Application of PSM alpha gene in regulating and controlling generation of staphylococcus aureus exosome vesicles

Abstract

The invention discloses application of a PSM alpha gene in regulating and controlling generation of staphylococcus aureus exosome vesicles, and belongs to the field of molecular biology. The research finds that the PSM alpha gene is related to the generation of the staphylococcus aureus exosome vesicles, and by knocking out the PSM alpha gene in the staphylococcus aureus, the number of the staphylococcus aureus exosome vesicles can be reduced, the particle size of the staphylococcus aureus exosome vesicles can be reduced, and the protein concentration of the staphylococcus aureus exosome vesicles can be reduced.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to the application of the PSMα gene in regulating the production of exovesicles in Staphylococcus aureus. Background Art

[0002] Staphylococcus aureus is an opportunistic pathogen that can cause diseases such as bacteremia, endocarditis, pneumonia, and mastitis (Tong et al., 2015). Staphylococcus aureus exovesicles are derived from the plasma membrane and are released by crossing a relatively thick peptidoglycan barrier (Rajagopal and Walker, 2017). Exovesicles can carry various components, such as proteins, lipids, and nucleic acids, and can participate in intercellular communication (McMillan and Kuehn, 2021). Initially thought to be a way for cells to process waste, recent studies suggest that exovesicles may be a novel method of intercellular communication, transporting components from exovesicles to recipient host cells through internalization or membrane fusion. Staphylococcus aureus exovesicles vary in size, ranging from 20 to 200 nm. Furthermore, exovesicles produced by different Staphylococcus aureus strains exhibit morphological differences (Bitto et al., 2021; Wang et al., 2023). Studies have shown that almost all Staphylococcus aureus strains produce exovesicles with relatively consistent composition and strong biological activity (Uppu et al., 2023; Wang et al., 2020). Furthermore, Staphylococcus aureus exovesicles can be generated during host infection and are closely related to the pathogenicity of Staphylococcus aureus (Wang et al., 2023).

[0003] The study of pathogenic microorganism exovesicles is a cutting-edge and emerging field in our understanding of the pathogenesis of pathogenic microorganisms. Staphylococcus aureus exovesicles package various components for delivery to host cells, and potentially even to host tissues far from the initial site of infection (Toyofuku et al., 2017). Staphylococcus aureus virulence factors, such as toxins, exposed to the host environment may be hydrolyzed by enzymes or inactivated by neutralizing antibodies before entering host cells, while toxins within exovesicles are immune to inactivation by the host environment (Dell'Annunziata et al., 2021; Yoshimura et al., 2023). Although exovesicles internalized into host cells may be transported to lysosomes for degradation, exovesicle-associated pore-forming toxins may avoid degradation by disrupting endosomes. Exovesicle components released into the host cell cytoplasm may target and interfere with normal host cell function and assist Staphylococcus aureus in establishing infection (Liu et al., 2022). Therefore, elucidating the cellular response mechanisms after Staphylococcus aureus exovesicles enter the cell will help deepen our understanding of the function of exovesicles during Staphylococcus aureus infection. However, there are currently very few reports on the generation and regulation of Staphylococcus aureus exovesicles. Summary of the Invention

[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide the application of the PSMα gene in regulating the production of Staphylococcus aureus exocrine vesicles.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the invention provides the use of the PSMα gene as a target in any of the following (1)-(3):

[0007] (1) Regulate the number of Staphylococcus aureus exocytic vesicles;

[0008] (2) Regulate the particle size of Staphylococcus aureus exocrine vesicles;

[0009] (3) Regulate the concentration of Staphylococcus aureus exovesicle proteins;

[0010] The nucleotide sequence of the PSMα gene is shown in SEQ ID NO.1.

[0011] In a second aspect, the invention provides the use of a substance that downregulates PSMα gene expression as described in (1) or (2):

[0012] (1) Prepare a drug to reduce the number of Staphylococcus aureus exocytic vesicles;

[0013] (2) Prepare drugs to reduce the concentration of Staphylococcus aureus exocyst protein.

[0014] In the above applications, the substances that downregulate PSMα gene expression include: knockout or silencing vectors targeting the PSMα gene; or small interfering RNA (siRNA), shRNA, long non-coding RNA (lncRNA), and circular RNA (circRNA), etc. These substances can act as interfering fragments to form complexes with proteins, bind to RNA, cut RNA and cause RNA degradation, thereby achieving the purpose of preventing gene expression.

[0015] Preferably, the knockout vector targeting the PSMα gene is the pCpfSA vector or the CRISPR / Cas9 knockout vector.

[0016] A third aspect of the present invention provides a method for reducing the number of Staphylococcus aureus exocytic vesicles, comprising the following steps:

[0017] The PSMα gene in Staphylococcus aureus was knocked out; the nucleotide sequence of the PSMα gene is shown in SEQ ID NO.1.

[0018] Preferably, the PSMα gene is knocked out using the pCpfSA plasmid.

[0019] The beneficial effects of this invention are:

[0020] This invention has found that the PSMα gene is associated with the production of Staphylococcus aureus exovesicles. Knocking out the PSMα gene in Staphylococcus aureus can reduce the number of Staphylococcus aureus exovesicles, decrease the particle size of Staphylococcus aureus exovesicles, and reduce the concentration of Staphylococcus aureus exovesicle proteins. Attached Figure Description

[0021] Figure 1 Staphylococcus aureus exovesicles: NTA analysis of their size and number; Figure 1 shows (A) the size distribution of purified exovesicles determined by NTA. (B) the size distribution of small (100 nm), medium (100-200 nm), and large (200 nm) exovesicles determined by NTA.

[0022] Figure 2 Transmission electron microscopy analysis of Staphylococcus aureus exovesicles; the image shows a transmission electron microscopy image (left) and a magnified image (right) of purified exovesicles. Scale bar: 100 nm.

[0023] Figure 3: Liquid chromatography-mass spectrometry analysis of the proteome of purified exocrine vesicles; In the figure, (A) pathway annotation analysis of the pathways involved by exocrine vesicle proteins; (B) enzyme classification analysis of exocrine vesicle proteins; (C) functional enrichment cluster analysis of exocrine vesicle proteins by GO annotation analysis.

[0024] Figure 4 PSMα gene regulates the production of Staphylococcus aureus exovesicles; in the figure, (A) NTA quantifies the number of Staphylococcus aureus exovesicle particles; (B) NTA analyzes the average particle size of Staphylococcus aureus exovesicles; (C) Quantitative analysis of exovesicle protein concentration; values ​​are shown as mean ± standard deviation, n = 3. "*" indicates significant difference, P < 0.05; "**" indicates very significant difference, P < 0.01; "***" indicates extremely significant difference, P < 0.001. Detailed Implementation

[0025] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0026] As mentioned earlier, the formation of Staphylococcus aureus exovesicles is a complex process. Because Staphylococcus aureus exovesicles contain various pore-forming toxins, purified exovesicles from Staphylococcus aureus isolates exhibit dose-dependent cytotoxicity. Related studies have shown that Hla from Staphylococcus aureus exovesicles is more cytotoxic than Hla from non-exovesicles. Therefore, reducing the production of Staphylococcus aureus exovesicles is beneficial for reducing the virulence of Staphylococcus aureus and is of great significance for the prevention and control of Staphylococcus aureus.

[0027] In view of this, the present invention has conducted an in-depth study on the generation process of Staphylococcus aureus exocrine vesicles. PSMα includes: PSM-alpha-1 (CDS:WP_014373781.1), PSM-alpha-2 (CDS:WP_014373780.1), PSM-alpha-3 (CDS:WP_014373779.1), and PSM-alpha-4 (CDS:WP_014532416.1). Wherein:

[0028] The region encoding the PSM-alpha-1 gene is region 477,759-477,824 of the whole genome sequence recorded in NCBI Reference Sequence: NZ_CP055225.1; the region encoding the PSM-alpha-2 gene is region 477,662-477,727 of the whole genome sequence; the region encoding the PSM-alpha-3 gene is region 477,542-477,610 of the whole genome sequence; and the region encoding the PSM-alpha-4 gene is region 477,416-477,478 of the whole genome sequence.

[0029] To investigate the effects of PSMα on Staphylococcus aureus exovesicle production, this invention uses region 477,416-477,824 of the whole genome sequence as the coding region of the PSMα gene, the nucleotide sequence of which is shown in SEQ ID NO.1. Knocking out the PSMα gene revealed a reduction in the size and number of Staphylococcus aureus exovesicles, as well as a decrease in the concentration of exovesicle proteins, thus leading to this invention.

[0030] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0031] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein:

[0032] The Staphylococcus aureus was identified as ATCC 25178. BHI brain heart extract broth and BHI brain heart extract agar were purchased from Beijing Solarbio Biotechnology Co., Ltd. The bacterial exovesicle isolation kit was purchased from Liaoning Runji Biotechnology Co., Ltd.

[0033] Example 1: Extraction and detection of Staphylococcus aureus exovesicles

[0034] 1. Test method:

[0035] 1.1 Culture of Staphylococcus aureus:

[0036] After thawing, *Staphylococcus aureus* stored in an ultra-low temperature freezer was streaked onto BHI brain heart extract agar medium and incubated at 37°C in a bacterial incubator. A single colony of *Staphylococcus aureus* cultured on the agar plate was randomly selected and placed in an Erlenmeyer flask containing BHI brain heart extract broth, and incubated with shaking at 37°C and 220 rpm. Microplate readers (OD500) were used to read the culture. 600nm Monitor bacterial growth, when OD600nm Stop culturing when the concentration reaches 1.2 and collect the bacterial solution for later use.

[0037] 1.2 Extraction of Staphylococcus aureus exocytic vesicles:

[0038] Staphylococcus aureus exovesicles were extracted using a bacterial exovesicle isolation kit, as detailed below:

[0039] 1) Sample pretreatment: Aliquot fresh Staphylococcus aureus culture into 50mL centrifuge tubes and place them on ice. Centrifuge at 5,000×g, 4℃ for 20min. Transfer the supernatant to a new centrifuge tube and centrifuge again at 5,000×g, 4℃ for 20min to thoroughly remove Staphylococcus aureus and its fragments. Collect the supernatant after centrifugation for later use (if the pH of the supernatant is <7.0, adjust the pH to 7.0-7.4 with 0.5M NaOH).

[0040] 2) Resin capture of Staphylococcus aureus exovesicles: Transfer 40 mL of the centrifuged Staphylococcus aureus culture supernatant to a new 50 mL centrifuge tube. Add 4 mL of binding buffer and tighten the cap, then invert to mix. Next, add 1.6 mL of binding resin (the resin should be thoroughly mixed before aspiration and should be aspirated as quickly as possible) to the centrifuge tube and tighten the cap. Invert to mix at room temperature for 15 min. Centrifuge the mixed tube at 1,500 × g at room temperature for 2 min. Slowly remove the centrifuge tube from the centrifuge and pipette 1 mL of the supernatant (do not discard). Carefully discard the remaining supernatant. Using the 1 mL of liquid in the pipette, gently transfer the resin from the centrifuge tube to a purification column. Let stand for 2 min, centrifuge at 2,000 × g at room temperature for 2 min, discard the filtrate, and return the purification column to the collection tube.

[0041] 3) Washing and elution of Staphylococcus aureus exovesicles: Add 2 ml of wash buffer to the purification column and let stand for 3 min. Centrifuge at 3,000 × g at room temperature for 2 min, then discard the filtrate and repeat the washing once. Transfer the purification column to a 15 ml low-adsorption protein centrifuge tube, add 1.6 ml of elution buffer and let stand at room temperature for 5 min. Centrifuge at 300 × g at room temperature for 2 min, and add the filtrate back to the purification column. Let stand for 2 min, and finally centrifuge at 3,000 × g at room temperature for 2 min. The liquid obtained in the centrifuge tube is the isolated Staphylococcus aureus exovesicles.

[0042] 1.3 NTA analysis of particle size and concentration of exocrine vesicles from *Vaccaria aurea*

[0043] The isolated Staphylococcus aureus exovesicles were diluted 200-fold with ultrapure water. Images were taken at 30 frames per second using a Zeta View PMX110 instrument at a 405 nm laser wavelength for 1 minute to determine the number and size of the exovesicles. Finally, the movement of the exovesicles was analyzed using NTA software (ZetaView).

[0044] 1.4 Transmission electron microscopy analysis of Staphylococcus aureus exocrine vesicles:

[0045] Extracted Staphylococcus aureus exovesicles were dissolved in 50-100 μL of 2% paraformaldehyde solution and mixed thoroughly. 5-10 μL of the mixed exovesicle solution was placed on a Formvar-carbon copper grid. 100 μL of PBS was placed on a sealing film, and the copper grid (Formvar membrane side down) was rinsed in the PBS droplet using tweezers. The copper grid was then placed on a droplet of 50 μL of 1% glutaraldehyde for 5 minutes and rinsed in 100 μL of double-distilled water for 2 minutes (a total of 8 rinses). The rinsed copper grid was then placed on a droplet of 50 μL of uranium oxalate (pH 7.0) for 5 minutes, followed by a 10-minute rinse on ice with a droplet of 50 μL of methylcellulose. The copper grid was placed on the stainless steel ring at the top of the sample stage, excess liquid was blotted off with filter paper, and the grid was air-dried for 5-10 minutes. Finally, the copper grid was placed in the sample container, and transmission electron microscopy (TEM) images of the exovesicles were taken at 80 kV.

[0046] 1.5 Identification of the proteome of exocrine vesicles by liquid chromatography-mass spectrometry:

[0047] 1) Sample pretreatment: Add an appropriate amount of SDT lysis buffer to the Staphylococcus aureus exovesicle sample and sonicate (100W, 10s on, 10s off, repeated 10 times). Incubate the lysed sample in a boiling water bath for 10 min. Centrifuge at 14,000×g at room temperature for 10 min, collect the supernatant, and perform protein quantification using the BCA method.

[0048] 2) Sample digestion: Take the treated protein solution, add DTT to a final concentration of 100 mM, boil in a water bath for 5 min, and then cool to room temperature. Add 200 μL of UA buffer (8 M urea, 0.1 M Tris-HCl, 50 mM dithiothreitol), mix well, and transfer to a 30 kDa ultrafiltration tube. Centrifuge at 14,000 × g for 15 min and discard the filtrate. Add 100 μL of IAA buffer (final concentration 100 mM IAA, dissolved in UA buffer) to the concentrated sample, shake the sample at 600 rpm for 1 min, and react at room temperature in the dark for 30 min. Then centrifuge at 14,000 × g for 15 min, add 100 μL of UA buffer, and centrifuge again at 14,000 × g for 15 min. Add 100 μL of 25 mM ammonium bicarbonate solution, centrifuge at 14,000 × g for 15 min, and repeat this step twice. Add 40 μL of Trypsin buffer (4 μg Trypsin added to 40 μL of 100 mM ammonium bicarbonate solution), shake the sample at 600 rpm for 1 min, and then incubate the sample at 37 °C for 16–18 h. Transfer the sample to a new centrifuge tube, centrifuge at 14,000 × g for 15 min, then add 40 μL of 25 mM ammonium bicarbonate solution, centrifuge at 14,000 g × g for 15 min, and collect the filtrate. Desalt the peptides using a C18 cartridge and lyophilize the peptides. Reconstitute the lyophilized peptides with 40 μL of 0.1% formic acid solution and quantify.

[0049] 3) Liquid Chromatography-Mass Spectrometry (LC-MS) Analysis of Exocrine Vesicles: 2 μL of the enzymatically digested product was analyzed using LC-MS based on the quantitative results. The column was equilibrated with 0.1% formic acid solution. The sample was loaded onto a Thermo Scientific EASY column (2 cm * 100 μm 5 μm-C18), followed by separation on a Thermo Scientific EASY column (75 μm * 100 mm 3 μm-C18) at a flow rate of 300 nL / min. The peptides were then analyzed by mass spectrometry using a Q-Exactive high-resolution mass spectrometer after chromatographic separation. Analysis duration: 60 min; Detection mode: positive ion; Precursor ion scan range: 300-1800 m / z; Primary mass spectrometry resolution: 70,000 at m / z 200; AGCarget: 3e6; Primary maximum IT: 50 ms; The mass-charge ratio of peptides and peptide fragments was acquired using the following method: 20 fragment spectra were acquired after each full scan (MS2 scan); Secondary mass spectrometry resolution: 17,500 at m / z 200; roscans: 1; resolution window: 2 m / z; Secondary maximum IT: 60 ms; MS2 Activation Type: HCD; Normalized collision energy: 27 eV; Dynamic exclusion: 60.0 s; Underfill ratio: 0.1%.

[0050] 4) Data Analysis: Raw data were analyzed using MaxQuant software to perform database searches for quantitative proteomics data. The protein database was uniprot_Staphylococcus_aureus_2926_210425.fasta (download link: http: / / www.uniprot.org). The search parameters were set as follows: enzyme: Trypsin; missed cleavage sites: 2; fixed modification: Carbamidomethyl (C); dynamic modifications: Oxidation (M) and Acetyl (Protein N-term). The filter parameter FDR ≤ 0.01 was set to screen the identified proteins.

[0051] 2. Test Results:

[0052] 2.1 Results of NTA analysis of Staphylococcus aureus exovesicles:

[0053] The number and size distribution of Staphylococcus aureus exovesicles were analyzed using NTA. The results showed that the number of exovesicles in the sample diluted 200-fold was 3.8 × 10⁻⁶. 7 / mL, the average diameter distribution of the isolated exocrine vesicles was 102.5 nm ( Figure 1 ).

[0054] 2.2 Transmission electron microscopy analysis results of Staphylococcus aureus exovesicles:

[0055] Staphylococcus aureus exotropic vesicles are nanoscale, spherical, double-membrane vesicles. Transmission electron microscopy (TEM) was used to observe the isolated Staphylococcus aureus exotropic vesicles. TEM results showed that the exotropic vesicles isolated from Staphylococcus aureus exhibited a typical teacup-shaped structure. Figure 2 ).

[0056] 2.3 Proteomic analysis results of Staphylococcus aureus exovesicles:

[0057] The protein composition of Staphylococcus aureus exovesicles was determined by analyzing the proteome using liquid chromatography-mass spectrometry (LC-MS). A total of 529 proteins (unique peptide ≥ 2) were identified in the exovesicles, including penicillin-binding proteins, aggregation factors A and B, immunoglobulin-binding protein Sbi, elastin-binding protein EbpS, autolysins, γ-hemolysin component A, and γ-hemolysin component B. Some of the identified proteins are closely related to the pathogenicity of Staphylococcus aureus. Bioinformatics analysis showed that these proteins are mainly involved in pathways such as amino acid biosynthesis, carbohydrate degradation, and cofactor biosynthesis. Figure 3 A). Enzyme classification analysis showed that these proteins were divided into oxidoreductases, transferases, and hydrolases, etc. Figure 3 B). Simultaneously, GO functional enrichment analysis revealed the molecular functions, biological processes, and cellular components of these proteins. Certain GO terms were significantly enriched in exovesicles, such as metabolic processes, molecular functional regulation, and catalytic activity. Figure 3 C). The results showed that Staphylococcus aureus exovesicles were closely related to the pathogenicity and immune evasion of Staphylococcus aureus.

[0058] Example 2: Association analysis between PSMα gene and Staphylococcus aureus exovesicle production

[0059] 1. Test method:

[0060] 1.1 Knockout of the PSMα gene in Staphylococcus aureus:

[0061] 1) pCpfSA plasmid amplification: The frozen bacterial culture carrying the pCpfSA plasmid was spread on a plate containing 50 μg / mL kanamycin. After culturing for 20 hours, a single colony was picked and cultured overnight at 37°C and 200 rpm in antibiotic-free liquid medium containing 50 μg / mL. The plasmid was then extracted using an endotoxin-free plasmid extraction kit.

[0062] 2) Spacer insertion: Using the restriction endonuclease BsaI, a spacer (F: AGATACATGGGTATCATTGCAGGAATC, R: GGCCGATTCCTGCAATGATACCCATGT) was inserted into the pCpfSA plasmid via the Golden Gate method. Subsequently, 10 μL of the product was transformed into 100 μL of *E. coli* IM08B competent cells using cold and heat shock methods. The bacterial culture was plated on LB agar plates containing 50 μg / mL kanamycin and incubated for 20 h. Single colonies from the plates were picked and incubated overnight at 37°C and 200 rpm in liquid medium containing 50 μg / mL kanamycin. The plasmid was then extracted.

[0063] 3) Insertion of homologous repair arms: The upstream and downstream homologous repair arm sequences were amplified using high-fidelity polymerase (upstream homologous repair arm primers: F: tctgcatctagaatgctcgagGTTCGATCAAAAGGTATCGTATGG, R: gaggtaatcttaTTTAAGCGAATTGAATACTTAAAATTCTC; downstream homologous repair arm primers: F: cgcttaaaTAAGATTACCTCCTTTGCTTATGAGTTAA, R: ggcaattccgacgatctcgagAAATGTCATGCTTGATAATTTCGC). The plasmid with the inserted spacer was linearized using XhoI, and then the homologous repair arms were inserted into the plasmid via homologous recombination. 10 μL of the product was transformed into 100 μL of *E. coli* IM08B competent cells using a cold-heat shock method. The bacterial culture was plated on LB agar plates containing 50 μg / mL kanamycin and cultured for 20 h. Single colonies from the plate were picked and cultured overnight at 37°C and 200 rpm in liquid medium containing 50 μg / mL kanamycin. Plasmids were then extracted for subsequent electroporation transformation.

[0064] 4) Preparation of competent Staphylococcus aureus cells: Culture Staphylococcus aureus overnight in Brain Heart Infusion Broth (BHI) (3-5 mL culture is sufficient). Add 1 mL of the overnight culture to 100 mL of fresh, antibiotic-free BHI liquid medium. Incubate at 37°C and 220 rpm until OD reaches [value missing]. 600nm It is 0.2-0.25.

[0065] The cultured Staphylococcus aureus was washed four times with pre-chilled 0.5M sucrose solution (17%) at 4°C, 6,000 rpm / min, for 9 min. The washing volume was increased from 100 mL to 25 mL, and finally to 3 mL, for a total of four washes. After each centrifugation, the liquid was discarded and fresh sucrose solution was added. The final precipitate was resuspended in approximately 400 μL of 0.5M sucrose solution.

[0066] 5) Electroporation: Add 1 μg of plasmid to 100 μL of competent Staphylococcus aureus cells. Gently pipette to mix and incubate on ice for 15 minutes, then transfer to an electroporation cuvette. Perform electroporation using an electroporator at 2.2 kV, 100 Ω, and 25 μF (using a 1 mm electroporation cuvette). Immediately after electroporation, add 1 mL of fresh BHI liquid medium to the electroporation cuvette, gently mix, and transfer to a sterile centrifuge tube. Incubate at 30°C and 180 rpm for 2.5 h, then plate onto agar plates containing 10 μg / mL chloramphenicol and incubate at 30°C for approximately 30 h.

[0067] 6) Plasmid repair: Pick a single colony and incubate overnight at 42°C and 200 rpm in antibiotic-free BHI medium. Streak the culture onto plates with or without chloramphenicol and incubate overnight at 37°C. If colonies grow on antibiotic-free plates but not on chloramphenicol-containing plates, the pCpfSA plasmid has been repaired.

[0068] 7) Gene knockout detection: Single clones were picked and cultured in BHI medium at 37°C and 200 rpm. Genomic DNA was extracted from the bacterial culture using a bacterial genomic DNA extraction kit. The knockout of the target gene was then detected by PCR and sequencing.

[0069] 1.2 Comparison of the effects of Staphylococcus aureus on the production of exovesicles:

[0070] Wild-type Staphylococcus aureus ATCC 25178 (WT) and PSMα gene knockout strain (Δpsmα) were cultured under the culture conditions described in 1.1 of Example 1; and Staphylococcus aureus exocrine vesicles were extracted according to the extraction method described in 1.2 of Example 1.

[0071] The extracted Staphylococcus aureus exovesicles were subjected to NTA analysis according to the method in Example 1; and the exovesicle protein concentration was determined using the following method:

[0072] Protein concentrations of Staphylococcus aureus exovesicles were determined using the Bradford method. 5 μL of standards or test exovesicle samples of different concentrations were added to 96-well plates using a pipette. 250 μL of Bradford Plus reagent was added to each well of the standards and test samples, and the mixture was gently vortexed for 30 seconds. The vortexed 96-well plates were incubated at room temperature for 10 minutes. The absorbance of the standards and samples was measured at 595 nm using a microplate reader. A standard curve was plotted using the standard measurements, and the protein concentration of each exovesicle sample was calculated using the standard curve.

[0073] 2. Test Results:

[0074] The PSMα gene was knocked out in Staphylococcus aureus using the pCpfSA plasmid. NTA analysis was performed on the exovesicles produced by the PSMα knockout strain. The results showed that the PSMα knockout strain produced fewer exovesicles compared to the wild-type strain. Figure 4 A) and the average particle size is smaller ( Figure 4 B). Measurements of exovesicle protein concentration revealed that the PSMα gene knockout strain produced exovesicles with lower protein concentrations compared to the wild-type strain. Figure 4 C).

[0075] The results showed that PSMα can regulate the production of Staphylococcus aureus exovesicles, and knocking out the PSMα gene reduces the production of Staphylococcus aureus exovesicles.

[0076] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. Application of the PSMα gene as a target in any of the following (1)-(3): (1) Regulate the number of Staphylococcus aureus exocytic vesicles; (2) Regulate the particle size of Staphylococcus aureus exocrine vesicles; (3) Regulate the concentration of Staphylococcus aureus exovesicle proteins; The nucleotide sequence of the PSMα gene is shown in SEQ ID NO.

1.

2. The substances that downregulate PSMα gene expression are used in the following applications (1) or (2): (1) Prepare a drug to reduce the number of Staphylococcus aureus exocytic vesicles; (2) Prepare drugs to reduce the concentration of Staphylococcus aureus exocyst protein.

3. The application according to claim 2, characterized in that, The substances that downregulate PSMα gene expression are: knockout or silencing vectors targeting the PSMα gene, small interfering RNA, shRNA, long non-coding RNA, or circular RNA.

4. The application according to claim 3, characterized in that, The substance that downregulates PSMα gene expression is a knockout vector targeting the PSMα gene.

5. The application according to claim 4, characterized in that, The knockout vector targeting the PSMα gene is either a pCpfSA vector or a CRISPR / Cas9 knockout vector.

6. A method for reducing the number of Staphylococcus aureus exocrine vesicles, characterized in that, The following steps are involved: Knock out the PSMα gene in Staphylococcus aureus; The nucleotide sequence of the PSMα gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that, The PSMα gene was knocked out using the pCpfSA plasmid.

Images