Nucleic acid tetrahedron derived from salmon PDRN sequence as well as preparation method and application of nucleic acid tetrahedron

By screening and self-assembling salmon PDRN sequences, nucleic acid tetrahedra with transdermal delivery and melanin production inhibition capabilities were prepared, solving the problem of limited application of PDRN and TDN in the cosmetic field in existing technologies, and achieving significant melanin production inhibition and transdermal delivery effects.

CN120843503AActive Publication Date: 2025-10-28SHANGHAI HONGSONG AESTHETICS BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511375941.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2025-10-28
Estimated Expiration
2045-09-25

AI Technical Summary

Technical Problem

The lack of PDRNs with good transdermal absorption and TDNs with functional sequences in existing technologies limits their application in the cosmetic field, especially in their ability to fully inhibit melanin production.

Method used

By analyzing the PDRN sequence of salmon, nucleic acid tetrahedrons (TDNs) were designed and prepared. TDN sequences with significant ability to inhibit melanin production were screened out, and nucleic acid nanoparticles with transdermal delivery capability were formed through self-assembly technology. Combined with conventional carriers and cross-linking agents, a stable nucleic acid nanostructure was formed.

Benefits of technology

The study demonstrated that PDRN-TDN significantly inhibits melanin production in skin whitening products, and its transdermal delivery capability was verified through cell and mouse in vivo studies, providing a promising prospect for the development of biological whitening products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843503A_ABST
    Figure CN120843503A_ABST
Patent Text Reader

Abstract

The invention discloses a salmon PDRN sequence sourced nucleic acid tetrahedron and a preparation method and application thereof, the nucleic acid tetrahedron is formed by self-assembly of four single-stranded DNAs, and the sequences of the four single-stranded DNAs are respectively shown as SEQ ID NO: 53-56. The nucleic acid tetrahedron provided by the invention has remarkable effects of inhibiting melanogenesis, penetrating cell membranes and transdermal penetration, has good application potential, and provides a good prospect for developing a biological whitening product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of beauty, specifically relating to nucleic acid tetrahedrons derived from salmon PDRN sequences, their preparation methods, and applications. Background Technology

[0002] Since SEEMAN first designed the first four-armed nucleic acid linker in 1982, the development of DNA nanostructures has gradually improved, and related nanomaterials have made great strides and been widely used in the biomedical field. In recent years, third-generation nanostructures have achieved a breakthrough from two-dimensional (2D) to three-dimensional (3D) structures, and 3D DN nanotechnology has therefore been widely used.

[0003] As a representative of 3D DNA nanostructures, the tetrahedral DNA nanostructure (TDN) is composed of four equal-length single-stranded DNA strands mixed in equal amounts. Each face of the tetrahedron consists of three short sequences of single-stranded DNA (ssDNA) paired with the sequence of the same ssDNA, forming a three-dimensional DNA structure with controllable size and rigidity, such as... Figure 1 As shown.

[0004] TDN has made some research progress in cutting-edge fields such as biosensors, tumor treatment, antigen detection, and regenerative medicine due to its good controllability of size and shape, simple preparation, high mechanical strength, good biocompatibility and membrane permeability [1]. It has good application prospects.

[0005] Polydeoxyribonucleotides (PDRNs) are a class of naturally derived polynucleotide mixtures with molecular weights ranging from 50 to 1500 kDa. Currently, the sources for extraction and purification include red algae, ginseng, and sperm cells from rainbow trout or salmon [2,3]. Due to economic benefits and the complexity of the extraction process, PDRN extracted from fish reproductive cells has become the main source [4]. Fish sperm contains fewer impurities, and after purification and sterilization under high-temperature conditions, the purity of the active substances in the obtained PDRN is greater than 95%, without the presence of pharmacologically active proteins and peptides, resulting in high safety and no immune side effects.

[0006] PDRN has shown definite effects in anti-inflammation, wound healing, tissue repair, and anti-ischemia [3]. Because PDRN can promote fibroblast proliferation and increase the formation of matrix components, including collagen, elastin and new blood vessels, and enable the damaged area to achieve biological regeneration, its application research in the fields of dermatology and cosmetic dermatology has also made great progress. However, due to its large molecular weight, PDRN does not have transdermal properties and is currently only used for microneedling or mesotherapy. Subsequently, the sodium hyaluronate and polydeoxyribonucleic acid complex solution pre-filled in the syringe was defined as a drug-device combination mainly based on medical devices, used for injection into the dermis of the face, thereby changing the skin condition, and further promoting the development of PDRN in the field of medical aesthetics.

[0007] Studies have found that PDRN has the ability to inhibit melanin production [4,5]. PDRN inhibits MITF and its target genes TRP1 and TRP2 in the process of melanin production by activating ERK and AKT activities in melanocytes, thereby reducing melanin production. It can also directly inhibit the activity of tyrosinase, the rate-limiting enzyme in melanin production, and reduce melanin content.

[0008] Research on TDN mainly focuses on its delivery capabilities[1,6]. In the field of beauty, patent CN116327627B discloses the application of nucleic acid tetrahedron carrying glycyrrhizin in skin whitening; patent CN114569628A discloses the application of nucleic acid tetrahedron in scleroderma, indicating that TDN can effectively inhibit skin fibrosis and improve the symptoms of scleroderma; patent CN107961381B discloses the application of nucleic acid tetrahedron in promoting cell anti-aging, but all of the above patents use the same nucleic acid tetrahedron sequence.

[0009] In summary, although PDRN can inhibit melanin production, its large molecular weight means it does not have direct transdermal penetration and is mostly used via microneedling or mesotherapy. TDN research focuses primarily on its transdermal delivery capabilities, with less research on the efficacy of its sequence itself. Although some studies exist, they are limited to single sequences and do not compare the efficacy of different sequences. Currently, there are no literature or patents that screen the ability of TDN sequences to inhibit melanin production. Summary of the Invention

[0010] The technical problem to be solved by this invention is the lack of PDRN with good transdermal permeability and TDN with functional sequences in the prior art. This invention provides a nucleic acid tetrahedron derived from salmon PDRN sequence, its preparation method and application.

[0011] This invention designs and prepares nucleic acid tetrahedra (TDNs) from the polydeoxyribonucleic acid (PDRN) sequence derived from salmon through sequence analysis, enabling them to be delivered transdermally. By comparing and screening different sequences, nucleic acid tetrahedra with significant melanin-inhibiting ability are obtained. Thus, the melanin-inhibiting ability of the PDRN sequence and the transdermal delivery ability of TDN are combined, providing a promising prospect for the development and application of PDRN-TDN in skin whitening products.

[0012] The present invention solves the above-mentioned technical problems through the following technical solutions.

[0013] A first aspect of the present invention provides a nucleic acid tetrahedron, which is self-assembled from four types of single-stranded DNA, the sequences of which are shown in SEQ ID NO: 53-56 respectively.

[0014] A second aspect of the present invention provides a nucleic acid nanoparticle comprising a nucleic acid tetrahedron as described in the first aspect.

[0015] Optionally, the nucleic acid nanoparticles may further comprise a carrier and / or a cross-linking agent.

[0016] In this invention, the carrier is conventional in the art, such as pharmaceutically acceptable carriers, including but not limited to buffers, antioxidants, preservatives, proteins, peptides, polymers, amino acids, and sugars. In some embodiments, the polymer can form a scaffold or particulate structure under specific conditions.

[0017] In this invention, the crosslinking agent can be conventional in the art, used to crosslink the nucleic acid nanoparticles or nucleic acid tetrahedra of this invention internally, crosslink intermolecularly, or crosslink with the scaffold or particle structure, or to enable the carrier to form a stable spatial structure.

[0018] A third aspect of the present invention provides a pharmaceutical composition comprising nucleic acid tetrahedra as described in the first aspect, and / or nucleic acid nanoparticles as described in the second aspect, as well as pharmaceutically acceptable carriers and / or excipients.

[0019] A fourth aspect of the present invention provides a method for preparing nucleic acid tetrahedra, the method comprising mixing and reacting four types of single-stranded DNA in a buffer system; terminating the reaction after the single-stranded DNA forms double-stranded DNA; the sequences of the four types of single-stranded DNA are shown in SEQ ID NO: 53-56, respectively.

[0020] In some implementations, the four single-stranded DNAs are mixed at equimolar concentrations.

[0021] In some implementations, the reaction is carried out at 95°C for at least 10 minutes.

[0022] In some implementations, the termination reaction is carried out at 4°C for 20 minutes.

[0023] In some embodiments, the buffer system comprises 10 mM Tris-HCl, 1 mM EDTA, 50 mM MgCl2, and pH 8.0.

[0024] The fifth aspect of the invention provides the use of nucleotide sequences as shown in SEQ ID NO: 53-56 in the preparation of nucleic acid tetrahedra.

[0025] The sixth aspect of the present invention provides the use of nucleic acid tetrahedra as described in the first aspect, nucleic acid nanoparticles as described in the second aspect, or pharmaceutical compositions as described in the third aspect in the preparation of products that inhibit melanin production.

[0026] In some implementations, the product is a cosmetic or a pharmaceutical.

[0027] A seventh aspect of the present invention provides a method for inhibiting melanin production, comprising administering to a subject in need an effective amount of a nucleic acid tetrahedron as described in the first aspect, a nucleic acid nanoparticle as described in the second aspect, or a pharmaceutical composition as described in the third aspect.

[0028] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0029] The reagents and raw materials used in this invention are all commercially available.

[0030] The positive and progressive effects of this invention are as follows:

[0031] This invention uses salmon polydeoxyribonucleic acid (PDRN) sequences as the source. Through sequence analysis, a nucleic acid tetrahedral (TND) sequence was designed and self-assembled into PDRN-TDN through denaturation and renaturation. The expression levels of tyrosinase, TRP1, and TRP2 melanin-producing rate-limiting enzymes were detected by RT-qPCR. TDN sequences with significant inhibitory effects on melanin production were screened out. Cell and mouse in vivo studies were conducted on the cell membrane penetration and transdermal ability of these TDNs. The results showed that PDRN-TDN has significant inhibitory effects on melanin production and penetrating cell membranes and transdermally, providing a promising prospect for the development of a biological skin whitening product. Attached Figure Description

[0032] Figure 1 This is a schematic diagram of the TDN self-assembly structure.

[0033] Figure 2 To test the self-assembly effect of PDRN-TDN-1.

[0034] Figure 3 The results are for PDRN-TDN agarose gel electrophoresis.

[0035] Figure 4 For PDRN-TDN particle size detection.

[0036] Figure 5 For the detection of genes related to melanin expression.

[0037] Figure 6 The results validate the genes related to melanin expression.

[0038] Figure 7 The results of agarose gel electrophoresis of Cy5 fluorescently modified TDN self-assembly.

[0039] Figure 8 shows the results of PDRN-TDN cell entry fluorescence detection.

[0040] Figure 9 shows the transdermal efficacy of PDRN-TDN. Detailed Implementation

[0041] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0042] Example 1: Design and self-assembly detection of salmon PDRN sequence-derived nucleic acid tetrahedrons (PDRN-TDN)

[0043] 1. Main reagents

[0044] Purified water, 10×Reaction buffer, and synthesis of PDRN-TDN ssDNA single strands.

[0045] 2. Main instruments and equipment

[0046] Benchtop refrigerated centrifuge, metal bath, electrophoresis apparatus, gel cutter, nanoparticle size analyzer.

[0047] 3. Experimental Procedure

[0048] 3.1 PDRN-TDN ssDNA Sequence Design

[0049] Based on the salmon PDRN sequence, 25 sets of tetrahedral ssDNA sequences were designed, and the specific sequences are shown in Table 1:

[0050] Table 1. Salmon PDRN sequences

[0051]

[0052]

[0053]

[0054]

[0055]

[0056] 3.2 ssDNA lysis and quantification

[0057] All ssDNA sequences were synthesized by Jiangsu Newtech Biopharmaceutical Co., Ltd. The synthesized ssDNA was in dry powder form. Each tube was centrifuged at 12,000 rpm for 5 min at 3 OD. 152 μL of purified water was added to each tube, and the tubes were incubated at room temperature for 1 min. After thorough vortexing and centrifugation, 2 μL of each ssDNA was taken and quantified using a UV spectrophotometer. The concentration of each ssDNA was calculated based on the A260 value, and all ssDNA concentrations were normalized to 30 μM.

[0058] 3.3 Detection of self-assembly of nucleic acid tetrahedrons (PDRN-TDN)

[0059] To perform tetrahedral self-assembly detection of PDRN-TDN-1, take seven 0.2 mL centrifuge tubes and add 1 μM of S1, S2, S3, S4, S1+S2, S1+S2+S3, and S1+S2+S3+S4, respectively, along with 1×Reaction buffer (composed of 10 mM Tris-HCl, 1 mM EDTA, 50 mM MgCl2, pH 8.0). Add purified water to bring the volume to 30 μL. After thoroughly vortexing and centrifuging all prepared systems, incubate at 95 °C for 10 min on a standard PCR instrument and immediately place on ice for 1 h. This is the prepared PDRN-TDN, which can be stored at 4 °C for later use.

[0060] Take 8 μL of the self-assembled PDRN-TDN, add 2 μL of 5× loading buffer, mix well, centrifuge, and then perform 2% agarose gel electrophoresis at 120V for 30 min. Electrophoresis results are shown below. Figure 2 .

[0061] 3.4 All PDRN-TDNs self-assemble

[0062] Take 25 0.2 mL centrifuge tubes and prepare 25 PDRN-TDN self-assembly systems according to the reagent systems shown in Table 2 below:

[0063] Table 2: TDN Self-Assembly System

[0064]

[0065] The 10×Reaction buffer consists of 100mM Tris-HCl, 10mM EDTA, 500mM MgCl2, and pH 8.0.

[0066] After thoroughly vortexing and centrifuging all prepared systems, incubate them in a metal bath at 95°C for 10 minutes, and then immediately place them on ice for 1 hour. This yields the prepared PDRN-TDN, which can be stored at 4°C for later use.

[0067] 3.5 Detection of PDRN-TDN self-assembly effect

[0068] 3.5.1 Agarose gel electrophoresis

[0069] Take 8 μL of the self-assembled PDRN-TDN, add 2 μL of 5× loading buffer, mix well, centrifuge, and then perform 2% agarose gel electrophoresis at 120V for 30 min. The electrophoresis results are shown in the figure. Figure 3 .

[0070] 3.5.2 Particle size detection

[0071] Take 20 μL of PDRN-TDN1 and PDRN-TDN15 respectively, add them to 180 μL of 1×Reaction buffer, mix well, centrifuge, and then add them to the detection dish. The tetrahedral particle size of the nucleic acid was measured using a Malvern PANalytical Zetasizer Ultra nanoparticle size analyzer. The particle size was mainly distributed in the 10-20 nm range, consistent with the tetrahedral particle size of nucleic acids. The results are shown in [Figure number missing]. Figure 4 .

[0072] 4. Experimental Conclusion: The self-designed salmon PDRN sequence-derived nucleic acid tetrahedron (PDRN-TDN) can self-assemble well, and particle size analysis shows that the particle size is around 20 nm. Figure 4 The particle size of PDRN-TDN 1 was measured to be 19.41 nm, and the particle size of PDRN-TDN 15 was measured to be 19.71 nm.

[0073] Example 2: Screening of PDRN-TDN sequences with anti-melanin production capabilities

[0074] 1. Main reagents

[0075] RPMI-1640 basal medium, DMEM medium, fetal bovine serum, B16F10 cells, PBS, PDRN-TDN 1-7, 9-18, 20-25, total RNA extraction kit, One-Step RT-qPCR Probe Kit (UDG Plus)

[0076] 2. Main instruments and equipment

[0077] Mini centrifuge, benchtop refrigerated centrifuge, real-time PCR instrument

[0078] 3. Experimental Procedure

[0079] 3.1 Cell Culture

[0080] Cultured B16F10 cells were seeded into 48-well cell culture plates at 10^4 cells per well and incubated in 250 μL of 10% FBS RPMI-1640 complete medium at 37°C and 5% CO2 for 12 hours. The medium was then replaced with fresh 10% FBS DMEM complete medium, to which PDRN-TDN 1-7, 9-18, and 20-25 were added to a final concentration of 250 nM. Wells in 10% FBS DMEM complete medium without PDRN-TDN were set as positive controls, and wells in 10% FBS RPMI-1640 complete medium were set as negative controls. The cells were incubated at 37°C and 5% CO2 for 72 hours.

[0081] 3.2 Total RNA Extraction

[0082] After the cultured cells were discarded, they were washed once with 1×PBS, and 300 μL of lysis buffer was added to each cell. After the cells were fully lysed, they were transferred to 1.5 mL centrifuge tubes and total RNA was extracted according to the cell / tissue total RNA extraction kit (YEASEN, catalog number 19221ES60).

[0083] 3.3 Total RNA detection

[0084] 3.3.1 The extracted total RNA from cells was quantified and diluted to 4 ng / μL, and the mRNA expression levels of tyrosinase (TYR), DHICA oxidase (TRP-1), and dopachrome isomerase (TRP-2) genes were detected.

[0085] The primer and probe sequences for all genes are shown in Table 3 below:

[0086] Table 3: Primer and probe sequences

[0087] serial number SEQ ID NO: sequence 5' Modification 3' Modification mTYR-F 93 CATCCTTCTTCTCCTCCTGGC / / mTYR-R 94 GCTTTGTCATGGTTTCCAGGA / / mTYR-P 95 TTTATGCGATGGAACACCTGAGGGACC FAM BHQ1 mTRP1-F 96 GGCTAAGGAGGTATAACGCCG / / mTRP1-R 97 CCAGAATGGCACCATGTTGTAT / / mTRP1-P 98 TTTCTACCTTCCCGTTGGAAAACGCACC FAM BHQ1 mTRP2-F 99 TGTGGCTCCATTATTATTCTGTTCG / / mTRP2-R 100 GCAGGCCCTTGGTGAGAGA / / mTRR2-P 101 TCCAGGACGCCCCTATAAGGCCATT FAM BHQ1 mGAPDH-F 102 TTGTGGAAGGGCTCATGACC / / mGAPDH-R 103 TGGATGCAGGGATGATGTTCT / / mGAPDH-P 104 ATGCCATCACTGCCACCCAGAAGACT ROX BHQ2

[0088] 3.3.2 All primer and probe sequences were synthesized by Jiangsu Newtech Biopharmaceutical Co., Ltd. The synthesized primers and probes were in dry powder form. After centrifugation at 12,000 rpm for 5 min, the corresponding volume of enzyme-free water was added according to the COA. After being placed at room temperature for 1 min, the mixture was thoroughly vortexed and centrifuged to obtain a 100 μM stock solution.

[0089] Take 10 μL of primer and probe stock solution and add it to 90 μL of enzyme-free water. Vortex thoroughly to mix and centrifuge to obtain a 10 μM working solution. Store at -20℃ for later use.

[0090] 3.3.3 The reaction system is shown in Table 4 below:

[0091] Table 4 PCR reaction system

[0092] reagents Volume (μL) 5×Hifair Master Mix 4 Enzyme Mix 1 upstream primer 1 Downstream primer 1 probe 0.5 Template (4 ng / μL) 5 Enzyme-free water 7.5 Total volume 20

[0093] 3.3.4 After thoroughly vortexing and centrifuging the prepared reaction system, aliquot it into 96-well plates and perform the reaction on a real-time PCR instrument (Shanghai Hongshi, model SLAN-96S). The reaction program is shown in Table 5 below:

[0094] Table 5 PCR reaction procedure

[0095]

[0096] 3.3.5 After the reaction, the Ct values ​​of the TYR, TRP-1, and TRP-2 genes in all detection wells were calculated using 2^-(ΔΔCt). PDRN-TDN 15 showed the best inhibitory effect on the mRNA expression of melanin production-related genes. The bar chart results are shown below. Figure 5 .

[0097] 4. Verification of the effect of PDRN-TDN15 on inhibiting the expression of melanin-related genes

[0098] B16F10 cells were seeded into 24-well plates at a density of 1 × 10⁴ cells per well and cultured in 10% FBS DMEM complete medium for 12 hours. The medium was then replaced with 10% FBS DMEM complete medium containing 250 nM PDRN-TDN 15 and 2 μM peptide amido as experimental groups. Wells in 10% FBS DMEM complete medium without PDRN-TDN served as positive controls, and wells in 10% FBS RPMI-1640 complete medium served as negative controls. Each group had three replicates. Cells were cultured at 37°C with 5% CO₂ for 7 days, with the medium being changed on days 3 and 5. After culture, total RNA was extracted, and the mRNA expression levels of TYR, TRP-1, and TRP-2 genes were detected. The expression was calculated using 2⁻(ΔΔCt) based on the Ct value. Results are shown below. Figure 6 .

[0099] 5. Experimental conclusion: Based on the detection of mRNA expression levels of TYR, TRP-1, and TRP-2 genes, PDRN-TDN15 showed a significant inhibitory effect on melanin production.

[0100] Example 3: Detection of PDRN-TDN membrane penetration ability

[0101] 1. Main reagents

[0102] Cy5 fluorescently modified PDRN-TDN ssDNA single strand, Cy5 fluorescently modified PDRN-TDN.

[0103] 2. Main instruments and equipment

[0104] Benchtop refrigerated centrifuge, metal bath, cell culture incubator, fluorescence microscope.

[0105] 3. Experimental Procedure

[0106] 3.1 Cy5 fluorescence-modified PDRN-TDN self-assembly

[0107] The 5' end of S1 in the nucleic acid tetrahedron was labeled with Cy5 fluorescence. Following the self-assembly system in Example 1, the corresponding S2 / S3 / S4 were denatured and annealed to form nucleic acid tetrahedra. 2% agarose gel electrophoresis was performed, and the electrophoresis results are shown below. Figure 7 .

[0108] 3.2 Cell Culture

[0109] On day 1, RAW264.7 cells were seeded into 24-well cell culture plates at 5 × 10^4 cells per well and cultured in 10% FBS DMEM complete medium at 37°C with 5% CO2 for 12 hours to stabilize the cells. On day 2 and day 3, the medium was replaced with 10% FBS DMEM complete medium containing 250 nM PDRN-TDN tetrahedra, and cultured for another 24 hours and 6 hours, respectively. A negative control was prepared by adding 250 nM Cy5-modified S1, and a blank control was prepared by adding an equal volume of PBS. After culture, the medium was removed, the cells were washed once with 1×PBS, and then 250 μL of PBS was added. Cy5 fluorescence was observed under a fluorescence microscope. The experimental results are shown in Figure 8.

[0110] 4. Experimental conclusion: Cy5 fluorescently modified PDRN-TDN 15 nucleic acid tetrahedral membrane penetration effect is better than other PDRN-TDNs.

[0111] Example 4: Transdermal efficacy testing of PDRN-TDN

[0112] 1. Main reagents

[0113] Cy5 fluorescence-modified PDRN-TDN 15 nucleic acid tetrahedron.

[0114] 2. Main instruments and equipment

[0115] Cryostat, fluorescence microscope, adhesive slides

[0116] 3. Experimental Procedure

[0117] 3.1 Mouse treatment

[0118] Five 6-8 week old BALB / c mice (purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) were purchased and kept in a quiet environment for 2 days. After the mice adapted to the environment, the fur on the backs of the mice was removed. 10 μL of the corresponding nucleic acid tetrahedron and 10 mg of skin moisturizer (Aquaphor) were mixed evenly and applied to the skin of the mice in an area of ​​2 cm × 2 cm. Each mouse was housed individually in a dark cage for 24 hours. The experimental groups are shown in Table 6 below.

[0119] Table 6 Experimental Groups

[0120] Grouping mouse quantity NC 1 PDRN-TDN 15 S1 1 PDRN-TDN 15 3 total 5 mice

[0121] 3.2 Preparation of Cryopreserved Skin Tissue

[0122] Mice were euthanized by cervical dislocation, and the skin on their backs was removed and fixed in 4% paraformaldehyde for 30 minutes. The skin was then cut into 2mm widths and placed in a disposable embedding cassette containing OCT embedding medium. The skin was then rapidly frozen in liquid nitrogen to fix it in the embedding medium with the cross-section facing upwards, and then placed at -80°C overnight to allow the embedding medium to freeze completely.

[0123] 3.3 Frozen sections of skin tissue

[0124] Turn on the cryostat (Leica, model CM1950) one hour in advance to allow the instrument temperature to drop to around -25°C before cryosectioning. The sections are 20 μm thick and laid flat on the adhesive slides (Sita).

[0125] 3.4 Staining of Sections

[0126] The cut sections were fixed with 4% paraformaldehyde for 15 min, then washed three times with PBS for 5 min each time; the cell nuclei were stained with 1 μg / mL DAPI for 10 min, and then washed three times with PBS for 5 min each time.

[0127] 3.5 Sealing

[0128] Add 15 μL of fluorescent anti-aging agent to a glass slide, carefully cover the slide with a coverslip, and then observe the sample tissue under a fluorescence microscope after mounting.

[0129] The experimental results are shown in Figure 9.

[0130] 4. Experimental conclusions: Based on the analysis of Cy5 fluorescence distribution, Cy5-modified ssDNA single strands aggregated in the hair follicle and did not enter the skin, thus lacking transdermal function; while Cy5-modified PDRN-TDN-15 successfully entered the mouse skin and was evenly distributed in the skin. According to the scale bar analysis, both could reach the dermal layer.

[0131] References:

[0132] [1] Christian Wiraja, et al. Framework nucleic acids as programmable carrier for transdermal drug delivery[J]. NATURE COMMUNICATIONS, 2019,10(1147).

[0133] [2] Kim T, Heo S, Han JS, et al. Anti-inflammatory effect ofpolydeoxyribonucleotides (PDRN) extracted from red alga (porphyra sp.) (Ps-PDRN) in RAW 264.7 macrophages stimulated with Escherichia colilipopolysaccharides: a comparative study with commercial PDRN[J]. CellBiochem Funct, 2023, 41(7): 889-897.

[0134] [3] Kim TH, Heo SY, Oh GW, et al. Applications of marine organism-derived polydeoxyribonucleotide: its potential in biomedical engineering[J]. Mar Drugs, 2021, 19(6): 296

[0135] [4] Noh TK, Chung BY, Kim SY, et al. Novel Anti-MelanogenesisProperties of Polydeoxyribonucleotide, a Popular Wound Healing Booster[J]. IntJ Mol Sci, 2016, 17(9):1448.

[0136] [5] Kim YJ, Kim MJ, Kweon DK, et al. Polydeoxyri-bonucleotideActivates Mitochondrial Biogenesis but Reduces MMP-1 Activity and MelaninBiosynthesis in Cultured Skin Cells[J]. Appl Biochem Biotechnol, 2020,191(2):540-554.

[0137] [6] Yuhao L, Zhiqiang L, Weitong C, et al. Tetrahedral frameworknucleic acids as an advanced drug delivery system for oligonucleotide drugs[J]. APL Mater, 2020,8, 100701.

[0138] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. A nucleic acid tetrahedron, characterized in that, The nucleic acid tetrahedron is self-assembled from four types of single-stranded DNA, the sequences of which are shown in SEQ ID NO: 53-56, respectively.

2. A nucleic acid nanoparticle, characterized in that, The nucleic acid nanoparticles comprise the nucleic acid tetrahedron as described in claim 1.

3. The nucleic acid nanoparticles as described in claim 2, characterized in that, The nucleic acid nanoparticles also contain a carrier and / or a cross-linking agent.

4. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises nucleic acid tetrahedra as described in claim 1, and / or nucleic acid nanoparticles as described in claim 2 or 3, as well as pharmaceutically acceptable carriers and / or excipients.

5. A method for preparing nucleic acid tetrahedra, characterized in that, The method includes mixing and reacting four types of single-stranded DNA in a buffer system; terminating the reaction after the single-stranded DNA forms double-stranded DNA; the sequences of the four types of single-stranded DNA are shown in SEQ ID NO: 53-56, respectively.

6. The method as described in claim 5, characterized in that, The four types of single-stranded DNA were mixed at equimolar concentrations.

7. The method as described in claim 5 or 6, characterized in that, The reaction conditions are 95°C, maintained for at least 10 minutes.

8. The method as described in claim 7, characterized in that, The reaction was terminated at 4°C for 20 minutes.

9. The method as described in claim 5, characterized in that, The buffer system consists of 10 mM Tris-HCl, 1 mM EDTA, 50 mM MgCl2, and pH 8.

0.

10. Application of nucleotide sequences as shown in SEQ ID NO: 53-56 in the preparation of nucleic acid tetrahedra.

11. The use of the nucleic acid tetrahedron of claim 1, the nucleic acid nanoparticle of claim 2 or 3, or the pharmaceutical composition of claim 4 in the preparation of a product that inhibits melanin production.

12. The application as described in claim 11, characterized in that, The product in question is either a cosmetic or a pharmaceutical.

Citation Information

Patent Citations

  • Applications of DNA tetrahedrons in promoting cellular anti-aging

    CN107961381B

  • Application of DNA tetrahedral framework nano nucleic acid in cosmetology

    CN114569628A

  • Preparation method of polydeoxyribonucleotide

    CN119592554A

  • EGCG (epigallocatechin gallate)-containing tightening and whitening composition as well as preparation method and application thereof

    CN120478180A

  • PDRN-containing anti-aging repair composition and lipid nanoparticles and application thereof

    CN120585664A