Anti-CD70 nano antibody, chimeric antigen receptor containing same and application of anti-CD70 nano antibody and chimeric antigen receptor

By developing nanobodies and chimeric antigen receptors (CARs) targeting CD70, the limited killing effect of CAR-T therapy on solid tumors has been solved, achieving highly efficient killing of CD70-positive tumor cells and low damage to normal tissues, thus enhancing the efficacy of solid tumor treatment.

CN120865403APending Publication Date: 2025-10-31NANJING MIRACLE BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202410495812.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-23
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Existing CAR-T therapies have limited killing effects on solid tumors, are difficult to penetrate dense tissues effectively, and traditional antibodies have stability and immunogenicity issues.

Method used

We developed a CD70-targeting nanobody and its chimeric antigen receptor (CAR). By utilizing the high affinity and small molecular weight of the nanobody, we can bind to CD70-positive tumor cells to prepare CAR-T cells to enhance the killing ability against solid tumors, while maintaining low killing effect on normal tissues and high proliferative capacity.

Benefits of technology

CAR-T cells have a good killing effect on CD70-positive tumor cells, without significant damage to normal tissues, strong proliferation capacity, and low exhaustion index, thus improving the effectiveness of solid tumor treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120865403A_ABST
    Figure CN120865403A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and relates to a nano antibody specifically bound with CD70 or an antigen binding fragment thereof. Specifically, the nano antibody or the antigen binding fragment thereof comprises complementary determining regions CDR1, CDR2 and CDR3 in an amino acid sequence as shown in any one of SEQ ID NOs: 4, 7, 11, 14 and 18. The invention also relates to chimeric antigen receptors (CARs) comprising such nanoantibodies or antigen binding fragments thereof, nucleic acid molecules encoding such CARs, immune cells expressing such CARs, and the use of said CARs or immune cells for the prevention and / or treatment of CD70-related conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to antibodies that specifically bind to CD70 and their antigen-binding fragments, as well as chimeric antigen receptors (CARs) containing them. This invention also relates to nucleic acid molecules encoding such CARs, immune cells expressing such CARs, and the use of these CARs and immune cells for the prevention and / or treatment of CD70-related conditions. Technical Background

[0002] With the development of tumor immunology theory and clinical techniques, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most popular and research-worthy treatment methods in tumor immunotherapy. Currently, CAR-T therapy has made significant progress in hematological malignancies; however, due to the complex tumor microenvironment, the killing effect of CAR-T on solid tumors is limited. Therefore, new methods need to be explored to improve the activity of CAR-T therapy in solid tumors.

[0003] The basic design of CARs includes tumor-associated antigen-binding regions, intracellular signaling regions, transmembrane regions, and extracellular hinge regions. Nanobodies are currently the smallest functional antigen-specific binding natural fragments, composed of approximately 120 amino acids, with a length of 4 nm and a diameter of 2.5 nm. This is in contrast to traditional monoclonal antibodies and Fab fragments (55 × 10³) or V... H With a molecular weight of 28×10³, nanobodies have a smaller molecular weight, resulting in stronger and faster tissue penetration, enabling them to reach dense tissues such as solid tumors to exert their effects. In addition, nanobodies offer advantages such as good stability, high affinity, weak immunogenicity, and ease of genetic modification. They also avoid the problems of mispairing and the need for optimization of heavy and light chain linkage sequences common with traditional antibodies, demonstrating broad application prospects in areas such as tumor immunotherapy.

[0004] CD70 is a member of the tumor necrosis factor receptor (TNFR) superfamily and has the ability to regulate the activation, proliferation, and differentiation of T cells and B cells, playing an important role in maintaining the body's immune response. While CD70 is only transiently expressed in activated lymphocytes under physiological conditions, it is abnormally expressed in various cancers, including renal cell carcinoma, lung cancer, hematopoietic tumors, and central nervous system gliomas. It is closely related to tumor development and prognosis, and could serve as a novel biomarker for early cancer diagnosis, a new target for clinical diagnosis and treatment, and a potential prognostic indicator. Summary of the Invention

[0005] Through in-depth research, the inventors developed anti-CD70 nanobodies or their antigen-binding fragments, and further developed a chimeric antigen receptor (CAR) targeting CD70. CAR-T cells prepared based on CD70-targeting CARs exhibit good killing effects on CD70-positive tumor cells, while having no killing effect on normal tissue cells with weak CD70 expression, and can maintain high proliferative capacity and low exhaustion indicators. This provides the following invention.

[0006] Nanobody

[0007] On one hand, the present invention provides nanobodies that specifically bind to CD70 or antigen-binding fragments thereof. Nanobodies typically comprise a V region consisting of four framework regions (FRs) and three complementarity-determining regions (CDRs). H H, referred to as FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4, wherein the antigen-binding fragment comprises at least a portion of the nanobody, sufficient to confer the ability of the fragment to specifically bind CD70. The nanobody described in this invention may also be truncated at the N-terminus or C-terminus to contain only a portion of FR1 and / or FR4, or to lack one or both of those backbone regions, as long as it substantially maintains antigen binding and specificity.

[0008] In some embodiments, the nanobody or its antigen-binding fragment comprises complementarity-determining regions CDR1, CDR2, and CDR3 in the amino acid sequences shown in any one of SEQ ID NOs:4, 7, 11, 14, and 18. In some embodiments, CDR1 to CDR3 are defined according to the Kabat, Chothia, or IMGT numbering system.

[0009] In some embodiments, the nanobody or its antigen-binding fragment comprises:

[0010] (1) CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:2, and CDR3 shown in SEQ ID NO:3;

[0011] (2) CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:5, and CDR3 shown in SEQ ID NO:6;

[0012] (3) CDR1 shown in SEQ ID NO:8, CDR2 shown in SEQ ID NO:9, and CDR3 shown in SEQ ID NO:10;

[0013] (4) CDR1 shown in SEQ ID NO:8, CDR2 shown in SEQ ID NO:12, and CDR3 shown in SEQ ID NO:13; or

[0014] (5) CDR1 shown in SEQ ID NO:15, CDR2 shown in SEQ ID NO:16, and CDR3 shown in SEQ ID NO:17.

[0015] In some implementations, the CDR described in any of the above implementations is defined by the Kabat numbering system.

[0016] In some embodiments, the nanobody or its antigen-binding fragment further includes a framework region derived from a camel-derived antibody.

[0017] In other embodiments, the nanobody or its antigen-binding fragment further comprises a heavy chain framework region derived from human immunoglobulins (e.g., a heavy chain framework region contained in the amino acid sequence encoded by a human heavy chain germline antibody gene), the heavy chain framework region optionally comprising one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) reversion mutations from human residues to camel residues.

[0018] In some embodiments, the nanobody or its antigen-binding fragment comprises the sequence shown in any one of SEQ ID NOs: 4, 7, 11, 14, 18, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids) compared to it; in some embodiments, the substitution is a conservative substitution. Those skilled in the art will understand that in V H Sequences whose N-terminus of the H sequence contains or does not contain an amino acid (such as Met) encoded by a start codon are all within the scope of protection of this invention.

[0019] peptide constructs

[0020] On the other hand, the present invention provides a polypeptide construct that specifically binds to CD70, comprising the nanobody of the present invention or its antigen-binding fragment and the immunoglobulin Fc fragment.

[0021] In some embodiments, the polypeptide construct further includes a signal peptide at its N-terminus.

[0022] In some embodiments, the polypeptide construct comprises, from N-terminus to C-terminus, the signal peptide, the nanobody or its antigen-binding fragment, and the immunoglobulin Fc fragment.

[0023] In some embodiments, the signal peptide is a murine light chain signal peptide (e.g., κ light chain signal peptide).

[0024] In some embodiments, the signal peptide comprises the sequence shown in SEQ ID NO: 24, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., 1, 2, 3, 4, or 5 amino acid substitutions, deletions, or additions). In some embodiments, the signal peptide comprises the sequence shown in SEQ ID NO: 24.

[0025] In this document, the Fc segment, also referred to as the Fc region, refers to a portion of the heavy chain constant region containing CH2 and CH3. In some embodiments, the Fc segment contains CH2 and CH3. In some embodiments, the Fc segment is the Fc segment of IgG (e.g., IgG1, IgG2, IgG3, or IgG4).

[0026] In some embodiments, the Fc segment included in the polypeptide construct of the present invention is a natural Fc segment containing an amino acid sequence consistent with the amino acid sequence of Fc segments found in nature. For example, the Fc segment may be a natural sequence human IgG1 Fc segment, a natural sequence human IgG2 Fc segment, a natural sequence human IgG3 Fc segment, or a natural sequence human IgG4 Fc segment. The natural Fc segment may have effector functions. Exemplary "effector functions" include binding to Fc receptors; Clq binding and complement-dependent cytotoxicity (CDC); antibody-dependent cell-mediated cytotoxicity (ADCC); phage activity; downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation, etc. Functional alterations can be produced by replacing at least one amino acid residue in the natural Fc segment with different residues or by chemical modification, for example, altering the antibody's affinity for effector ligands (such as FcR or complement C1q), thereby changing the effector function (e.g., reducing or enhancing it).

[0027] Therefore, in some embodiments, the Fc segment contained in the polypeptide construct of the present invention may also be a variant Fc segment, which may contain one or more (e.g., 1-10, e.g., 1-5) amino acid mutations or chemical modifications compared to the natural Fc segment to change one or more of the following properties of the antibody of the present invention: Fc receptor binding, antibody glycosylation, number of cysteine ​​residues, effector cell function or complement function, etc.

[0028] In some embodiments, the immunoglobulin Fc segment is the Fc segment of human IgG (e.g., IgG1, IgG2, IgG3, or IgG4).

[0029] In some embodiments, the immunoglobulin Fc fragment comprises the sequence shown in SEQ ID NO: 25, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., 1, 2, 3, 4, or 5 amino acid substitutions, deletions, or additions). In some embodiments, the immunoglobulin Fc fragment comprises the sequence shown in SEQ ID NO: 25.

[0030] In some embodiments, the polypeptide construct comprises a sequence shown in any one of SEQ ID NOs:19-23, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., 1, 2, 3, 4, or 5 amino acid substitutions, deletions, or additions). In some embodiments, the polypeptide construct comprises a sequence shown in any one of SEQ ID NOs:19-23.

[0031] Preparation of nanobodies and peptide constructs

[0032] The nanobodies or peptide constructs of the present invention can be prepared using various methods known in the art, such as phage display technology and genetic engineering recombination technology. For example, DNA molecules encoding the nanobodies or peptide constructs of the present invention can be obtained by chemical synthesis or PCR amplification. The obtained DNA molecules are inserted into an expression vector and then transfected into host cells. The transfected host cells are then cultured under specific conditions to express the nanobodies or peptide constructs of the present invention. The antigen-binding fragments of the present invention can be obtained by hydrolyzing intact antibody molecules.

[0033] In another aspect, the present invention also provides isolated nucleic acid molecules that encode the nanoantibodies of the present invention or antigen-binding fragments thereof, or polypeptide constructs of the present invention.

[0034] In another aspect, the present invention also provides a vector comprising the isolated nucleic acid molecules of the present invention. In some embodiments, the vector is a cloning vector or an expression vector.

[0035] In another aspect, the present invention also provides host cells comprising the isolated nucleic acid molecules or vectors of the present invention. Such host cells include, but are not limited to, prokaryotic cells such as bacterial cells (e.g., Escherichia coli cells), eukaryotic cells such as fungal cells (e.g., yeast cells), insect cells, plant cells, and animal cells (e.g., mammalian cells, such as mouse cells, human cells, etc.).

[0036] In another aspect, the present invention also provides a method for preparing the nanobodies of the present invention or their antigen-binding fragments or the polypeptide constructs of the present invention, comprising culturing the host cells of the present invention under conditions that allow protein expression, and recovering the nanobodies or their antigen-binding fragments or the polypeptide constructs from the cultured host cell culture.

[0037] Conjugate

[0038] On the other hand, the present invention also provides conjugates comprising the nanoantibody or its antigen-binding fragment, or polypeptide construct, and the conjugated portion thereof.

[0039] In some embodiments, the nanobody of the present invention or its antigen-binding fragment, or polypeptide construct, is optionally conjugated to the coupling moiety via a linker.

[0040] In some embodiments, the conjugation portion is selected from protein tags. Such protein tags are well known in the art, and examples include, but are not limited to, His, Flag, GST, MBP, HA, Myc, GFP, or biotin, and those skilled in the art know how to select appropriate protein tags (e.g., purification tags, detection tags, or tracer tags) according to the desired purpose. In some exemplary embodiments, the C-terminus of the bispecific antibody of the present invention is linked to a purification tag.

[0041] In some embodiments, the coupling portion is selected from detectable markers, such as enzymes (e.g., horseradish peroxidase), radionuclides, fluorescent dyes, luminescent substances (e.g., chemiluminescent substances), or biotin. The detectable markers described in this invention can be any substance detectable by fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electrical, optical, or chemical means. Such markers are well known in the art, and examples include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, β-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g., 3H, 125I, 35S, 14C, or 32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas red, rhodamine, quantum dots, or cyanine dye derivatives (e.g., Cy7, Alexa 750)), luminescent substances (e.g., chemiluminescent substances such as acridinium esters), magnetic beads (e.g., The labeling includes thermometric markers such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex, etc.), and biotin for binding avidin (e.g., streptavidin) modified with the aforementioned markers. In some embodiments, such markers are suitable for immunological assays (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescence immunoassay, etc.). In some embodiments, the detectable markers described above can be linked to the nanobodies or their antigen-binding fragments or peptide constructs of the present invention via linkers of varying lengths to reduce potential steric hindrance.

[0042] In some embodiments, the coupling portion is selected from therapeutic agents, such as antitumor drugs or cytotoxic drugs.

[0043] In some embodiments, the coupling moiety is selected from other bioactive peptides.

[0044] In some embodiments, the conjugate is an antibody-drug conjugate (ADC), wherein the conjugated portion is a cytotoxic drug, and the conjugated portion is linked to the nanobody or its antigen-binding fragment of the present invention via a linker.

[0045] In some embodiments, the linker is a non-cleavable linker (e.g., SMCC), a disulfide linker, a hydrazone linker, or a protease-cleavable linker. In some embodiments, the protease-cleavable linker is selected from cathepsin B substrate linkers (e.g., dipeptide linkers Val-Cit, Val-Ala, or Gly-Gly-Phe-Gly), pyrophosphate diester linkers, PEG linkers, β-glucuronidase substrate linkers, β-galactosidase substrate linkers, or sulfatase substrate linkers.

[0046] In some embodiments, the cytotoxic agent is selected from: paclitaxel, tubulysins, duostatins, cytochalasin B, bacitracin D, ethidium bromide, emetine, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxydiketone anthrax, maytansin or its analogues or derivatives, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin, chachiin or its analogues or derivatives, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil), (e.g., dacrylamide, hydroxyurea, asparaginase, gemcitabine, cladribine), alkylating agents (e.g., nitrogen mustard, thiotepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, dacarbazine (DTIC), procarbazine, cisplatin and other platinum derivatives (e.g., carboplatin), docamycin A, docamycin SA, CC-1065 (also known as rachelmycin) or analogs or derivatives of CC-1065), dolalastatin, auristatin, pyrrolo[2,1-c][1,4]benzodiazepines) Drug class (PDB), indolebenzodiazepine IGN or its analogues, antibiotics (e.g., bleomycin, doxorubicin, idarubicin, sclerosomycin, mitomycin, mitoxantrone, procainamide, amycin (AMC)), antimitotic agents (e.g., tubulin targets), diphtheria toxin and related molecules (e.g., diphtheria A chain and its active fragments and hybrid molecules), ricin (e.g., ricin A or deglycosylated ricin A chain toxin), cholera toxin, shiga-like toxins (SLT-I, SLT-II, SLT-IIV), LT toxin, C3 toxin, shiga toxin, pertussis toxin, tetanus toxin, soybean bowel extract. Man-Birk protease inhibitors, Pseudomonas exotoxins, alarin, saponins, saccharin, gelanin, absinthecin A chain, saccharin A chain, α-arbusculin, tung oil protein, caryophyllin protein, American pokeweed protein (PAPI, PAPII and PAP-S), bitter melon inhibitors, jatropha toxin, croton toxin, sphagnum moss inhibitors, white tree toxin, mitogellin, localized arbusculin, phenolmycin, enoxacin toxin, antimicrobial / cleavage peptides (e.g., CLIP, Magaiin2, bee venom peptide, silkworm antimicrobial peptide and P18), ribonuclease (RNase), DNase I, staphylococcal enterotoxin-A and Pseudomonas endotoxins.

[0047] In some embodiments, the conjugate is a radionuclide drug conjugate (RDC), wherein the conjugation portion is a radionuclide, and the conjugation portion is chelated with a chelating agent and then linked to the nanobody or its antigen-binding fragment via a connector.

[0048] In some embodiments, the radionuclide is a diagnostic or therapeutic radionuclide. In some embodiments, the diagnostic radionuclide is selected from: 18 F, 67 Ga、 68 Ga、 123 I, 99m Tc, 89 Zr、 52 Mn, 15 O、 13 N、 11 C 45 Ti、 52 Fe、 59 Fe、 60 Cu、 61 Cu、 62 Cu、 64 Cu、 67 Cu、 63 Zn, 111 In、117m Sn、 153 Sm、 177 Lu、 186 Re、 188 Re、 191m Pt, 193m Pt, 195m Pt, 198 Au and 199 Au. In some embodiments, the therapeutic radionuclide is selected from: 223 Ra、 225 Ac、 90 Y、 131 I, 177 Lu、 89 Sr、 90 Sr、 212 Bi、 213 Bi、 211 At、 225 Ac、 58m Co、 60 Cu、 61 Cu、 62 Cu、 64 Cu、 67 Cu、 103m Rh、 103 Pd, 111 In、 117m Sn、 119 Sb、 153 Sm、 153 Gd, 161 Tb, 161 Ho、 166 Ho、 186 Re、 188 Re、 193m Pt, 195m Pt, 197 Pt, 198 Au、 199 Au、 201 Tl、 203 Pb and 227 Th.

[0049] In some embodiments, the chelating agent is a cyclic chelating agent or a non-cyclic chelating agent. In some embodiments, the cyclic chelating agent is selected from: 1,4,7-triazacyclononane, 1,4,7-triazacyclononane-triacetic acid, 1,4,7,10-tetraazacyclododecane, 1,4,7,10-tetraazacyclotridecane, 1,4,7,11-tetraazacyclotetradecane, 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid, 2-(1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid ... 2,2'-(1,4,7,10-tetraazacyclododecane-1,7-diyl)diacetic acid, 2,2',2'-(1,4,7,10-tetraazacyclododecane-1,4,7-triyl)triacetic acid, 1,4,8,11-tetraazacyclotetradecane, 1,4,8,12-tetraazacyclopentadecane, 1,5,9,13-tetraazacyclohexadecane, 2-(1,4,8,11-tetraazacyclotetradecane-1- 2,2'-((2-((carboxymethyl)(2-hydroxyethyl)amino)ethyl)azonyl)diacetic acid and 2,2'-(1,4,8,11-tetraazacyclotetradecane-1,8-diyl)diacetic acid. In some embodiments, the acyclic chelating agent is selected from: ethylenediaminetetraacetic acid, diethylenetriaminepentaacetic acid, 2,2'-((2-((carboxymethyl)(2-hydroxyethyl)amino)ethyl)azonyl)diacetic acid, 2,3-bis(2-mercaptoacetamido)propionic acid, 2,2',2”,2”'-(((4'-(3- Amino-4-methoxyphenyl)-[2,2':6',2”-terpyridine]-6,6”-diyl)bis(methylene))bis(azinyl))tetraacetic acid, 2,2'-((1-carboxyethyl)azinyl)diacetic acid, 2,2'-(ethane-1,2-diylbis(azinyl))bis(2-(2-hydroxyphenyl)acetic acid) and 2,2',2”,2”'-((cyclohexane-1,2-diyl)bis(azinyl))tetraacetic acid.

[0050] In some embodiments, the linker is a non-cleavable linker (e.g., SMCC), a disulfide linker, a hydrazone linker, or a protease-cleavable linker. In some embodiments, the protease-cleavable linker is selected from cathepsin B substrate linkers (e.g., dipeptide linkers Val-Cit, Val-Ala, or Gly-Gly-Phe-Gly), pyrophosphate diester linkers, PEG linkers, β-glucuronidase substrate linkers, β-galactosidase substrate linkers, or sulfatase substrate linkers.

[0051] Chimeric antigen receptor

[0052] The antibodies or antigen-binding fragments of the present invention can be used to construct chimeric antigen receptors (CARs). The CARs of the present invention are characterized by non-MHC-restricted CD70 recognition capability, which endows immune effector cells expressing the CAR (e.g., T cells, NK cells, peripheral blood monocytes, macrophages or dendritic cells) with the ability to recognize CD70-expressing cells independently of antigen processing and presentation.

[0053] Therefore, on the other hand, the present invention provides a chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a spacer domain, a transmembrane domain, and an intracellular signal transduction domain, wherein the extracellular antigen-binding domain comprises the nanobody or its antigen-binding fragment of the present invention. In some embodiments, the CAR comprises the extracellular antigen-binding domain, the spacer domain, the transmembrane domain, and the intracellular signal transduction domain from the N-terminus to the C-terminus.

[0054] 1. Extracellular antigen-binding domain

[0055] The extracellular antigen-binding domain contained in the CAR of the present invention endows the CAR with the ability to recognize CD70.

[0056] In some embodiments, the extracellular antigen-binding domain comprises a sequence shown in any one of SEQ ID NOs: 4, 7, 11, 14, 18, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids); in some embodiments, the substitution is a conservative substitution.

[0057] 2. Transmembrane domain

[0058] The transmembrane domain of the CAR of the present invention can be any protein structure known in the art, provided that it is thermodynamically stable in the cell membrane (particularly the eukaryotic cell membrane). The transmembrane domain of the CAR suitable for use in the present invention can be derived from natural sources. In such embodiments, the transmembrane domain can be derived from any membrane-bound or transmembrane protein. Alternatively, the transmembrane domain can be a synthetic, non-naturally occurring protein segment, such as a protein segment primarily containing hydrophobic residues such as leucine and valine.

[0059] In some embodiments, the transmembrane domain is a transmembrane region selected from the following proteins: CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, and combinations thereof.

[0060] In some embodiments, the transmembrane domain comprises the transmembrane region of CD28.

[0061] In some embodiments, the transmembrane domain comprises the sequence shown in SEQ ID NO:33.

[0062] 3. Spacing zone structural domain

[0063] The chimeric antigen receptor of the present invention may include a spacer domain between the extracellular antigen-binding domain and the transmembrane domain.

[0064] In some embodiments, the spacer domain comprises the CH2 and CH3 regions of an immunoglobulin (e.g., IgG1 or IgG4). In such embodiments, without being bound by any particular theory, it is assumed that CH2 and CH3 extend the antigen-binding domain of the CAR from the cell membrane of the cell expressing the CAR, and more accurately mimic the size and domain structure of the native TCR.

[0065] In some embodiments, the spacer domain comprises a hinge domain. The hinge domain can be an amino acid segment typically found between two domains of a protein, which allows the protein to be flexible and allows movement of one or both domains relative to each other. Therefore, the hinge domain can be any amino acid sequence, as long as it provides this flexibility of the extracellular antigen-binding domain and this mobility relative to the transmembrane domain.

[0066] In some embodiments, the hinge domain is a hinge region or portion thereof of a naturally occurring protein. In some embodiments, the hinge domain comprises a hinge region or portion thereof of CD8α, for example, a fragment containing at least 15 (e.g., 20, 25, 30, 35, or 40) consecutive amino acids of a CD8α hinge region. In some embodiments, the spacer domain comprises the amino acid sequence shown in SEQ ID NO:32.

[0067] 4. Intracellular signal transduction domains

[0068] In some embodiments, the intracellular signal transduction domain includes a co-stimulatory signal transduction domain and / or a primary signal transduction domain.

[0069] In this invention, the co-stimulatory signal transduction domain may be an intracellular signal transduction domain derived from a co-stimulatory molecule. In some embodiments, the co-stimulatory signal transduction domain comprises an intracellular signal transduction domain selected from the following proteins: ligands of CD27, CD28, CD137, OX40, CD30, CD40, CD3, LFA 1, ICOS, CD2, CD7, LIGHT, NKG2C, B7H3, CD83, and combinations thereof.

[0070] In some embodiments, the co-stimulatory signal transduction domain includes an intracellular signal transduction domain of CD28 and / or an intracellular signal transduction domain of CD137.

[0071] In some embodiments, the co-stimulatory signal transduction domain comprises the sequence shown in SEQ ID NO:35.

[0072] In this invention, the primary signal transduction domain can be any intracellular signal transduction domain containing an immune receptor tyrosine activation motif (ITAM). In some embodiments, the primary signal transduction domain is derived from CD3ζ. In some embodiments, the primary signal transduction domain contains the sequence shown in SEQ ID NO:34.

[0073] In some embodiments, the intracellular signal transduction domain comprises a primary signal transduction domain and at least one co-stimulatory signal transduction domain. The primary signal transduction domain and at least one co-stimulatory signal transduction domain may be connected in series to the carboxyl terminus of the transmembrane domain in any order.

[0074] 5. Signal peptides

[0075] In some embodiments, the CAR of the present invention further comprises a signal peptide at its N-terminus. Typically, a signal peptide is a polypeptide sequence to which a linked sequence is targeted to a desired site in the cell. In some embodiments, the signal peptide can target the linked CAR to the cellular secretory pathway and allow the CAR to further integrate and anchor into a lipid bilayer. Signal peptides that can be used for CARs are known to those skilled in the art. In some embodiments, the signal peptide is derived from CD8α, GM-CSF receptor α, or the IgG1 heavy chain. In some embodiments, the signal peptide comprises the sequence shown in SEQ ID NO:36.

[0076] 6. Full-length CAR

[0077] The present invention provides a chimeric antigen receptor capable of specifically binding to CD70, wherein the chimeric antigen receptor comprises, from its N-terminus to its C-terminus, a signal peptide, an extracellular antigen-binding domain, a spacer domain, a transmembrane domain, and an intracellular signal transduction domain.

[0078] In some embodiments, the signal peptide is derived from CD8α and contains the sequence shown in SEQ ID NO:36.

[0079] In some embodiments, the spacer region structural domain includes the hinge region of CD8α, comprising the sequence shown in SEQ ID NO:32.

[0080] In some embodiments, the transmembrane domain comprises a transmembrane region of CD28, including the sequence shown in SEQ ID NO:33.

[0081] In some embodiments, the intracellular signal transduction domain comprises a co-stimulatory signal transduction domain and a primary signal transduction domain, the co-stimulatory signal transduction domain being connected to the N-terminus of the primary signal transduction domain; the co-stimulatory signal transduction domain comprises an intracellular signal transduction domain of CD28, comprising the sequence shown in SEQ ID NO:35; the primary signal transduction domain is derived from CD3ζ, comprising the sequence shown in SEQ ID NO:34.

[0082] In some embodiments, the chimeric antigen receptor comprises a sequence shown in any one of SEQ ID NOs:27-31, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids) compared to it, and the sequence substantially retains at least one biological activity of the amino acid sequence from which it is derived (e.g., the ability to specifically and reactivity of immune effector cells toward cells expressing CD70 in a non-MHC-restricted manner); in some embodiments, the substitution is a conserved substitution.

[0083] Preparation of chimeric antigen receptors

[0084] Methods for generating chimeric antigen receptors and immune effector cells (e.g., T cells) containing such chimeric antigen receptors are known in the art, and detailed descriptions can be found, for example, Brentjens et al., 2010, Molecular Therapy, 18:4, 666-668; Morgan et al., 2010, Molecular Therapy, published online February 23, 2010, pp. 1-9; Till et al., 2008, Blood, 112:2261-2271; Park et al., Trends Biotechnol., 29:550-557, 2011; Grupp et al., N Engl J Med., 368:1509-1518, 2013; Han et al., J. Hematol Oncol., 6:47, 2013; PCT patent publications WO2012 / 079000, WO2013 / 126726; and US patent publication 2012 / 0213783, all of which are incorporated herein by reference in their entirety. For example, it may include introducing at least one nucleic acid molecule encoding a CAR into cells and expressing that nucleic acid molecule in the cells. For example, the nucleic acid molecule encoding the CAR of the present invention may be contained in an expression vector (e.g., a lentiviral vector) capable of expression in a host cell, such as a T cell, to manufacture the CAR.

[0085] On the other hand, the present invention provides isolated nucleic acid molecules containing nucleotide sequences encoding the chimeric antigen receptor of the present invention. In some embodiments, the isolated nucleic acid molecules encode the chimeric antigen receptor of the present invention.

[0086] Those skilled in the art will understand that, due to the degeneracy of the genetic code, the nucleotide sequence encoding a chimeric antigen receptor of the present invention can have many different sequences. Therefore, unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate forms of each other and encode the same amino acid sequence.

[0087] In some embodiments, the isolated nucleic acid molecule comprises a sequence shown in any one of SEQ ID NOs:38-42, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids) compared to it, and the sequence substantially retains at least one biological activity of the nucleotide sequence from which it is derived (e.g., the ability to encode a CAR having the ability to specifically and reactivityly direct immune effector cells to cells expressing CD70 in a non-MHC-restricted manner); in some embodiments, the substitution is a conserved substitution.

[0088] On the other hand, the present invention provides a vector containing the isolated nucleic acid molecules of the present invention. In some embodiments, the vector is a cloning vector or an expression vector.

[0089] In some embodiments, the vector contains a nucleotide sequence encoding the chimeric antigen receptor of the present invention.

[0090] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor of the present invention comprises the sequence shown in any one of SEQ ID NOs:38-42, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity compared to it, or a sequence having one or more amino acid substitutions, deletions, or additions (e.g., substitutions, deletions, or additions of 1, 2, 3, 4, or 5 amino acids) compared to it, and the sequence substantially retains at least one biological activity of the nucleotide sequence from which it is derived (e.g., the ability to encode a CAR having the ability to specifically and reactivityly direct immune effector cells to cells expressing CD70 in a non-MHC-restricted manner); in some embodiments, the substitution is a conserved substitution.

[0091] In some implementations, the vector is a viral vector.

[0092] In some implementations, the viral vector is a lentiviral vector.

[0093] Engineered immune cells and their preparation methods

[0094] On the other hand, the present invention provides engineered immune cells comprising the chimeric antigen receptor of the present invention, the isolated nucleic acid molecule of the present invention, or the vector of the present invention.

[0095] In some implementations, the engineered immune cells are human immune cells.

[0096] In some embodiments, the engineered immune cells are selected from T cells, NK cells, macrophages, peripheral blood mononuclear cells, hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, and combinations thereof.

[0097] On the other hand, the present invention provides a method for preparing engineered immune cells expressing the chimeric antigen receptor of the present invention, comprising: (1) providing immune cells; and (2) introducing an isolated nucleic acid molecule of the present invention or a vector of the present invention into the immune cells. The isolated nucleic acid molecule or vector contains a nucleotide sequence encoding the chimeric antigen receptor of the present invention.

[0098] In some implementations, the engineered immune cells are human immune cells.

[0099] In some embodiments, the engineered immune cells are selected from T cells, NK cells, macrophages, peripheral blood mononuclear cells, hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, and combinations thereof.

[0100] In some embodiments, in step (1), the immune cells are pretreated; the pretreatment includes sorting, activation, and / or proliferation of the immune cells. In some embodiments, the pretreatment includes contacting the immune cells with anti-CD3 antibodies and anti-CD28 antibodies to stimulate the immune cells and induce their proliferation, thereby generating pretreated immune cells.

[0101] In some embodiments, in step (2), the nucleic acid molecule or vector is introduced into immune cells via viral infection. In other embodiments, in step (2), the nucleic acid molecule or vector is introduced into immune cells via non-viral vector transfection, such as through transposon vector systems, CRISPR / Cas9 vectors, TALEN methods, ZFN methods, electroporation methods, calcium phosphate transfection, DEAE-glucan-mediated transfection, or microinjection.

[0102] In some implementations, after step (2), the method further includes: amplifying the engineered immune cells obtained in step (2).

[0103] Pharmaceutical Composition

[0104] On the other hand, the present invention provides pharmaceutical compositions comprising the nanobody or antigen-binding fragment thereof of the present invention, a polypeptide construct, a conjugate, a chimeric antigen receptor, an isolated nucleic acid molecule, a carrier, a host cell or an engineered immune cell; and one or more pharmaceutically acceptable excipients.

[0105] In some embodiments, the pharmaceutical composition may also contain additional antitumor drugs.

[0106] In some embodiments, the nanobody or its antigen-binding fragment, polypeptide construct, conjugate, chimeric antigen receptor, isolated nucleic acid molecule, carrier, host cell or engineered immune cell of the present invention, along with the additional antitumor drug, can be provided as separate components or as mixed components in the pharmaceutical composition. Therefore, the nanobody or its antigen-binding fragment, polypeptide construct, conjugate, chimeric antigen receptor, isolated nucleic acid molecule, carrier, host cell or engineered immune cell of the present invention, along with the additional antitumor drug, can be administered simultaneously, separately, or sequentially.

[0107] In some embodiments, the one or more pharmaceutically acceptable excipients may comprise a sterile injectable liquid (such as an aqueous or non-aqueous suspension or solution). In some exemplary embodiments, such a sterile injectable liquid is selected from water for injection (WFI), bacteriostatic water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), glucose solution (e.g., 5% glucose), solution containing surfactant (e.g., 0.01% polysorbate 20), pH buffer solution (e.g., phosphate buffer solution), Ringer's solution, and any combination thereof.

[0108] The pharmaceutical compositions of the present invention may include, in a “therapeutic effective amount” or a “preventative effective amount”, the nanobody or its antigen-binding fragment, polypeptide construct, conjugate, chimeric antigen receptor, isolated nucleic acid molecule, carrier, host cell, or engineered immune cell of the present invention. A “preventative effective amount” refers to an amount sufficient to prevent, stop, or delay the onset of a disease. A “therapeutic effective amount” refers to an amount sufficient to cure or at least partially stop the disease and its complications in a patient already suffering from the disease. Therapeutic effective amounts may vary depending on factors such as the severity of the disease to be treated, the overall state of the patient’s own immune system, the patient’s general characteristics such as age, weight, and sex, the method of administration of the drug, and other concurrent treatments, etc.

[0109] Therapeutic applications

[0110] On the other hand, the present invention provides a method for preventing and / or treating CD70-related diseases in subjects, comprising administering to subjects in need of the nanobody or antigen-binding fragment thereof, polypeptide construct, conjugate, chimeric antigen receptor, isolated nucleic acid molecule, carrier, host cell, engineered immune cell, or pharmaceutical composition of the present invention. The present invention also relates to the use of said nanobody or antigen-binding fragment thereof, polypeptide construct, conjugate, chimeric antigen receptor, isolated nucleic acid molecule, carrier, host cell, engineered immune cell, or pharmaceutical composition in the preparation of a medicament for the prevention and / or treatment of tumors or autoimmune diseases in subjects.

[0111] In some implementations, the tumor is a CD70-positive tumor.

[0112] In some implementations, the tumor is a solid tumor or a hematogenous tumor.

[0113] In some embodiments, the solid tumor is selected from renal cell carcinoma, lung cancer, glioma, nasopharyngeal carcinoma, gastric cancer, head and neck cancer, skin cancer, colorectal cancer, ovarian cancer, esophageal cancer, pancreatic cancer, cervical cancer, mesothelioma, breast cancer, colorectal cancer, or oral squamous cell carcinoma.

[0114] In some embodiments, the hematogenous tumor is selected from Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, or leukemia.

[0115] In some embodiments, the autoimmune disease is selected from arthritis, rheumatoid arthritis, psoriatic arthritis, lupus, lupus nephritis, systemic lupus erythematosus, psoriasis, vitiligo, alopecia areata, inflammatory bowel disease, ulcerative colitis, Crohn's disease, type I diabetes, multiple sclerosis, autoimmune hepatitis, primary biliary cirrhosis, celiac disease, scleroderma, Graves' disease, Hashimoto's thyroiditis, ankylosing spondylitis, myasthenia gravis, Sjögren's syndrome, IgA nephropathy, IgG4-related disease, vasculitis, ANCA-associated vasculitis, uveitis, pemphigus, bullous pemphigoid, or autoimmune hemolytic anemia.

[0116] In some implementations, the subject is a mammal, such as a human.

[0117] In some embodiments, the nanobody or its antigen-binding fragment, polypeptide construct, conjugate, chimeric antigen receptor, nucleic acid molecule, carrier, host cell, engineered immune cell or pharmaceutical composition may be used alone or in combination with other antitumor drugs.

[0118] The nanobodies or their antigen-binding fragments, polypeptide constructs, conjugates, chimeric antigen receptors, nucleic acid molecules, carriers, host cells, engineered immune cells, or pharmaceutical compositions of the present invention can be formulated into any dosage form known in the medical field, such as tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injectable solutions, sterile powders for injection, and concentrated solutions for injection), inhalers, sprays, etc. Preferred dosage forms depend on the intended route of administration and therapeutic use.

[0119] A preferred dosage form is an injection. Such injections can be sterile injectable solutions. For example, sterile injectable solutions can be prepared by incorporating an appropriate dose of the nanobody or antigen-binding fragment of the present invention, a polypeptide construct, conjugate, chimeric antigen receptor, nucleic acid molecule, carrier, host cell, engineered immune cell, or pharmaceutical composition, and optionally, simultaneously incorporating other desired components (including, but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof) into a suitable solvent, followed by sterilization by filtration. Alternatively, sterile injectable solutions can be prepared as sterile lyophilized powders (e.g., by vacuum drying or freeze-drying) for easy storage and use. Such sterile lyophilized powders can be dispersed in a suitable carrier before use, such as water for injection (WFI), antibacterial water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), glucose solution (e.g., 5% glucose), solution containing surfactant (e.g., 0.01% polysorbate 20), pH buffer solution (e.g., phosphate buffer solution), Ringer's solution, and any combination thereof.

[0120] The nanobodies or antigen-binding fragments thereof, polypeptide constructs, conjugates, chimeric antigen receptors, nucleic acid molecules, carriers, host cells, engineered immune cells, or pharmaceutical compositions of the present invention may be administered by any suitable method known in the art, including but not limited to oral, oral, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracytoplasmic reticulum groove, groin, intrabladder, topical (e.g., powder, ointment, or drops), or nasal routes. However, for many therapeutic uses, the preferred route of administration is parenteral (e.g., intravenous or bolus injection, subcutaneous injection, intraperitoneal injection, intramuscular injection). Those skilled in the art will understand that the route of administration and / or method will vary depending on the intended purpose. In some embodiments, the nanobodies or antigen-binding fragments thereof, polypeptide constructs, conjugates, chimeric antigen receptors, nucleic acid molecules, carriers, host cells, engineered immune cells, or pharmaceutical compositions of the present invention are administered by intravenous injection or bolus injection.

[0121] Terminology Definition

[0122] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as cell culture, molecular biology, biochemistry, nucleic acid chemistry, and immunology, are all conventional steps widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0123] When the terms “for example,” “such as,” “like,” “including,” “contains,” or variations thereof are used herein, these terms will not be considered restrictive terms but will be interpreted as meaning “but not limited to” or “not limited to.”

[0124] Unless otherwise specified herein or clearly contradicted by the context, the terms “an” and “a kind” as well as “the” and similar designations shall be interpreted to cover both the singular and the plural in the context of describing the invention (especially in the context of the following claims).

[0125] As used herein, the term "CD70" refers to the ligand of CD27 (TNFRSF27), a member of the tumor necrosis factor receptor (TNFR) superfamily, which regulates the activation, proliferation, and differentiation of T cells and B cells, playing a crucial role in maintaining the body's immune response. The sequence of CD70 is well known to those skilled in the art (see, for example, NCBI GENBANK database accession number: NC_000019.10).

[0126] As used herein, the term "camel-derived antibody" refers to antibodies against an antigen produced by camel-dwelling animals (including camels, alpacas, and llamas) after immunization or antigen invasion. Those skilled in the art know that among the antibodies produced by camel-dwelling animals are "camelid heavy-chain antibodies" (HCAbs) lacking the light chain; these antibodies contain only a variable domain of the heavy chain of the HCAb (V... H H) and two conventional CH2 and CH3 regions, and V was cloned and expressed separately. H The H region exhibits excellent structural stability and antigen-binding activity. V H H is the smallest known unit that can bind to a target antigen. It can exist stably on its own in vitro and is also known as a single-domain antibody (sdAb) or nanobody.

[0127] As used herein, the term "nanobody" has the meaning commonly understood by those skilled in the art as an antibody fragment consisting of a single monomeric variable antibody domain (e.g., a single heavy chain variable region), typically derived from the variable region of a heavy chain antibody (e.g., a camel antibody or a shark antibody). Typically, a nanobody consists of four framework regions and three complementarity-determining regions, having a structure of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Nanobodies can be truncated at the N-terminus or C-terminus to contain only a portion of FR1 and / or FR4, or to omit one or both of those framework regions, as long as they substantially maintain antigen binding and specificity. Nanobodies are also called single-domain antibodies (sdAbs), and the two terms are used interchangeably.

[0128] As used herein, the term "antigen-binding fragment" of a nanobody refers to a polypeptide containing a fragment of a nanobody that retains the ability to specifically bind to the same antigen bound by the nanobody, and / or competes with the nanobody for specific binding to the antigen; it is also referred to as the "antigen-binding moiety." See Fundamental Immunology, Ch. 7 (Paul, W., ed., 2nd ed., Raven Press, NY (1989)), which is incorporated herein by reference in its entirety for all purposes. The antigen-binding fragment of the antibodies of the present invention can be generated by recombinant DNA technology or by enzymatic or chemical cleavage of the nanobody of the present invention. In some embodiments, the "antigen-binding fragment" of the nanobody may be truncated at the N-terminus or C-terminus compared to the full-length nanobody to contain only a portion of FR1 and / or FR4, or lack one or both of those backbone regions, as long as it substantially retains antigen binding and specificity.

[0129] Antigen-binding fragments of nanobodies can be obtained from a given nanobody (e.g., the nanobody provided by the present invention) using conventional techniques known to those skilled in the art (e.g., recombinant DNA technology or enzymatic or chemical fragmentation methods), and the antigen-binding fragments of nanobodies can be specifically screened in the same manner as for intact nanobodies.

[0130] In this article, unless the context clearly indicates otherwise, when referring to the term "nanobody," it includes not only the complete nanobody but also the antigen-binding fragment of the nanobody.

[0131] As used herein, the term “complementarity-determining region” or “CDR” refers to the amino acid residue in the variable region of an antibody responsible for antigen binding. The nanobody contains three CDRs, named CDR1, CDR2, and CDR3. The precise boundaries of these CDRs can be defined according to various numbering systems known in the art, such as the IMGT numbering system (Lefranc et al., Dev. Comparat. Immunol. 27:55-77, 2003), the Kabat numbering system (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., 1991), or the Chothia numbering system (Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:878-883). For a given nanobody, those skilled in the art will readily identify the CDR defined by each numbering system. Furthermore, the correspondence between different numbering systems is well known to those skilled in the art (see, for example, Lefranc et al., Dev. Comparat. Immunol. 27:55-77, 2003).

[0132] As used herein, the term “framework region” or “FR” residues refer to those amino acid residues in the antibody variable region other than the CDR residues as defined above.

[0133] As used herein, the term "Fc fragment" or "Fc region" refers to a portion of the heavy chain constant region containing CH2 and CH3. The Fc fragment of an antibody has a variety of different functions but is not involved in antigen binding. "Effective functions" mediated by the Fc region include Fc receptor binding; Clq binding and complement-dependent cytotoxicity (CDC); antibody-dependent cell-mediated cytotoxicity (ADCC); phage activity; downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation. In some embodiments, the Fc region contains a hinge, CH2, and CH3. When the Fc region contains a hinge, the hinge regulates dimerization between two Fc-containing polypeptides. The Fc region can be any antibody heavy chain constant region isotype, such as IgG1, IgG2, IgG3, or IgG4.

[0134] Fc regions can include both native and variant Fc regions. Native Fc regions contain amino acid sequences identical to those found in naturally occurring Fc regions, such as the native human IgG1 Fc region (both non-A and A allotypes); the native human IgG2 Fc region; the native human IgG3 Fc region; and the native human IgG4 Fc region, as well as their naturally occurring variants. Variant Fc regions contain amino acid sequences that differ from the amino acid sequences of native Fc regions due to at least one amino acid modification. In some embodiments, variant Fc regions may possess altered effector functions compared to native Fc regions (e.g., Fc receptor binding, antibody glycosylation, number of cysteine ​​residues, effector cell function, or complement function). As used herein, the term "specific binding" refers to a non-random binding reaction between two molecules, such as the reaction between an antibody and its targeted antigen. The strength or affinity of a specific binding interaction can be expressed as the equilibrium dissociation constant (KD) of that interaction. In this invention, the term "KD" refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, which describes the binding affinity between the antibody and the antigen. The smaller the equilibrium dissociation constant, the tighter the antibody-antigen binding and the higher the affinity between the antibody and the antigen.

[0135] The specific binding properties between two molecules can be determined using methods known in the art. One method involves measuring the rate of formation and dissociation of the antigen binding site / antigen complex. Both the “binding rate constant” (ka or kon) and the “dissociation rate constant” (kdis or koff) can be calculated from the concentration and the actual rates of association and dissociation (see Malmqvist M, Nature, 1993, 361:186-187). The ratio of kdis / kon is equal to the dissociation constant KD (see Davies et al., Annual Rev Biochem, 1990; 59:439-473). The values ​​of KD, kon, and kdis can be measured using any effective method. In some embodiments, the dissociation constant can be measured in Biacore using surface plasmon resonance (SPR). Alternatively, bioluminescent interferometry or Kinexa can be used to measure the dissociation constant.

[0136] As used herein, the term "chimeric antigen receptor (CAR)" refers to a recombinant polypeptide construct comprising at least one extracellular antigen-binding domain, a spacer domain, a transmembrane domain, and an intracellular signaling domain, which combines antibody-based specificity against a target antigen (e.g., CD70) with an intracellular domain activating immune effectors to exhibit specific immune activity against cells expressing that target antigen (e.g., CD70). In this invention, the expression "CAR-expressing immune effector cell" refers to an immune effector cell that expresses a CAR and possesses antigen specificity determined by the CAR's targeting domain. Methods for manufacturing CARs (e.g., for cancer treatment) are known in the art and can be found, for example, Park et al., Trends Biotechnol., 29:550-557, 2011; Grupp et al., N Engl J Med., 368:1509-1518, 2013; Han et al., J. Hematol Oncol., 6:47, 2013; PCT patent publications WO2012 / 079000 and WO2013 / 059593; and U.S. Patent Publication 2012 / 0213783, all of which are incorporated herein by reference in their entirety. In this document, the expression "anti-CD70 CAR" refers to a CAR containing an extracellular antigen-binding domain capable of specifically binding to CD70; the expression "anti-CD70 CAR-T" refers to immune cells (e.g., PBMCs, T cells) expressing the aforementioned CAR.

[0137] As used herein, the term "extracellular antigen-binding domain" refers to a polypeptide capable of specifically binding to a target antigen or receptor. This domain will be able to interact with cell surface molecules. For example, an extracellular antigen-binding domain can be selected to recognize antigens that serve as cell surface markers associated with a specific disease state. Typically, the extracellular antigen-binding domain is an antibody-derived targeting domain.

[0138] As used herein, the term "intracellular signal transduction domain" refers to a protein portion that transduces effector signals and guides the cell to perform specific functions. Therefore, intracellular signal transduction domains have the ability to activate at least one normal effector function in CAR-expressing immune effector cells. For example, T cell effector functions could be cytolytic activity or helper activities, including cytokine secretion.

[0139] As used herein, the term "primary signal transduction domain" refers to a protein motif capable of regulating primary activation of the TCR complex in a stimulatory or inhibitory manner. Primary signal transduction domains acting in a stimulatory manner typically contain a signal transduction motif known to be an immune receptor tyrosine-based activation motif (ITAM). Non-limiting examples of such primary signal transduction domains include TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD3ζ, CD22, DAP10, CD79a, CD79b, and CD66d.

[0140] As used herein, the term "co-stimulatory signaling domain" refers to the intracellular signaling domain of a co-stimulatory molecule. A co-stimulatory molecule is a cell surface molecule, other than an antigen receptor or Fc receptor, that provides a second signal required for the efficient activation and function of T lymphocytes upon binding to an antigen. Non-limiting examples of such co-stimulatory molecules include CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD270 (HVEM), CD278 (ICOS), and DAP10.

[0141] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to: plasmids; phage particles; Cos plasmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retrotranscriptoviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomaviruses (such as SV40). A vector may contain multiple elements controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain a replication initiation site.

[0142] As used herein, the term "viral vector" is broadly used to refer to nucleic acid molecules (e.g., transfer plasmids) that typically facilitate the transfer or integration of nucleic acid molecules into the genome of a cell, or viral particles that mediate nucleic acid transfer. In addition to nucleic acids, viral particles typically include various viral components and sometimes host cell components. The term "viral vector" can refer to a virus or viral particle capable of transferring nucleic acids into a cell, or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements primarily derived from viruses.

[0143] As used herein, the term "lentiviral vector" refers to a viral vector or plasmid containing structural and functional genetic elements or portions thereof (including LTRs) primarily derived from lentiviruses. In some embodiments, the terms "lentiviral vector" and "lentiviral expression vector" may be used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles. When elements (e.g., cloning sites, promoters, regulatory elements, heterologous nucleic acids, etc.) are mentioned herein, it should be understood that the sequences of these elements are present in the lentiviral particles of the present invention in RNA form and in the DNA plasmids of the present invention in DNA form.

[0144] As used herein, the term "host cell" refers to cells that can be used to introduce a vector, including but not limited to prokaryotic cells such as *Escherichia coli* or *Bacillus subtilis*, fungal cells such as yeast cells or *Aspergillus*, insect cells such as S2 *Drosophila* cells or Sf9 cells, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK 293 cells, or human cells, as well as immune cells (such as T lymphocytes, NK cells, peripheral blood mononuclear cells, macrophages, or dendritic cells). Host cells can include single cells or cell populations.

[0145] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoIBiol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0146] As used herein, the term "conservative substitution" means an amino acid substitution that does not adversely affect or alter the intended properties of a protein / peptide containing an amino acid sequence. For example, conservative substitutions can be introduced using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitutions of amino acid residues with amino acid residues having similar side chains, such as substitutions with residues that are physically or functionally similar to the corresponding amino acid residues (e.g., having similar size, shape, charge, chemical properties, including the ability to form covalent or hydrogen bonds). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, and tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, and methionine), β-branched side chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). Therefore, it is preferable to replace the corresponding amino acid residue with another amino acid residue from the same side chain family. Methods for identifying conserved amino acid substitutions are well known in the art (see, for example, Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al., Protein Eng. 12(10):879-884 (1999); and Burks et al., Proc. Natl Acad. Set USA 94:412-417 (1997), which are incorporated herein by reference).

[0147] The twenty common amino acids mentioned in this article are written in accordance with conventional usage. See, for example, Immunology-ASynthesis (2nd Edition, E.S. Golub and D.G. Ren, Eds., Sinauer Associates, Sunderland, Mass. (1991)), which is incorporated herein by reference. In this invention, the terms “polypeptide” and “protein” have the same meaning and are used interchangeably. Furthermore, in this invention, amino acids are generally represented by single-letter and three-letter abbreviations known in the art. For example, alanine can be represented by A or Ala.

[0148] As used herein, the term "pharmaceuticalally acceptable excipient" means an excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to: pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, osmotic pressure maintainers, absorption delayers, and preservatives. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Osmotic pressure maintainers include, but are not limited to, sugars, NaCl, and their analogues. Absorption delayers include, but are not limited to, monostearates and gelatin. Diluents include, but are not limited to, water, aqueous buffer solutions (such as buffered saline), alcohols and polyols (such as glycerol).

[0149] As used herein, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease or condition or symptom (e.g., a CD70-related disease) in a subject. As used herein, the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the progression of the disease, improving or alleviating the state of the disease, and relieving symptoms (whether partial or complete), whether detectable or undetectable. Furthermore, "treatment" can also refer to prolonged survival compared to expected survival (if no treatment was received).

[0150] As used herein, the term "subject" refers to a mammal, such as a primate mammal, like a human. In some embodiments, the subject (e.g., a human) suffers from a disease related to CD70.

[0151] Beneficial effects of the invention

[0152] This invention provides a CD70-targeting nanobody or its antigen-binding fragment, and further provides a CD70-targeting chimeric antigen receptor (CAR), as well as CAR-T cells prepared based on the CD70-targeting CAR. The CAR-T cells prepared based on the CD70-targeting CAR exhibit good killing activity against CD70-positive tumor cells, but no killing activity against normal tissue cells with weak CD70 expression, and maintain high proliferative capacity and low exhaustion indicators. Therefore, the anti-CD70 nanobody and the CAR containing it of this invention have the potential for prevention and / or treatment of CD70-positive tumors and have significant clinical value.

[0153] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0154] Figure 1 : Affinity of antibodies to Raji cells.

[0155] Figure 2 : Affinity of recombinant antibody to Raji cells.

[0156] Figure 3 CAR expression in anti-CD70 CAR-T cells. NC was the negative control. Figures 4A-4F CD70 expression in different cancer cell lines; among them, Figure 4A This refers to the CD70 expression status of the U251 glioma cell line; Figure 4B This refers to the CD70 expression status of the U87 glioma cell line; Figure 4C This shows the CD70 expression status of the renal cell carcinoma line 786-0; Figure 4D This refers to the CD70 expression status of the renal cell carcinoma line ACHN; Figure 4E This shows the CD70 expression status of the Huh7 cell line; Figure 4F This shows the CD70 expression status of the 293T cell line.

[0157] Figures 5A-5C : Anti-CD70 CAR-T cell-mediated tumor cell killing effect; among which, Figure 5A It is the killing effect of CD70 CAR-T cells on renal cancer cells (786-0); Figure 5B It is the killing effect of CD70CAR-T cells on glioma cells (ACHN); Figure 5CIt is the killing effect of anti-CD70 CAR-T cells on 293T cells. Figures 5A-5C In this study, T was the negative control.

[0158] Figure 6 Schematic diagram of long-term killing effect of anti-CD70 CAR-T.

[0159] Figures 7A-7C The long-lasting killing effect of anti-CD70 CAR-T cells on 786-0 cells; among them, Figure 7A The results show the cytotoxicity of different anti-CD70CAR-T agents on 786-0 cells, with T serving as a negative control. Figure 7B The levels of PD-1 expression in 786-0 cells treated with different anti-CD70 CAR-T agents are shown; Mock T is the negative control. Figure 7C The values ​​represent the LAG-3 expression levels in 786-0 cells treated with different anti-CD70 CAR-T agents. Mock T serves as the negative control.

[0160] Figures 8A-8B : Cell subtypes of anti-CD70 CAR-T cells after stimulation with ACHN / U251 cells; among them, Figure 8A It is a cell subtype that resists CD70 CAR-T after stimulation by ACHN cells; Figure 8B It is a cell subtype that resists CD70 CAR-T after stimulation by U251 cells. Figures 8A-8B In this study, Mock T served as a negative control.

[0161] Figure 9 Animal experiments demonstrating the anti-tumor effects of anti-CD70 CAR-T. MOCK-T served as a negative control. Figures 10A-10E Detection of CD70 antigen in unactivated T cells, activated T cells, CH-A034 CAR-T cells, CH-G060 CAR-T cells, and CH-E066 CAR-T cells; among which, Figure 10A This is a detection of CD70 antigen in unactivated T cells; Figure 10B It is a CD70 antigen detection for activating T cells; Figure 10C It is the detection of CD70 antigen in CH-A034 CAR-T cells; Figure 10D It is the detection of CD70 antigen in CH-G060 CAR-T cells; Figure 10E This is a detection of CD70 antigen in CH-E066 CAR-T cells.

[0162] Sequence information

[0163] Table 1: Information about the sequences involved in this invention is described in the table below:

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170] Detailed Implementation

[0171] The invention will now be described in the following non-limiting embodiments.

[0172] Those skilled in the art will understand that the embodiments are described by way of example only and are not intended to limit the scope of protection claimed in this application. Unless otherwise specified, the experimental methods in the embodiments are conventional methods. Where specific conditions are not specified in the embodiments, they are performed according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0173] Example 1: Preparation of anti-CD70 sdAb

[0174] To develop sdAbs with high binding affinity for CD70, llamas were immunized with recombinant CD70 antigen. A phage display library was then constructed to identify V. H H leader sequence. Different clones were randomly selected and classified according to the heavy chain complementarity-determining region 3 (CDR3) (the region that plays a major role in antigen binding). An exemplary protocol is described below; other protocols for preparing sdAbs have been described. See, for example, Els Pardon et al., Nature Protocol, 2014; 9(3):674.

[0175] 1-1. Animal Immunization and Immune Response Assay

[0176] 1-1-1. Animal Immunization

[0177] An immunogen containing recombinant human CD70 protein (ACRO Biosystems, Catalog No.: CDL-H52Da) with a C-terminal Fc tag was mixed with adjuvant or PBS and injected into the llamas. The animals were immunized seven times by the service provider (Cedarline), typically with 200 μg of immunogen and CFA (complete Freund's adjuvant) each time, at intervals of approximately 1 to 2 weeks. Peripheral blood samples were collected before immunization and after the 5th and 7th immunizations. After multiple rounds of immunization, the llamas' immune response to the target antigen was assessed to confirm the antigen-specific sdAb titer. Lymphocytes were isolated from approximately 100 ml of peripheral blood by gradient centrifugation. Cells were supplemented with RNALATER™ and stored at -80°C. Serum was obtained by centrifuging anticoagulated blood samples and stored at -80°C.

[0178] 1-1-2. IgG fractionation and separation

[0179] IgG fractions were fractionated from tail-collected serum using protein G and protein A resins. 1 ml of serum sample was loaded onto a 1 ml protein G HP column and washed with 10 ml of phosphate buffer (20 mM, pH 7.0). The IgG3 fraction (MW 100,000 Da) was eluted with 0.15 M NaCl and 0.58% acetic acid (pH 3.5), and the eluent was neutralized to pH 7.4 with 1 M Tris HCl (pH 9.0). Subsequently, the IgG1 fraction (MW 170,000 Da) was eluted with 0.1 M glycine-HCl (pH 2.7), and the eluent was neutralized to pH 7.4 with 1 M Tris HCl (pH 8.5). The effluent from the protein G HP column was then loaded onto a 1 ml protein A HP column and washed with 20 ml of phosphate buffer (20 mM, pH 7.0). The IgG2 fraction (MW 100,000 Da) was eluted with 0.15 M NaCl and 0.58% acetic acid (pH 4.5), and the eluent was neutralized to pH 7.4 with 1 M Tris-HCl (pH 9.0). The concentrations of purified IgG1, IgG2, and IgG3 antibodies were determined by OD280, and their purity was assessed by reducing and non-reducing SDS-PAGE analysis.

[0180] 1-1-3. Immunological Response Assay

[0181] The immune response of llamas was assessed by ELISA, which determined the binding of serum samples and purified IgG to immobilized immunogen. Serum samples were collected before immunization, after the fifth immunization, and at tail sampling. The antigen (i.e., recombinant human antigen protein) was diluted to 4 μg / ml in coating buffer. Microtiter plates were coated with the diluted antigen overnight at 4°C. The plates were then washed three times with washing buffer and blocked at room temperature for 2 hours. The plates were then washed four times with washing buffer. A series of diluted serum or IgG were added to the plates and incubated at room temperature for 1.5 hours. The plates were then washed four times with washing buffer. HRP-conjugated anti-llama IgG secondary antibody was added to the plates and incubated at room temperature for 1 hour. After washing, TMB substrate was added to each well, incubated for 10 minutes, and then terminated with 1M HCl. For quantitative binding, the absorbance at 450 nm in each well was measured using an MK3 spectrophotometer.

[0182] 1-2.V H Construction of H phage display library

[0183] 1-2-1. RNA Extraction

[0184] Total RNA was extracted from isolated lymphocytes using reagents according to the manufacturer's protocol. The quantity and quality of total RNA were assessed by gel electrophoresis and quantified by measuring absorbance at OD260 / 280.

[0185] 1-2-2. RT-PCR and V H H amplification

[0186] Following the manufacturer's instructions, total RNA was reverse transcribed into cDNA using the PRIMESCRIPT™ First-Strand cDNA Synthesis Kit with oligo(dT)20 primers. Six forward and two reverse specific degenerate primers were designed to amplify V... H H fragments, these primers have two introduced BglI restriction sites.

[0187] The variable region (i.e., V) of heavy chain immunoglobulins was amplified using a two-step polymerase chain reaction (PCR). HH). In the first PCR, 100 ng of cDNA template was mixed with primers CALL001 (sequence: gtcctg gctgctcttctacaagg, SEQ ID NO:43) and CALL002 (sequence: ggtacgtgctgttgaa ctgttcc, SEQ ID NO:44). The DNA product from the first PCR reaction was analyzed by agarose gel electrophoresis. After gel purification, the DNA product from the first PCR was used as a template in the second PCR. The second PCR was performed using primers BACK-1 (sequence: gatgtgcagctgcaggagtctggaggagg, SEQ ID NO:45), BACK-2 (sequence: gatgtgcagctgcaggagtctgggggagg, SEQ ID NO:46), and PMCF (sequence: ctagtgcggccgctgaggagacggtgacctgggt, SEQ ID NO:47). The template containing V H The amplified second PCR product of the H PCR fragment was gel purified and enzymatically digested, and then inserted into a phage plasmid (Camed Biotechnology). The plasmid containing V... H Recombinant plasmids containing the H gene fragment were electroporated into Escherichia coli cells (Full Gold) to generate phages displaying V. H H immune library.

[0188] The PCR reaction procedure was as follows: initial denaturation at 94°C for 7 min, followed by 30 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min; and then a final extension at 72°C for 7 min.

[0189] 1-2-3. Phage Library Construction

[0190] V was obtained by amplification using different primer pairs. H H PCR products. The PCR products were then digested with BglI and purified by gel electrophoresis. The gel-purified fragments were inserted into the internal phage vector of Kanghe Research Institute. An experimental library was constructed to optimize ligation and transformation conditions. A phage library was developed using the optimized ligation and transformation conditions. A small fraction of transformed cells was diluted and streaked onto 2×YT plates supplemented with 100 μg / ml ampicillin. Colonies were counted to calculate the library size. Positive clones were randomly picked and sequenced to assess library quality. The remaining transformed cells were streaked onto YT plates supplemented with 100 μg / ml ampicillin and 2% glucose. Colony trails were scraped from the plates. A small fraction of cells was used for plasmid isolation. The remaining fraction was supplemented with glycerol and stored at -80°C as a primary culture.

[0191] 1-3. Phage Display Selection

[0192] 1-3-1. Biological Screening

[0193] Using a standard procedure developed by Kanghe Research Institute, the constructed V protein was screened against recombinant human CD70 protein and CHO cells expressing human CD70 (internal-prepared CHO-CD70 cells). H H phage library. The original library was grown to the logarithmic growth phase, then rescued with M13KO7 helper phage and amplified overnight in a shaker at 25°C. The phage was then precipitated with PEG / NaCl, resuspended in PBS, and stored at -80°C. For solid-phase panning, microplate wells were coated overnight at 4°C with recombinant human CD70 protein dissolved in PBS. For liquid-phase panning, CHO CD70 cells were blocked with blocking buffer for 1 hour at room temperature. During the coating or blocking step, phage particles were pre-incubated in the microplate wells with blocking buffer. After pre-incubation, phage particles were added to wells coated with CD70 protein or CHO-CD70 solution, respectively, and incubated for 1 hour. After incubation, unbound and non-specifically bound phages were washed away by rinsing the wells or CHO-CD70 cells six times with PBST and then twice with PBS. The bound phage particles were eluted with 100 mM triethylamine (TEA), and the eluent was neutralized with 1 M Tris-HCl (pH 7.4). Half of the eluent was then used on Escherichia coli TG1 cells (OD600 = 0.4–0.6) with an infection index growth for output titration.

[0194] 1-3-2. Phage ELISA

[0195] Phage ELISA was performed to identify target antigen-specific clones. Single exported phage clones were grown in 96-well deep-well plates and rescued overnight with M13KO7 helper phage. To identify clones bound to the antigen protein, 96-well ELISA microtiter plates were coated overnight with recombinant human CD70 protein in coating buffer at 4°C, followed by blocking with blocking buffer. After blocking, approximately 50 μl / well of phage supernatant from the overnight cell culture was added to the plate and incubated at 4°C for 1.5 h. The plate was washed four times, and HRP-conjugated anti-M13 monoclonal antibody was added to the plate and incubated at 4°C for 45 min. The plate was washed five more times, and substrate solution was added to the wells for color development. The absorbance of each well was measured at 450 nm.

[0196] To identify clones binding to CHO-CD70 cells, CHO-CD70 cells were blocked with blocking buffer for 1 hour at room temperature. After blocking, approximately 20 μl / well of phage supernatant from overnight cell culture was added to the cell solution and incubated for 1 hour at room temperature. After washing the cells four times, HRP-conjugated anti-M13 monoclonal antibody was added and incubated for 30 minutes at room temperature. The cells were washed five times, and then substrate solution was added for color development. The absorbance was measured at 450 nm. The phage ELISA results are shown in Table 2 below, indicating that five clones (C020 / P025 / A034 / G060 / E066) showed good binding to CHO-CD70. After panning, these five ELISA-positive phage clones were selected, and DNA was prepared from the exported phages using a plasmid extraction kit. The anti-CD70 antibody in the plasmid was then analyzed. H H sequencing, C020 / P025 / A034 / G060 / E066V H The amino acid sequences of H are shown in SEQ ID NOs:4, 7, 11, 14, and 18, respectively.

[0197] Table 2: Phage ELISA Results

[0198] Antibody name <![CDATA[EC 50 (nM)]]> C020 9.10 P025 12.12 A034 4.83 G060 85.89 E066 28.63

[0199] 1-3-3. Verification of the affinity between phage-expressed antibodies and Raji cells

[0200] Flow cytometry was used to further verify the cell binding of the five phage-expressed antibodies with good affinity for Raji (high CD70 expression) and one antibody without affinity for Raji (null1204) (as a negative control). The specific methods are as follows:

[0201] (1) Human Raji (ATCC) cells were obtained and the cell density was adjusted to 2 x 10⁻⁶ cells. 6 / ml, add 100μl to each well of a 96-well microplate, centrifuge at 400G for 5min, and discard the supernatant;

[0202] (2) Starting with a concentration of 400 nM, the anti-CD70 antibody was serially diluted 3-fold in PBS containing 0.1% bovine serum albumin (BSA) to a total of 8 spots. 100 μl of diluted antibody was added to each well and incubated at 4°C for 30 min.

[0203] (3) Centrifuge at 400G for 5 min, wash twice with PBS, then add 100 μl of secondary antibody (Phycoerythrin (PE) labeled goat anti-human IgG antibody, Souther Biotech, final concentration 5 μg / ml) diluted in PBS (1% BSA) to each well, and incubate at 4℃ for 30 min (protected from light).

[0204] (4) Centrifuge at 400G for 5 min, wash twice with PBS, and resuspend cells in 100 μl PBS per well. Perform flow cytometry on a CytoFlex (Beckman) system to detect PE positive signals and calculate MFI based on CytoFlex software. Calculate EC using GraphPad software. 50 value.

[0205] Test results as follows Figure 1 As shown in Table 3, all five antibodies exhibited strong affinity for Raji cells at a concentration of 250 nM, and their affinity for Raji cells gradually decreased with increasing antibody concentration.

[0206] Table 3: Affinity of antibodies to Raji cells (EC50) 50 value)

[0207] Antibody name <![CDATA[EC 50 (nM)]]> C020 3.988 P025 2.273 A034 2.176 G060 17.48 E066 8.362 null1204 NA

[0208] 1-4.V H Construction of H-hFc recombinant antibody expression vector

[0209] To verify V H Based on the affinity of the H-form candidate antibodies for the target, single-domain antibody expression vectors of the above five antibodies and recombinant protein expression vectors of the human Fc fragment were constructed. Simultaneously, a recombinant antibody expression vector for the null1204 antibody (as a negative control) and a recombinant antibody expression vector based on the P8F8 sequence disclosed in US2023 / 0041456A1 (as a standard control) were also constructed.

[0210] Constructing expression V H The expression vectors of H-Fc recombinant protein were C020-Fc, P025-Fc, A034-Fc, G060-Fc, E066-Fc, null1204-Fc (negative control), and P8F8-Fc (positive control) (amino acid sequences are shown in SEQ ID NOs:19-23, 48, and 49, respectively). In short, the pDD1 hFc vector (constructed based on the pTT5 vector, by inserting the signal peptide and hFc encoding gene) and the human IgG1 Fc encoding sequence were digested with restriction endonucleases. HThe H sequence was cloned into the genes encoding the light chain signal peptide and hFc to form a fusion expression.

[0211] 1-5.V H Expression of H-hFc recombinant antibody

[0212] (1) Pass HEK293 cells (ATCC) to the required transfection volume, and adjust the cell density to 1x10⁻¹ one day before transfection. 6 / ml;

[0213] (2) Take 3 mL of OptiMEM medium (Gibco, 31985-070) as transfection buffer, and apply it to the corresponding cells carrying V. H 30 μg of plasmid encoding the H-hFc recombinant antibody gene was mixed, filtered, and allowed to stand for 5 min.

[0214] (3) Add 90 μL of 1 mg / mL polyethyleneimine (PEI) (Polysciences, 23966) to the plasmid OptiMEM mixture, mix well, and incubate at room temperature for 15 min. Gently pour the mixture into the cells and incubate at 36.5 °C with 8% CO2.

[0215] (4) After 20 hours, add 0.6 mL of 200 g / L FEED (equal ratio of soybean peptone (BD, 211906) and plant peptone (BD, 210931)), 0.3 mL of 200 g / L glucose mother solution, and 30 μL of 2.2 M sodium valproate (VPA) (Sigma, P4543).

[0216] (5) Continue culturing until the viability is less than 60%, collect the supernatant, filter and purify by affinity chromatography.

[0217] 1-6. Protein A method for purifying V H H-hFc recombinant antibody

[0218] (1) Rinse the packing and gravity column with ultrapure water to remove the packing protective liquid;

[0219] (2) Soak the gravity column and packing material in 0.1M NaOH for 2 hours. Add 300 μL of protein A affinity chromatography medium (Mabselect sure) (GE Healthcare, 17-5438-03) to each gravity column;

[0220] (3) The cell material was centrifuged at 8000 r / min for 40 min, then filtered through a 0.45 μm filter and stored at 4℃ for later use.

[0221] (4) Rinse the gravity column and packing with a large amount of ultrapure water to remove the alkaline solution;

[0222] (5) Before purification, equilibrate the packing material with 10 ml of binding / washing buffer (20 mM Tris + 150 mM NaCl (pH 7.2));

[0223] (6) Loading the sample: Pass the supernatant that needs to be purified through the column;

[0224] (7) Washing: Rinse the packing material with 5-10 ml of binding / washing buffer (20 mM Tris + 150 mM NaCl (pH 7.2)) to remove non-specific binding proteins;

[0225] (8) Elution: Rinse the packing material with 1 mL of elution buffer (100 mM sodium citrate / citrate buffer, pH 3.5) and collect the specific binding protein;

[0226] (9) Add neutralization buffer (2M Tris) to the collected solution at a ratio of 85 μl / ml and adjust the pH to 6-7.

[0227] 1-7.V H Detection of H-hFc recombinant antibody and Raji affinity

[0228] (1) Human Raji (ATCC) cells were obtained and the cell density was adjusted to 2 x 10⁻⁶ cells. 6 / ml, 100μl per well in a 96-well microplate, centrifuged at 400G for 5min, and the supernatant was discarded;

[0229] (2) V H H-hFc antibody was started at a concentration of 400 nM and serially diluted 3-fold in PBS containing 0.1% bovine serum albumin (BSA) for a total of 12 spots. 100 μl of diluted antibody was added to each well and incubated at 4°C for 30 min.

[0230] (3) Centrifuge at 400G for 5 min, wash twice with PBS, add 100 μl of secondary antibody diluted in PBS (1% BSA) (Phycoerythrin (PE) labeled goat anti-human IgG antibody, Souther Biotech, final concentration 5 μg / ml) to each well, and incubate at 4℃ for 30 min (protected from light).

[0231] (4) Centrifuge at 400G for 5 min, wash twice with PBS, and resuspend cells in 100 μl PBS per well. Perform flow cytometry on a CytoFlex (Beckman) system to detect PE positive signals and calculate MFI based on CytoFlex software. Calculate EC using GraphPad software. 50 value.

[0232] Test results as follows Figure 2 And as shown in Table 4 below. The results in the figure show that, except for the null1204 recombinant antibody, the affinity (ECg) of other recombinant antibodies and the reference recombinant antibody to Raji cells is... 50 Both (value) have good affinity.

[0233] Table 4: Affinity of recombinant antibodies to Raji cells (EC50) 50 value)

[0234] Recombinant antibody name <![CDATA[EC 50 (nM)]]> C020-Fc 3.373 P025-Fc 2.674 A034-Fc 2.276 G060-Fc 23.83 E066-Fc 6.516 P8F8-Fc 21.25 null1204-Fc NA

[0235] Example 2: Construction of CD70 chimeric antigen receptor vector

[0236] A nucleic acid sequence encoding a CAR backbone polypeptide comprising a CD8α hinge domain, a CD28 transmembrane domain, a CD28 cytoplasmic domain, and a CD3ζ cytoplasmic domain from the N-terminus to the C-terminus was chemically synthesized and cloned downstream of a pre-modified lentiviral vector (packaging plasmids, Addgene), operably ligated to a constitutive hEF1α promoter. The resulting CAR backbone vector was named “PLV-hEF1α”. The multiple cloning site (MCS) in the vector allows the inclusion of a Kozak sequence (sequence: GCCACC, SEQ ID NO:37) operably ligated to a nucleic acid sequence encoding a CD8α signal peptide fused to a V… H The nucleic acid sequence of the N-terminus of the H fragment is inserted upstream of the PLV-hEF1α vector and operatively linked to the CAR backbone sequence.

[0237] To construct a single V using the PLV-hEF1α skeleton H A single-specific CAR in the H domain will encode V H The H-domain nucleic acid sequence was operatively linked to the 3' of the nucleic acid sequence encoding the CD8α signal peptide. The fusion nucleic acid sequence was chemically synthesized and cloned into the PCDH-hEF1α backbone using molecular cloning techniques known in the art via EcoRI and BamHI restriction sites. Table 5 lists the sequences and their composition constructed to express exemplary single-specific, monovalent anti-CD70 CARs. The vectors were transformed into DH5α *E. coli* strains, screened with ampicillin, and positive clones were obtained. Plasmids were extracted, and clones were identified by enzyme digestion, resulting in lentiviral packaging vectors including CH-C020, CH-P025, CH-A034, CH-G060, CH-E066, negative control, and positive control P8F8. The extracellular region of the negative control did not contain the antibody sequence; the sequences and composition of the other parts were identical to those of the aforementioned anti-CD70 CARs.

[0238] Table 5: Sequences and Compositions of Exemplary CARs

[0239]

[0240] Example 3: Lentiviral Preparation

[0241] 24 hours before transfection, use approximately 1×10 per bottle. 7 293T cells (ATCC) were seeded into T75 culture flasks. Lentiviral packaging was performed when the cells were at approximately 80% confluence and evenly distributed in the culture flasks.

[0242] 3-1. Prepare plasmid and transfection reagent dilution buffer

[0243] (1) Vortex the PEI 40K transfection reagent to mix well;

[0244] (2) Prepare two centrifuge tubes and prepare plasmid and transfection reagent dilution solutions in the order of Table 6 and Table 7 respectively;

[0245] Table 6: Preparation of plasmid DNA solution (centrifuge tube 1)

[0246] Components Dosage shuttle plasmid 15μg REV plasmid 5μg Gag-pol plasmid 5μg Vsvg plasmid 5μg DMEM serum-free culture medium 470μl Total volume 500μl

[0247] Table 7: Preparation of transfection reagent dilution solution (centrifuge tube 2)

[0248] Components Dosage PEI 40K transfection reagent 60μl DMEM serum-free culture medium 440μl Total volume 500μl

[0249] (3) Mix thoroughly;

[0250] (4) Add the transfection reagent dilution solution (centrifuge tube 2) to the plasmid DNA solution (centrifuge tube 1) and mix thoroughly immediately. Note that the order of addition is very important;

[0251] (5) Incubate the transfection mixture at room temperature for 15-20 minutes;

[0252] (6) Add 1 ml of transfection mixture to a 293T cell culture flask and gently pipette to mix the culture medium.

[0253] (7) Incubate at 37℃ for 6 hours;

[0254] (8) Remove the culture medium containing the transfection reagent and replace it with 20 ml of virus culture medium;

[0255] (9) Collect the cell culture supernatant 48 hours after transfection. Centrifuge at 500g for 10 min to remove cell debris. This supernatant can be used directly for lentiviral infection, or for virus titer determination or virus concentration. For long-term storage, it can be frozen at -80℃.

[0256] Example 4: Preparation of Anti CD70 CAR-T cells

[0257] 0.5 ml of blood was collected for rapid pathogen detection to exclude infections caused by HBV, HCV, HDV, HEV, HIV-1 / 2, Treponema pallidum, and parasites. Peripheral blood mononuclear cells (PBMCs) were collected from the patient using an apheresis machine. Complete growth medium was prepared, with 5% autologous AB or FBS (Gibco) and IL-2 at a concentration of 100 U / ml added to X-VIVO15 (Miltenyi). T cells were isolated from the PBMCs using a T cell sorting kit (stemcell), and their purity was determined by flow cytometry. On day 0, prepare buffer 1, add 1% FBS to PBS, and shake CD3 / CD28 microbeads (Thermo) for 30 seconds or manually shake up and down for 5 minutes. Take CD3 / CD28 beads at a 3:1 ratio of beads to T cells and place them in a 1.5 ml EP tube. Add 1 ml of buffer 1 to wash the beads, then use a magnet to remove the beads from the EP tube for 1 minute. Discard the washing solution, repeat twice, and then resuspend the beads to their original volume using culture medium. Mix the cells and beads and press at 2 × 10⁻⁶. 6 T cells / ml were added to suitable culture flasks. The next day, virus vectors (lentiviral packaging vectors expressing CH-C020, CH-P025, CH-A034, CH-G060, CH-E066, and negative or positive control P8F8, prepared in Example 2) were added at a virus vector:cel1 ratio of 3:1, along with polybrene 4 μg / ml and IL-2 100 U / ml. After 4 hours, fresh complete culture medium was added to adjust the cell density to 1 × 10⁶ cells / ml. 6 Continue culturing at 0.5-1 × 10⁹ / ml. Centrifuge all cells, add fresh culture medium, and continue culturing. Perform a half-volume medium change every 2-3 days to maintain a cell density of 0.5-1 × 10⁹ / ml. 6 / ml. Cell count reaches 10 in 10-12 days. 6 Immunocytes were centrifuged at 400g for 5 min to obtain immune cells, and then washed twice with pre-cooled PBS (400g, 5 min). CAR-T cells expressing CH-C020, CH-P025, CH-A034, CH-G060, CH-E066, negative control, or positive control P8F8 were obtained and used in subsequent examples. Cell populations and CAR-T cell proportions were detected by flow cytometry using a hemocytometer. (See [link to example]). Figure 3 CAR was well expressed (>50%) in all CAR-T cells except for the negative control.

[0258] Example 5: Screening and Detection of Engineered Cell Lines

[0259] (1) Screening cancer cell lines that may have high CD70 expression (glioma cell lines U251, U87, renal cell carcinoma cell lines 786-0, ACHN, Huh7 and 293T cells, all from ATCC) for culture;

[0260] (2) Take 20,000 cells of each type, incubate at 400g for 5 minutes, then wash twice with pre-cooled PBS. Add 2 μl of CD70 antibody (BD, PE Mouse Anti-Human CD70) to each cell, incubate in the dark for 20 minutes, centrifuge, wash once with pre-cooled PBS, resuspend the cells in 200 μl of PBS, and detect CD70 expression by flow cytometry. The detection results are as follows: Figures 4A-4F As shown, the experimental results indicate that the renal cell carcinoma lines 786-0 and ACHN highly express CD70, as do the glioma cell lines U251 and U87, which can be used as target cells for subsequent experiments. However, Huh7 and 293T cells do not express CD70 and can be used as negative controls.

[0261] Example 6: Anti-CD70 CAR-T cell-mediated tumor cell killing

[0262] (1) Place the X-VIVO serum-free cell culture medium in a 37°C water bath for incubation;

[0263] (2) Prepare 7860-luc, U251-luc and Huh7-luc cells in good condition (all from ATCC);

[0264] (3) Before plating and killing cells, transfer the culture medium of 7860-luc, U251-luc and Huh7-luc cells into 15ml centrifuge tubes, rinse the bottom of the culture flask with PBS, add an appropriate amount of 0.25% trypsin for digestion, and when the cells are suspended, use a pipette to aspirate the original cell culture supernatant and add it to the culture flask to stop digestion. After the cells are dispersed, transfer them into 15ml centrifuge tubes and centrifuge (400g, 5min) to remove the supernatant.

[0265] (4) Select the required number of wells in the 96-well cell culture plate (calculate the required number of wells based on the sample size: 10 (N=1); 10*(N-1), N>=2; N is the sample size) and add 60 μl of 7860-luc, U251-luc and Huh7-luc cells at a concentration of 3.33*105 cells / ml. This results in 20,000 target cells added to each well.

[0266] (5) Place the cell culture plate with the target cells in a 37°C, 5% CO2 incubator for 3-5 hours or overnight;

[0267] (6) The suspension concentration of the CAR-T cells to be tested was adjusted according to different positive rates and effector-to-target ratios (E:T). When the target cells were 20,000 cells and the effector-to-target ratio (E:T) was 8:1, the cell suspension concentration needed to be adjusted to (160,000 / 0.06 / positive rate) cells / ml, since the amount of culture medium added was also 60 μl. At the same time, the effector-to-target ratios of 1:1, 1:2, and 1:4 were obtained by successively half-dilution (150 μl of cell suspension + 150 μl of X-VIVO serum-free cell culture medium containing 10% FBS).

[0268] (7) Place the cell culture plate with the cells in a 37°C, 5% CO2 incubator for a period of time;

[0269] (8) Before the end of the incubation, remove the reagents from the ONE-Glo Luciferase Assay System kit from the -20°C freezer and allow them to thaw at room temperature. Dissolve the E606A powder with E605A reagent according to the instructions. After complete dissolution, dispense the solution into EP tubes and store them in the -20°C freezer. They can be taken out directly and brought to room temperature for future experiments.

[0270] (9) Turn on the multi-functional microplate reader and software, select Luminescence mode, and perform plate layout;

[0271] (10) Add 100 μl of the prepared reagent to each well of cells, mix by pipetting a few times, and place at room temperature in the dark for 10 min. Use a pipette to transfer 180 μl of the solution from the cell culture plate into a 96-well white flat-bottomed plate, avoiding the formation of air bubbles. Place the 96-well white flat-bottomed plate in a microplate reader to read the data, and export and save the data for calculating the cell killing rate. Cell killing rate = (background luminescence value - sample luminescence value) / background luminescence value * 100%;

[0272] (11) The results are as follows Figures 5A-5C As shown in the figure, the time required for CD70 CAR-T cells to achieve the same killing effect on renal cell carcinoma (786-0) and glioma cells (ACHN) decreases with the increase of effector-target ratio, and cancer cells can be almost completely eliminated in all different effector-target ratios. However, no killing effect was observed on 293T cells that do not express CD70 in the experiments at different effector-target ratios.

[0273] Example 7: Long-lasting tumor cell killing effect mediated by AntiCD70 CAR-T cells

[0274] To simulate the long-term killing effect of CAR-T cells in the tumor microenvironment and the survival and persistence of cells, the inventors conducted a long-term killing experiment using AntiCD70 CAR-T cells. A schematic diagram of the entire experiment is shown below. Figure 6 As shown.

[0275] The study consisted of two parts: a rechallenge part, in which CAR-T cells were stimulated twice a week with 786-0 cells to keep them in an activated state; and a killing assay part, in which short-acting killing was performed after each stimulation, targeting 786-0, U251, and ACHN cells, as described in Example 6. The killing ability of CAR-T cells was detected, and various CAR-T indicators, such as exhaustion indicators and cell subtypes, were evaluated. Results were as follows: Figures 7A-7C As shown, after four rounds of stimulation, CH-A034, CH-G060, and CH-E066 CAR-T cells exhibited lower PD-1 / LAG-3 expression levels and superior tumor-killing capabilities compared to other CAR-T cells. Among them, CH-E066 CAR-T showed the best tumor-killing ability, which was significantly better than that of Yangshen P8F8.

[0276] Furthermore, after stimulation with ACHN and U251 cells respectively, the Tn / Tcm ratio was higher in the CH-G060 CAR-T and CH-E066 CAR-T cell subtypes, indicating stronger survival ability. The results are as follows... Figures 8A-8B As shown.

[0277] Example 8: Animal Experiment

[0278] NCG mice (purchased from Biocytogen Biotechnology Co., Ltd.) were subcutaneously inoculated in the back with CD70-highly expressing 786-0, U251, U87, and ACHN tumor cells sequentially to construct a subcutaneous xenograft model. On days 20 and 25 post-injection, mice were divided into groups (n=5 per group) for treatment with Anti-CD70 CAR-T cells (CH-A020 CAR-T, CH-A025 CAR-T, CH-A034 CAR-T, CH-G060 CAR-T, CH-E066 CAR-T, and the positive control P8F8), a negative control mock T cell therapy, and PBS via tail vein infusion. Mice survival and tumor size were observed and recorded every 3-5 days. Results are shown below. Figure 9 As shown, combining the four tumor models, it can be seen that the tumors in the CH-E066CAR-T injection group and the CH-A034CAR-T injection group regressed the fastest, and the tumors did not recur in the end.

[0279] Example 9: CD70 expression on the surface of CAR-T cells

[0280] Because CD70 antigen is weakly expressed to varying degrees (10%-20%) on the surface of activated lymphocytes, the inventors performed CD70 antigen detection on unactivated T cells, activated T cells, CH-A034 CAR-T cells, CH-G060 CAR-T cells, and CH-E066 CAR-T cells. The detection antibody was FITC Mouse Anti-Human CD70 (Biolegend). The detection results are as follows. Figures 10A-10E As shown, unactivated T cells do not express CD70 antigen, activated T cells express CD70 antigen at low levels, and CH-A034 CAR-T cells do not express CD70, indicating that CAR-T cells undergo cannibalism during proliferation, killing off CD70-positive T cells. In contrast, CH-E066 CAR-T and CH-G060 CAR-T cells weakly express CD70 antigen, indicating a weak ability to recognize CD70. They also exhibit weak killing activity against activated T cells, low exhaustion, and long survival, while demonstrating comparable killing efficacy against CD70-highly expressing tumor cells. Therefore, CH-E066 CAR-T and CH-G060 CAR-T are safer and more effective for immunotherapy of CD70-positive tumor cells.

[0281] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. Nanobodies or antigen-binding fragments thereof that specifically bind to CD70, wherein, The nanobody or its antigen-binding fragment comprises: complementarity-determining regions CDR1, CDR2 and CDR3 in any one of the amino acid sequences shown in SEQ ID NOs:4, 7, 11, 14 and 18; Preferably, CDR1 to CDR3 are defined according to the Kabat, Chothia or IMGT numbering system.

2. A nanobody or antigen-binding fragment that specifically binds to CD70, comprising: (1) CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:2, and CDR3 shown in SEQ ID NO:3; (2) CDR1 shown in SEQ ID NO:1, CDR2 shown in SEQ ID NO:5, and CDR3 shown in SEQ ID NO:6; (3) CDR1 shown in SEQ ID NO:8, CDR2 shown in SEQ ID NO:9, and CDR3 shown in SEQ ID NO:10; (4) CDR1 shown in SEQ ID NO:8, CDR2 shown in SEQ ID NO:12, and CDR3 shown in SEQ ID NO:13; or (5) CDR1 shown in SEQ ID NO:15, CDR2 shown in SEQ ID NO:16, and CDR3 shown in SEQ ID NO:

17.

3. The nanobody or its antigen-binding fragment according to claim 1 or 2, wherein, The nanobody or its antigen-binding fragment comprises the sequence shown in any one of SEQ ID NOs:4, 7, 11, 14, 18, or a sequence having at least 80% sequence identity with it, or a sequence having one or more amino acid substitutions, deletions, or additions compared to it; preferably, the substitution is a conservative substitution.

4. A polypeptide construct that specifically binds to CD70, comprising the nanobody or its antigen-binding fragment as described in any one of claims 1-3 and the immunoglobulin Fc fragment; Preferably, the polypeptide construct further includes a signal peptide at its N-terminus; Preferably, the polypeptide construct comprises, from the N-terminus to the C-terminus, the signal peptide, the nanobody or its antigen-binding fragment, and the immunoglobulin Fc fragment; Preferably, the signal peptide is a mouse-derived light chain signal peptide (e.g., κ light chain signal peptide); Preferably, the immunoglobulin Fc segment is the Fc segment of human IgG (e.g., IgG1, IgG2, IgG3, or IgG4); Preferably, the signal peptide comprises the sequence shown in SEQ ID NO: 24; Preferably, the immunoglobulin Fc fragment comprises the sequence shown in SEQ ID NO: 25; Preferably, the polypeptide construct comprises the sequence shown in any one of SEQ ID NOs:19-23.

5. An isolated nucleic acid molecule encoding a nanobody or its antigen-binding fragment as described in any one of claims 1-3, or a polypeptide construct as described in claim 4.

6. A vector comprising the isolated nucleic acid molecule of claim 5; preferably, the vector is a cloning vector or an expression vector.

7. A host cell comprising the isolated nucleic acid molecule of claim 5, or the vector of claim 6.

8. A conjugate comprising the nanobody or its antigen-binding fragment as described in any one of claims 1-3 and a conjugated portion; Preferably, the coupling portion is selected from protein tags, such as purification tags; detectable markers, such as enzymes (e.g., horseradish peroxidase), radionuclides, fluorescent dyes, luminescent substances (e.g., chemiluminescent substances), or biotin; therapeutic agents, such as antitumor drugs or cytotoxic drugs; or other bioactive peptides. Preferably, the conjugate is an antibody-drug conjugate, wherein the conjugated portion is a cytotoxic drug, and the conjugated portion is linked to the nanobody or its antigen-binding fragment via a linker; Preferably, the conjugate is a radionuclide-conjugated drug, wherein the conjugated portion is a radionuclide, and the conjugated portion, after chelating with a chelating agent, is linked to the nanobody or its antigen-binding fragment via a connector.

9. A chimeric antigen receptor comprising an extracellular antigen-binding domain, a spacer domain, a transmembrane domain, and an intracellular signal transduction domain, wherein the extracellular antigen-binding domain comprises the nanobody or its antigen-binding fragment as described in any one of claims 1-3.

10. The chimeric antigen receptor of claim 9, further comprising a signal peptide at its N-terminus; Preferably, the signal peptide is derived from CD8α, GM-CSF receptor α, or IgG1 heavy chain; Preferably, the signal peptide comprises the sequence shown in SEQ ID NO:

36.

11. The chimeric antigen receptor of claim 9 or 10, wherein, The spacer region is selected from the hinge region and / or the CH2 and CH3 regions of immunoglobulins (e.g., IgG1 or IgG4); Preferably, the spacer region structural domain includes the hinge region of CD8α; Preferably, the spacer region structural domain comprises the sequence shown in SEQ ID NO:

32.

12. The chimeric antigen receptor according to any one of claims 9-11, wherein, The transmembrane domain is selected from the transmembrane regions of the following proteins: CD8α, CD4, CD28, CD137, CD80, CD86, CD152, PD1, and combinations thereof; Preferably, the transmembrane domain comprises the sequence shown in SEQ ID NO:

33.

13. The chimeric antigen receptor according to any one of claims 9-12, wherein, The intracellular signal transduction domain includes a co-stimulatory signal transduction domain; Preferably, the co-stimulatory signal transduction domain comprises intracellular signal transduction domains selected from the following proteins: ligands of CD27, CD28, CD137, OX40, CD30, CD40, CD3, LFA 1, ICOS, CD2, CD7, LIGHT, NKG2C, B7H3, CD83, and combinations thereof; Preferably, the co-stimulatory signal transduction domain includes an intracellular signal transduction domain of CD28 and / or an intracellular signal transduction domain of CD137; Preferably, the co-stimulatory signal transduction domain comprises the sequence shown in SEQ ID NO:

35.

14. The chimeric antigen receptor according to any one of claims 9-13, wherein, The intracellular signal transduction domain includes a primary signal transduction domain; Preferably, the primary signal transduction domain is derived from CD3ζ; Preferably, the primary signal transduction domain comprises the sequence shown in SEQ ID NO:

34.

15. The chimeric antigen receptor according to any one of claims 9-14, wherein, The chimeric antigen receptor comprises, from its N-terminus to its C-terminus, the signal peptide, the extracellular antigen-binding domain, the spacer domain, the transmembrane domain, and the intracellular signal transduction domain. Preferably, the signal peptide is derived from CD8α; Preferably, the spacer region structural domain includes the hinge region of CD8α; Preferably, the transmembrane structural domain includes the transmembrane region of CD28; Preferably, the intracellular signal transduction domain includes a co-stimulatory signal transduction domain and a primary signal transduction domain, the co-stimulatory signal transduction domain being connected to the N-terminus of the primary signal transduction domain, the co-stimulatory signal transduction domain including the intracellular signal transduction domain of CD28, and the primary signal transduction domain originating from CD3ζ; Preferably, the chimeric antigen receptor comprises the sequence shown in any one of SEQ ID NOs:27-31.

16. An isolated nucleic acid molecule encoding the chimeric antigen receptor as described in any one of claims 9-15; Preferably, the isolated nucleic acid molecule contains the sequence shown in any one of SEQ ID NOs:38-42.

17. A vector comprising the isolated nucleic acid molecule of claim 16; preferably, the vector is a cloning vector or an expression vector.

18. Engineered immune cells comprising the chimeric antigen receptor of any one of claims 9-15, the isolated nucleic acid molecule of claim 16, or the vector of claim 17; Preferably, the engineered immune cells are human immune cells; Preferably, the engineered immune cells are selected from T cells, NK cells, macrophages, peripheral blood mononuclear cells, hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, and combinations thereof.

19. A pharmaceutical composition comprising a nanobody or an antigen-binding fragment thereof as claimed in any one of claims 1-3, a polypeptide construct as claimed in claim 4, a conjugate as claimed in claim 8, a chimeric antigen receptor as claimed in any one of claims 9-15, an isolated nucleic acid molecule as claimed in claim 5 or 16, a carrier as claimed in claim 6 or 17, a host cell as claimed in claim 7 or an engineered immune cell as claimed in claim 18; and pharmaceutically acceptable excipients; Preferably, the pharmaceutical composition further comprises an additional antitumor drug.

20. Use of the nanobody or antigen-binding fragment thereof of any one of claims 1-3, the polypeptide construct of claim 4, the conjugate of claim 8, the chimeric antigen receptor of any one of claims 9-15, the isolated nucleic acid molecule of claim 5 or 16, the carrier of claim 6 or 17, the host cell of claim 7, the engineered immune cell of claim 18, or the pharmaceutical composition of claim 19 for the preparation of a medicament for the prevention and / or treatment of tumors or autoimmune diseases in a subject; Preferably, the tumor is a CD70-positive tumor; Preferably, the tumor is a solid tumor or a hematogenous tumor; Preferably, the solid tumor is selected from renal cell carcinoma, lung cancer, glioma, nasopharyngeal carcinoma, gastric cancer, head and neck cancer, skin cancer, colorectal cancer, ovarian cancer, esophageal cancer, pancreatic cancer, cervical cancer, mesothelioma, breast cancer, colorectal cancer, or oral squamous cell carcinoma. Preferably, the hematogenous tumor is selected from Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, or leukemia; Preferably, the nanobody or its antigen-binding fragment, polypeptide construct, conjugate, chimeric antigen receptor, nucleic acid molecule, carrier, host cell, engineered immune cell or pharmaceutical composition is used alone or in combination with other antitumor drugs.

Citation Information

Patent Citations

  • Anti-vascular endothelial growth factor receptor-2 chimeric antigen receptors and use of same for the treatment of cancer

    US20120213783A1

  • Chimeric antigen receptors targeting CD70

    US20230041456A1

  • Use of chimeric antigen receptor-modified t cells to treat cancer

    WO2012079000A1

  • Anti-CD22 chimeric antigen receptors

    WO2013059593A1

  • Double transgenic t cells comprising a car and a TCR and their methods of use

    WO2013126726A1