis were treated by tail vein injection, with the treatment strategy involving seven injections every three days. The experiment lasted 25 days from the start of treatment to the end. After the experiment, the mice were euthanized, and their lung tissue was collected and fixed in 4% paraformaldehyde.

[0054] (1) Treatment of pulmonary fibrosis in mice - HE staining and Masson staining Fixed lung tissue was embedded, and 4 μm sections were cut using a paraffin microtome and stained with hematoxylin and eosin (HE) and Masson's stain to evaluate changes in lung tissue structure and collagen deposition. Figure 10 .

[0055] (2) Treatment of pulmonary fibrosis mice - immunofluorescence staining Fixed lung tissue was embedded, and 4 μm sections were cut using a paraffin microtome for immunofluorescence staining. Changes in collagen I content in the lung tissue were observed to assess the therapeutic effect on fibrosis. Figure 11 .

[0056] In this embodiment, CAR is constructed in vitro or in situ using MMI-GCL. FAPThe therapeutic effect of nanoliposomes on pulmonary fibrosis mice was systematically evaluated by assessing the pathological characteristics of lung tissue through HE staining and Masson's trichrome staining, combined with the expression level analysis of pulmonary fibrosis marker proteins. Figure 10 As shown, compared with the untreated pulmonary fibrosis model group (BLM), MMI-GCL and CAR FAP MMI-GCL and CAR-T therapy significantly reduced lung parenchyma in mice, and their lung tissue structure was closer to that of the normal control group. Masson staining further confirmed the effects of MMI-GCL and CAR-T therapy. FAP Collagen deposition in the lung tissue of mice treated with the -M group was significantly reduced, to a degree comparable to that in the normal control group. As shown in Figure 11, the level of collagen I in the immunoassay was significantly decreased. These experiments demonstrate that engineered cells constructed in situ using nanoliposomes are as effective as those directly infused with CAR in treating pulmonary fibrosis. FAP Similar to -M, this demonstrates the application capabilities of liposome therapy.

[0057] This invention designs nanoliposomes based on the pathological conditions of disease occurrence and delivers chimeric antigen receptor genes through nanoliposomes, thereby enhancing the phagocytic and targeting capabilities of macrophages. Macrophages are easier to obtain and have greater plasticity than other immune cells; therefore, chimeric antigen receptor macrophages have the potential for wide-ranging applications.

[0058] It should be understood that the various forms of processes shown above can be used, with steps reordered, added, or deleted. For example, the steps described in this invention can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this invention can be achieved, and this is not limited herein.

[0059] The specific embodiments described above do not constitute a limitation on the scope of protection of this invention. Those skilled in the art should understand that various modifications, combinations, sub-combinations, and substitutions can be made according to design requirements and other factors. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this invention should be included within the scope of protection of this invention.

Claims

1. A nanoliposome encoding a chimeric antigen receptor, characterized in that, include: The composition includes liposomes, PLL-CA, macrophage membranes, mannose, and a pCAR recombinant plasmid, wherein the PLL-CA is generated by reacting polylysine with citrate anhydride; and the pCAR recombinant plasmid contains a sequence that edits a specific chimeric antigen receptor targeting FAP, as shown in SEQ ID NO.

1.

2. The nanoliposome encoding a chimeric antigen receptor according to claim 1, characterized in that, It also includes Toll-like receptor 7 agonist drugs.

3. The method for preparing the nanoliposomes according to claim 1 or claim 2, characterized in that, The specific steps are as follows: a. Prepare liposomes by fully dissolving cationic lipid CL and auxiliary lipid AL, or by adding a Toll-like receptor 7 agonist drug, in an organic solvent and injecting it. b. After adding PLL-CA, mannose, and macrophage cell membrane, the cell membrane is coated by co-extrusion and then homogenized by sonication to form a suspension. c. Dissolve pCAR in enzyme-free ultrapure water, add it to the suspension and mix thoroughly, then let it stand at room temperature to obtain nanoliposomes encoding chimeric antigen receptor macrophages.

4. The preparation method according to claim 3, characterized in that, The mass ratio of cationic lipid CL : accessory lipid AL : macrophage membrane : mannose : PLL-CA : hydrophilic Toll-like receptor 7 agonist is 20 : 10 : 30 : 6 : 3 :

3.

5. The preparation method according to claim 3, characterized in that, The cationic lipid CL is selected from at least one of DOTAP, DOTMA, DOSPA, DC-Chol, DODAB, DMRIE-C, EDMPC, and CLinDMA.

6. The preparation method according to claim 3, characterized in that, The auxiliary lipid AL is selected from at least one of DOPE, DOPC, CHOL, DOPG, DSPE, DMPE, DOPS, POPC, DSPC, DMPC, and POPE.

7. The preparation method according to claim 3, characterized in that, Toll-like receptor 7 agonist drugs are selected from at least one of imiquimod, retinomod, gadequimod, loxolibin, 852A, motolimod, 3M-052, CL075, and vesatomod.

8. A chimeric antigen receptor macrophage, characterized in that, The chimeric antigen receptor macrophages are obtained from the nanolipid reprogrammed macrophages described in claim 1 or claim 2.

9. The chimeric antigen receptor macrophage according to claim 8, characterized in that, The specific preparation method of the chimeric antigen receptor macrophage is as follows: nanoliposomes are added to M2 macrophages in serum-free medium, incubated for 4-8 hours, and then cultured for another 24 hours in medium containing 10% serum to obtain chimeric antigen receptor macrophages.

10. The use of the nanoliposomes of claim 1 or claim 2, or the macrophages of claim 1, in the preparation of drugs for pulmonary fibrosis.

Images