Efficient genetic transformation method for apple seedlings based on agrobacterium rhizogenes
By employing ultrasonic treatment and Agrobacterium rhizogenes K599-mediated infection, the problem of low hypocotyl transgenic root induction efficiency in Malus baccata seedlings was solved, achieving efficient and simple transformation results, suitable for genetic improvement and gene function verification in Malus species.
Patent Information
- Application Number
- CN202510929439.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies cannot efficiently and easily induce transgenic hypocotyl roots in Malus baccata seedlings under non-tissue culture conditions. In particular, the lack of a clear infection site and efficient infection mode leads to low transformation efficiency and complicated operation.
Using Agrobacterium rhizogenes K599-mediated method, the roots and hypocotyls of apple seedlings were ultrasonically treated to create slanted wounds, which were then infected with recombinant Agrobacterium rhizogenes carrying the target vector. Subsequently, they were co-cultured in a natural environment. The specific steps included an ultrasonic frequency of 40 kHz, a time of 3 minutes, a power of 100 W, an infection time of 10 minutes, and a co-culture time of 3 days.
This study achieved efficient transgenic induction of hypocotyls in Malus plants under non-tissue culture conditions, with a transformation efficiency of 79.37%. It simplified the operation process, reduced costs, and ensured the stable expression of exogenous genes.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a highly efficient genetic transformation method for apple seedlings based on Agrobacterium rhizogenes. Background Technology
[0002] An efficient genetic transformation system is crucial for achieving genetic improvement, gene function analysis, and molecular design breeding in fruit trees. Currently, genetic transformation in apples mainly relies on various methods such as leaf disc transformation, stem segment transformation, and callus transformation under tissue culture conditions. In recent years, genetic transformation systems have been preliminarily established for many apple materials, such as 'Royal Gala' and 'Golden Delicious'. However, some common problems still exist, such as strong genotype dependence, low regeneration efficiency, high transformation difficulty, and cumbersome experimental procedures. Moreover, the reported genetic transformation efficiency under apple tissue culture conditions in current studies is mostly only between 1% and 5%.
[0003] Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) and Agrobacterium rhizogenes ( Agrobacterium rhizogenes Agrobacterium tumefaciens and Agrobacterium rhizogenes are two commonly used strains in plant genetic transformation. Agrobacterium tumefaciens is widely used in apple leaf disc transformation, but its infection and transformation efficiency is relatively low. Agrobacterium rhizogenes, due to its Ri plasmid... rol Agrobacterium rhizogenes plays a crucial role in efficiently inducing transgenic hairy roots in plants and ensuring stable expression of exogenous genes. This technology is widely used in root functional gene research and the exploration of efficient genetic transformation systems. The technique of direct injection transformation of Agrobacterium rhizogenes under non-tissue culture conditions has been applied in various plants.
[0004] Malus halliana ( Malus micromalus Malus baccata is a widely used apple rootstock, characterized by its well-developed root system, strong resistance to adverse conditions, and good adaptability. Malus baccata seedlings are typically propagated from seeds; therefore, directly inducing stable transgenic roots from seedlings after sowing is of great significance for analyzing the gene function of Malus baccata and achieving genetic improvement. However, there is currently a lack of efficient, stable, and suitable non-tissue culture transgenic method for Malus baccata seedlings, especially regarding genetic transformation studies targeting specific parts of the seedling (hypocotyl).
[0005] The T-DNA region of the Ri plasmid of Agrobacterium rhizogenes K599 is naturally involved in root initiation and development. rol Genes (such as) rolA / B / C / D These can specifically induce the production of transgenic hairy roots at the site of infection. rolGenes can influence the levels of endogenous hormones in plants, making transformed cells more sensitive to auxin and promoting the induction of adventitious roots. Similar phenomena have been reported in many species. Studies have successfully induced transgenic adventitious roots in pea hypocotyls (with a transformation rate of 70%-80%) and verified their symbiotic relationship with rhizobia and arbuscular mycorrhizal fungi. Other studies have established adventitious root transformation systems using citrus seedlings.
[0006] In apples, Agrobacterium-mediated transgenic root induction under tissue culture conditions typically employs the stem base wound infection method, where the base of the stem segment of the tissue-cultured seedling is wounded before inoculation with Agrobacterium tumefaciens. Some studies have also used leaf scabs for direct infection to induce transgenic hairy roots. Under non-tissue culture conditions, the injection infection method is more widely used, where Agrobacterium rhizogenes bacterial solution is directly injected into the root-stem junction of apple seedlings to induce transgenic roots in natural soil conditions. Some studies have also used the plaster application method in crops such as cabbage, peas, and soybeans to achieve Agrobacterium rhizogenes-mediated transformation. This method is a non-injection infection approach, where Agrobacterium plaques are directly applied to the surface of plant wounds to promote transformation. However, this technique is less commonly used in woody fruit trees.
[0007] Disadvantages of existing technology 1) Most rely on tissue culture conditions: Currently, most transgenic root induction systems need to be completed in a sterile culture environment, requiring precise control of culture medium, hormone concentration, etc., and the sterile operation process is complex and costly, which is not conducive to large-scale promotion and application.
[0008] 2) The Agrobacterium rhizogenes transformation system is incomplete: Compared with adventitious bud induction, there are fewer studies on the in situ transformation system of adventitious roots, especially in the induction of transgenic roots of apple rootstocks, which lacks clear infection sites, efficient infection methods and operation procedures.
[0009] 3) Low efficiency of transgenic root induction: Current research mostly uses injection, scratching and other methods to achieve non-tissue culture transformation, but the infection efficiency is low. Each seedling needs to be treated individually during infection, which is a complicated procedure and makes it difficult to obtain a large number of transformed roots at once.
[0010] In summary, existing technologies cannot achieve a simple and efficient hypocotyl transgenic root induction system for Malus baccata, a plant in the genus Malus, under non-tissue culture conditions. Summary of the Invention
[0011] The technical problem to be solved by the present invention is how to provide a hypocotyl transgenic induction system for Malus baccata, a plant of the genus Malus, that is easy to operate and highly efficient under non-tissue culture conditions.
[0012] To address the aforementioned problems, this invention provides a method for Agrobacterium rhizogenes-mediated genetic transformation of Malus plants, including... 1) The roots and the hypocotyl connected to the roots of the apple seedlings to be transformed are removed to create a slanted wound, thus obtaining explants. 2) The explants are subjected to ultrasonic treatment to obtain ultrasonically treated explants. 3) Infect the sonicated explants with recombinant Agrobacterium rhizogenes carrying the target vector to obtain infected explants. 4) Co-culture the infected explants to obtain co-cultured explants, thus completing the transformation; The ultrasonic treatment was performed at a frequency of 40 kHz, for a duration of 3 minutes, and with a power of 100 W.
[0013] In the above method, the portion of the hypocotyl connected to the root is 1 / 5 of the length of the entire hypocotyl.
[0014] The hypocotyl is part of the hypocotyl and is located below the cotyledons, specifically the part connecting the cotyledons and radicle of the seedling.
[0015] The apple seedlings are non-tissue culture seedlings. In one specific embodiment of the invention, the apple seedlings are seedlings grown from seed. Seedlings refer to seedlings that grow from seeds.
[0016] In the above method, the apple seedlings can be seedlings with two to four leaves. In one specific embodiment of the present invention, the apple seedlings are seedlings with three leaves.
[0017] In the above method, the apple plant can be Malus halliana.
[0018] In the above method, the Agrobacterium rhizogenes can be Agrobacterium rhizogenes strain K599.
[0019] In the above method, the infection can be achieved by soaking the ultrasonically treated explant wound in a liquid containing the recombinant Agrobacterium rhizogenes for 10 minutes.
[0020] In the above method, the co-culture is carried out in the dark for 3 days in an environment with a temperature of 20-25℃ and a relative humidity of 70-80%. After 3 days, the culture is continued under a condition of 16 hours of light and 8 hours of darkness per day.
[0021] This invention also provides the application of the above method in the breeding of apple plants.
[0022] This invention also provides the application of the above method in gene function verification.
[0023] In the above method, the Agrobacterium rhizogenes K599 strain contains the streptomycin Str resistance gene.
[0024] The recombinant Agrobacterium rhizogenes described above was obtained by transforming the vector plasmid pBI121 into Agrobacterium rhizogenes strain K599.
[0025] The recombinant Agrobacterium rhizogenes can be prepared as follows: Agrobacterium rhizogenes K599 competent cells are thawed on ice and set aside. 100 µL of competent cells are taken and 1 µL of pBI121 plasmid DNA is added. After gentle mixing, the cells are sequentially placed in liquid nitrogen for 5 min, then in a 37°C water bath for 5 min, and then quickly transferred to ice and allowed to stand for 5 min. 800 µL of antibiotic-free liquid LB medium (or TY medium) is added to a clean bench and cultured in a shaker at 28°C for 3 h. 100-200 µL of the bacterial suspension is taken and evenly spread onto TY plates containing appropriate kanamycin and streptomycin resistance using sterile glass beads, and incubated upside down at 28°C for 2 days.
[0026] This invention aims to address the challenges of inducing transgenic roots in apple rootstock *Malus floribunda* under non-tissue culture conditions, as well as the incompleteness of existing methodologies. Most existing genetic transformation technologies for woody fruit trees rely on tissue culture systems, which suffer from strong dependence on explant type, the need for a sterile environment during transformation, cumbersome hormone treatment, and long operation cycles, severely limiting their application. Furthermore, research on in situ adventitious root induction and root transgenic transformation in apple rootstock *Malus floribunda* is limited, particularly lacking a highly efficient *Agrobacterium rhizogenes* transformation system that uses the hypocotyl of seedlings as the infection target under non-tissue culture conditions. Therefore, the core issue of this invention is to construct a genetic transformation method (ultrasound-assisted infection method) for *Agrobacterium rhizogenes*-mediated induction of transgenic roots that requires no tissue culture, is simple to operate, has high infection efficiency, stable expression, and can be achieved in situ on the hypocotyl of seedlings. This method aims to solve the problem of in situ induction of transgenic roots in apple rootstock *Malus floribunda* under non-tissue culture conditions and provide technical support for accelerating gene function verification and molecular design breeding processes in woody fruit trees.
[0027] This invention establishes a highly efficient method for inducing transgenic adventitious roots of hypocotyls from apple rootstock Malus baccata seedlings based on Agrobacterium rhizogenes K599, which has the following significant beneficial effects: 1) No tissue culture environment required, simple operation: This invention breaks away from the traditional genetic transformation system that relies on sterile tissue culture. The infection site is the hypocotyl of the seedling. Transgenic roots can be induced under natural non-tissue culture seedling conditions, which reduces the operation threshold and experimental cost.
[0028] 2) High transformation efficiency and stable results: After using the ultrasound-assisted infection method, the induction efficiency of transgenic adventitious roots was significantly improved, reaching 79.37%, which is significantly higher than the traditional injection method and plaque method. Moreover, the obtained adventitious roots showed stable expression in GUS staining verification, indicating that the exogenous gene was successfully integrated and expressed.
[0029] 3) Strong applicability and great application potential: This method is not only applicable to Malus baccata, but can also be used in other rootstocks or woody plants of the genus Malus, providing technical reference for the verification of root-related functional genes and non-tissue culture in situ transformation. Attached Figure Description
[0030] Figure 1 This is a map of the pBI121 plasmid.
[0031] Figure 2 The images show the GUS staining of transgenic adventitious roots induced by Agrobacterium rhizogenes K599 infection of the hypocotyl of seedlings. In image A, the GUS staining at the injection site is shown 3 days after infection with the bacterial solution at the hypocotyl. In image B, the GUS staining of hairy adventitious roots obtained after infection at the hypocotyl is shown. WT represents the wild type, and TR represents the transgenic adventitious roots obtained.
[0032] Figure 3 The effects of different infection methods on the genetic transformation efficiency of hypocotyls in Malus baccata seedlings. In this study, A represents the methods of hypocotyl infection mediated by Agrobacterium rhizogenes K599, from left to right: injection infection, ultrasound-assisted infection, and cut surface plaque smear method; B represents the transgenic roots obtained through injection infection and ultrasound-assisted infection; C represents the induction rate of transformed hypocotyl roots after infection using different methods. The experiment was performed in triplicate, and multiple comparisons were conducted using Tukey's post-hoc test. Different letters indicate statistically significant differences between groups (P < 0.05).
[0033] Figure 4 This document outlines the technical process for infecting the hypocotyls of Malus baccata seedlings using an ultrasound-assisted method. Detailed Implementation
[0034] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0036] Unless otherwise specified, the specific apple rootstock variety used in the following examples is Malus baccata.
[0037] The following examples used Origin 2024 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The experiment was repeated three times, and Tukey post-hoc test was used for multiple comparisons. Different letters indicate that the differences between groups reached the significance level (P<0.05).
[0038] Example 1: Genetic transformation of hypocotyls mediated by Agrobacterium rhizogenes K599 under non-tissue culture conditions 1. Seed stratification of Malus octaveta Take an appropriate amount of Malus halliana seeds that have been stored at room temperature and are dry. Soak them in water for 12 hours, then discard any flawed seeds that float on the surface. After washing, spread the seeds evenly in a 15-20 cm glass petri dish containing a moist gauze. Place the dish in a 4℃ refrigerator. Every 7 days, wash the seeds and gauze with water, ensuring the gauze is moist but not waterlogged. After washing, return the dish to its original position. After about 30 days, a large number of seeds will show white radicles, indicating that stratification is complete. Remove the seeds from the 4℃ refrigerator and place them at room temperature for 1-2 days until the radicles elongate. The seeds are then ready for sowing.
[0039] 2. Sowing and seedling cultivation of Malus halliana After stratification, once the radicles of the Malus halliana seeds have elongated to a suitable level, select healthy and plump seeds for sowing. The sowing substrate is a loose, well-draining mixture of peat moss and vermiculite (volume ratio 3:1). Fill the sowing trays with the substrate, water thoroughly, keeping the substrate moist but not waterlogged. Sow the seeds evenly on the substrate surface using a spot sowing method, covering them with 0.5-1.0 cm of soil and gently compacting to ensure full contact between the seeds and the substrate. Cover with a plastic moisture-retaining cover after sowing. Place the seedling trays in a greenhouse with a temperature of 20-25℃, relative humidity of 60-70%, and light intensity of 12 h / d. In the early stages of sowing (0-10 days), keep the substrate moist by spraying with water 1-2 times daily. Gradually reduce the watering frequency after the seedlings develop cotyledons.
[0040] 3. Plasmid selection and transformation with Agrobacterium rhizogenes K599 The experimental vector chosen was the commercially available vector pBI121 (Beijing Zhuangmeng International Biotechnology Co., Ltd., ZK850), which possesses... 35S::GUS sequence.
[0041] Agrobacterium type selected was Agrobacterium rhizogenes K599 strain (Shanghai Weidi Biotechnology Co., Ltd., AC1080S). The vector plasmid pBI121 was transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. The glycerol bacteria were stored at -80℃ for later use.
[0042] The Agrobacterium-mediated transformation process is as follows: Thaw Agrobacterium rhizogenes K599 competent cells on ice. Take 100 µL of competent cells and add 1 µL of plasmid DNA. Gently mix, then freeze in liquid nitrogen for 5 min, incubate at 37°C for 5 min, and immediately transfer to ice for 5 min. Next, add 800 µL of antibiotic-free liquid LB medium (or TY medium) to a clean bench and incubate at 28°C on a shaker for 3 h. Take 100-200 µL of the bacterial culture and spread it evenly on kanamycin-resistant and streptomycin-resistant TY plates using sterile glass beads. Incubate at 28°C upside down for 2 days.
[0043] Single colonies were selected and PCR was performed using primers GUS-F / R. The primer sequences are as follows: GUS-F: CATGAAGATGCGGACTTGCG; GUS-R:ATAACGGTTCAAGGCACAGCA.
[0044] After verification, a positive single colony was obtained and used for subsequent Agrobacterium rhizogenes infection tests.
[0045] 4. Selection of the conversion site Fresh tissues to be stained, such as leaves and adventitious roots, were sampled and placed in appropriately sized centrifuge tubes. GUS staining solution was added and the tubes were soaked in the solution. After incubating at 37°C for 12-16 hours, the waste GUS staining solution was discarded, and 75% ethanol was added. The tubes were then placed in a 37°C oven for further destaining for 8-12 hours, with the 75% ethanol replaced twice, until the negative control plant tissue turned white. The blue areas, observed with the naked eye or under a microscope, represent the GUS expression sites.
[0046] To explore the non-tissue culture genetic transformation system of hypocotyls in Malus halliana seedlings, an injection infection experiment was conducted on the hypocotyl using Agrobacterium rhizogenes K599 carrying the pBI121 vector. The results showed that, under the injection infection of Agrobacterium rhizogenes K599, numerous hairy adventitious roots could be induced to form at the wound site of the hypocotyl. Figure 2 (A), and compared with the wild-type control, GUS staining showed a distinct blue color ( Figure 2 (Figure B) indicates that the hypocotyl of this Malus octaveis can be successfully overexpressed with transgenic adventitious roots under the infection of Agrobacterium rhizogenes.
[0047] This result demonstrates that *Agrobacterium rhizogenes* K599 can efficiently infect the hypocotyl of *Malus arborescens* seedlings via injection under non-tissue culture conditions, inducing transgenic hairy adventitious roots expressing exogenous genes. This method is simple to operate, requires no aseptic culture system, has a clearly defined infection site, and is highly efficient. It has preliminarily achieved the induction of in situ transgenic hypocotyl roots in *Malus arborescens* rootstock at the seedling stage. Further optimization and exploration of the infection method will follow.
[0048] 5. Selection of infection mode To further optimize the Agrobacterium rhizogenes K599-mediated hypocotyl genetic transformation system and find the infection method with the highest transformation efficiency, three different Agrobacterium rhizogenes infection methods—injection infection, ultrasound-assisted infection, and cut surface plaque smear—were selected to infect the hypocotyls of Malus baccata seedlings. Figure 3 (A), and assess the formation of transgenic adventitious roots.
[0049] I. Injection Infection Method The logarithmic growth phase Agrobacterium rhizogenes was removed from the shaker and centrifuged to resuspend the culture. The resuspension was prepared using MES buffer (10 mmol / L MES-KOH (pH 5.2), 10 mmol / L MgCl2, and 100 μmol / L acetylsylgenone) to obtain the bacterial suspension for infection. An appropriate amount of the Agrobacterium resuspension was drawn up with a 1 mL syringe and injected into the rootstock junction of a Malus baccata seedling. The seedling was then replanted in the seedling tray substrate for induction culture, ensuring the injection site was buried in the soil to maintain moisture and facilitate the induction of hairy roots.
[0050] II. Ultrasonic-assisted immersion and infection method Select healthy, whole-planted Malus halliana seedlings. Using a blade, remove the young roots and the portion of the hypocotyl connected to the roots (approximately 1 / 5 of the total hypocotyl length), creating a slanted cut to increase the wound area. After treating the hypocotyl wound with an ultrasonic cleaner (40kHz frequency) for 3 minutes, soak it in a resuspended bacterial solution for 10 minutes. Ensure the wound is covered with bacterial cells, and directly plant the treated seedlings into pre-prepared moist, sterilized substrate trays. Slowly add the remaining bacterial solution around the infected area using a pipette to improve infection efficiency. Incubate in a high-humidity, dark environment for 3 days, then transfer to normal light conditions to continue growth, covering with a transparent lid to maintain humidity.
[0051] III. Plaque Application Method Take 300 µL of Agrobacterium-mediated bacterial suspension and spread it evenly on a TY-resistant plate. After 2-3 days, the bacterial colonies will cover the plate, and it is ready for use. Take a healthy, three-leaf-aged Malus halliana seedling and use a blade to cut off the young roots and part of the hypocotyl connected to the roots (about 1 / 5 of the total length of the hypocotyl), making the cut surface slant-shaped. Dip the cut area into the Agrobacterium-mediated bacterial colonies (the paste-like colonies collected by the spreader) on the plate, ensuring that the wound surface is covered by the bacterial colonies. Plant the treated seedlings directly into pre-prepared moist sterilized substrate trays and place them in a high-humidity, dark environment for 3 days. Then, transfer them to normal light conditions to continue growth and cover them with a transparent lid to maintain humidity.
[0052] The experiment was repeated three times, with each treatment transfected into 96 seedlings (explants) in each repetition. Tukey post-hoc test was used for multiple comparisons, and different letters indicated that the differences between groups reached a significant level (P<0.05).
[0053] The formula for calculating the induction rate of transgenic adventitious roots is: Transgenic adventitious root induction rate (%) = Number of seedlings induced with transgenic adventitious roots / Total number of seedlings treated The results showed that the ultrasound-assisted infection method had the highest induction rate of transgenic adventitious roots, reaching 79.37%, which was significantly higher than the other two methods; while the conversion rates of the injection infection method and the cut surface plaque smear method were relatively low, at 57.93% and 61.5%, respectively, with no significant difference between the two methods. Figure 3 (Middle BC). This result indicates that ultrasound-assisted infection can significantly improve the induction rate of transgenic adventitious roots from the hypocotyl of Malus baccata.
[0054] Ultrasonic treatment increases the permeability of the hypocotyl cell wall, thereby improving the efficiency of Agrobacterium entry; it also promotes the tight adhesion of Agrobacterium to the area around the cut wound, resulting in a larger area for infection and transformation. Figure 3 The staining of the far right of B is shown in the image. Simultaneously, the ultrasonic-assisted infection stimulates a stress response, leading to the secretion of various phenolic secondary metabolites, making the cells more susceptible to Agrobacterium infection and the integration of exogenous genes. While injection infection can directly inject bacteria into tissue cells, its infection range is limited and its transformation efficiency is low. In the smear method, the hypocotyl base is prone to rotting in the soil after infection, hindering normal infection and regeneration, indicating that the concentration of the plaque and the co-culture environment need further optimization. Therefore, the method with the highest induction rate of transgenic hypocotyl roots mediated by Agrobacterium rhizogenes K599 is ultrasonic-assisted infection.
[0055] Example 2: Procedure for Ultrasonic-Assisted Infection of Hypocotyls of Malus baccata Seedlings Example 1 demonstrates that ultrasound-assisted infection is the most efficient technique for inducing transgenic roots from the hypocotyl region. The following example will be based on... Figure 4 The experimental procedure shown details the technical approach for non-tissue culture genetic transformation of the hypocotyl portion of Malus baccata seedlings using Agrobacterium rhizogenes K599 and ultrasound-assisted transformation. The specific steps are as follows: 1) Seedling age selection and pretreatment: Select seedlings of Malus halliana with about three leaves, ensuring that the plants are healthy and free from pests and diseases. Use a scalpel to remove the young roots and part of the hypocotyl to obtain explants. The explants include leaves, epicotyl, and the remaining part of the hypocotyl. The wound should be cut at an angle to enhance the efficiency of fungal attachment and infection.
[0056] 2) Preparation of Agrobacterium rhizogenes bacterial culture: Select Agrobacterium rhizogenes strain K599 carrying the pBI121 vector and culture it in LB liquid medium containing 50 μg / mL kanamycin (Kan) and 50 μg / mL streptomycin (Str) at 28°C for about 14 hours in a shaker until the logarithmic growth phase. Adjust the bacterial concentration to OD. 600 It is 0.6-0.8.
[0057] 3) Ultrasonic-assisted infection treatment: The hypocotyl of the pretreated Malus halliana seedlings was immersed in blank resuspension culture medium and then treated in an ultrasonic cleaner at a frequency of 40 kHz and a power of 100 W for 3 min. Ultrasonic treatment promotes the penetration of the bacterial solution into the plant cell wall, thereby improving the infection effect.
[0058] 4) Bacterial infection: After the seedlings were treated with ultrasonic wound creation, they were transferred to the resuspended Agrobacterium rhizogenes bacterial solution and the hypocotyls were immersed in the bacterial solution for 10 min for infection.
[0059] 5) Sowing and Cultivation: After infection, remove the seedlings and drain them slightly. Then, insert the hypocotyls into seedling trays filled with moist substrate (peat moss / vermiculite / perlite, volume ratio 3:1:1). Maintain a moderate planting density to avoid excessive residual bacterial solution leading to rot.
[0060] 6) Dark induction and routine culture: Place seedlings in seedling trays with transparent covers, cover them with black cloth, and culture them in darkness for 3 days to promote co-culture and infection. After 3 days, transfer them to a normal light environment for continued culture, maintaining a temperature of 20-25℃ and a relative humidity of 70-80%.
[0061] 7) Results observation and transgenic verification: After about 20 days of culture, hairy adventitious roots were induced in situ at the wound site of the hypocotyl. The hairy roots were verified to be positive for transformation by the GUS staining method in step 4 of Example 1.
[0062] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A method for genetic transformation of Malus plants mediated by Agrobacterium rhizogenes, including... 1) Remove the roots and the portion of the hypocotyl connected to the roots (approximately 1 / 5 of the total length of the hypocotyl) from the apple seedlings to be transformed, creating a slanted wound to obtain the explant. 2) The explants are subjected to ultrasonic treatment to obtain ultrasonically treated explants. 3) Infect the sonicated explants with recombinant Agrobacterium rhizogenes carrying the pBI121 vector to obtain infected explants. 4) Co-culture the infected explants to obtain co-cultured explants, thus completing the transformation; The ultrasonic treatment was performed at a frequency of 40 kHz, for a duration of 3 minutes, and with a power of 100 W.
2. The method according to claim 1, characterized in that, The ultrasonic frequency is 40 kHz, and the ultrasonic duration is 3 minutes.
3. The method according to claim 1 or 2, characterized in that, The apple seedlings mentioned are three-leaf-aged seedlings.
4. The method according to any one of claims 1-3, characterized in that, The apple rootstock variety is Malus baccata.
5. The method according to any one of claims 1-4, characterized in that, The Agrobacterium rhizogenes is strain K599.
6. The method according to any one of claims 1-5, characterized in that, The infection was achieved by immersing the ultrasound-treated explant wound in a liquid containing the recombinant Agrobacterium rhizogenes for 10 minutes.
7. The method according to any one of claims 1-6, characterized in that, The co-culture was carried out in the dark for 3 days in an environment with a temperature of 20-25℃ and a relative humidity of 70-80%. After 3 days, the culture was continued under a 16-hour light and 8-hour dark environment per day.
8. The application of the method according to any one of claims 1-7 in the breeding of apple plants.
9. The application of the method according to any one of claims 1-8 in gene function verification.