A kind of ZmARF6 protein for regulating plant nitrogen absorption, biological material and application and the method for improving plant traits

Abstract

The present application relates to the field of agricultural biotechnology, and particularly relates to a ZmARF6 protein for regulating plant nitrogen absorption, biological material and application and a method for improving plant traits. The amino acid sequence of the ZmARF6 protein is selected from any one of the following cases: 1) the amino acid sequence shown in SEQ ID NO: 1; 2) an amino acid sequence having at least 91% identity with the amino acid sequence shown in SEQ ID NO: 1; 3) a fusion polypeptide obtained by connecting a tag to the N terminal or / and C terminal of the amino acid sequence shown in SEQ ID NO: 1; 4) an amino acid sequence derived by deleting, substituting, inserting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1. The present application is suitable for ZmARF6 The overexpression material and gene editing knockout material of the gene are subjected to nitrogen absorption phenotype identification, and it is found that the overexpression material has increased lateral root elongation, enhanced low nitrogen tolerance, and higher nitrogen content and per ear grain weight.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to a ZmARF6 protein that regulates nitrogen absorption in plants, biomaterials, and methods for its application and improvement of plant traits. Background Technology

[0002] Nitrogen is a key limiting factor for plant growth and development and is essential for crop productivity. Over the past few decades, large amounts of chemical fertilizers have been applied to the field to achieve higher crop yields. However, in agro-ecosystems, nitrates, the main form in which most crop plants utilize available inorganic nitrogen, are easily dissolved and lost through leaching, leading to temporal and spatial variations in nitrate concentrations. This, in turn, exacerbates nitration, reduces nitrogen fertilizer use efficiency, and causes environmental pollution. For example, maize is one of the crops with the highest yield response to supplemental nitrogen, effectively acquiring only 25% to 50% of its nitrogen during the application season. Plant root system architecture has a significant impact on nitrogen sensing and uptake. In response to highly variable NO3 concentrations in soil over time and space, plants attempt to maximize nitrogen uptake by adjusting root architecture; plants have evolved the ability to monitor and respond to external nutrient availability. Therefore, elucidating the mechanistic framework of root development in response to nitrate concentration is a key objective for improving agricultural sustainability. Currently, omics screening combined with phenotypic validation is an effective technical means for maize genetic research.

[0003] Auxins function at every stage of root development through localization patterns and signal transduction. Nitrate supply has been shown to influence auxin accumulation and distribution to regulate root-origin development in maize, and this remodeling of root architecture promotes better plant growth while enhancing nitrogen uptake (NUE). Furthermore, extensive research has identified auxin-responsive factors (ARFs) as key regulators of auxin signaling pathways, modulating the expression of downstream auxin signaling genes to regulate growth and development. Moderate nitrate levels have been reported to promote auxin signaling and lateral root initiation through the regulatory module AtARF6, while nitrogen deficiency also activates AtARF6 to promote root hair development and nitrogen uptake. Additionally, OsARF6 has been identified as a key regulator of nitrogen uptake. However, research on the role of ZmARF6 in regulating root development is scarce, and its function in maize nitrogen uptake remains unknown. Therefore, elucidating the role of ZmARF6 in lateral root elongation and nitrogen uptake could provide excellent regulatory targets and theoretical guidance for efficient single-row cultivation of maize. Summary of the Invention

[0004] To address the above problems, this invention provides a ZmARF6 protein for regulating plant nitrogen absorption, a biomaterial, and methods for its application and improvement of plant traits.

[0005] This invention is achieved through the following technical solution:

[0006] A ZmARF6 protein that regulates nitrogen uptake in plants, wherein the amino acid sequence of the ZmARF6 protein is selected from any of the following:

[0007] 1) The amino acid sequence shown in SEQ ID NO:1.

[0008] 2) An amino acid sequence that has at least 91% identity with the amino acid sequence shown in SEQ ID NO:1.

[0009] 3) A fusion polypeptide obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:1.

[0010] 4) An amino acid sequence derived from the deletion, substitution, insertion and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO:1.

[0011] Preferably, the amino acid sequence has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:1.

[0012] SEQ ID NO:1:

[0013] MKLSPSASGGLQDQPASPEEAEEHKCLNSELWHACAGPLVSLPSVGSRVVYFPQGHGEQVAASTNKEMEAQIPNYPSLPPQLICQLHNVTMHADAETDEVYAQMTLQPLSPQELKDPFLPAELGTASNQPTNYFCKTLTASDTSTHGGFSVPRRAAEKVFPPLDFNQQPPAQELIAKDLHGNDWKFRHIFRGQPKRHLLTTGWSVFVSAKRLVAGDSVLFIWNDNNQLLLGIRRANRPQTVMPSSVLSSDSMHIGLLAAAAHAASTNSRFTIFYNPRASPCEFVIPMAKYVKAVYHTRISVGMRFRMLFETEESSVRRYMGTITGISDLDPVRWPNSHWRSVKVGWDESTAGEKQPRVSLWEIEPLTTFPMYPSPFALGLKRPWPAGLPSLYGGRGDGLTSSLMWLRDRANPGFQSLNFSGLGMSPWMQPRLDNSLLGLQSDMYQTIAAAAALQSTTKQVPPSAMQFQQPQNIADRSALLSSQILQQVQPRFQQIYPQNLNENKIQGHTQPEYLQVQQQLQRCQSFNEQKPPMHPQQQQQEPQQQQCVQTPQDQQMQEQKHLHNFHSLPDALSAFSQLSPATHSPPSALQTVPAFSHQQNFPDTNISSLSPSTGPSMHGMLGRLPSEAASSLPCVAMNAPVSVSDPWSSKRVAVESVNPCRPHVSPHIEHLDMATCNMPQSSALAPLPGRECLVDEDGCSDPQNHLLFGVHIDSHSLLMQGGIPALQNDNSSGTIPYSTSNFLSPSENDFPLNQPLRSAGCLDESDYLPCAENAEQANQQFATFVKVYKSGTVGRLLDITRFSSYDELRSEVGRLFGLEGQLEDPLRSGWQLVFVDREDDVLLVGDDPWQEFVNSVSCIKILSPEEVQRMGKPGIQLLSSAPSRRLGNGCDSYASMQEPRGLDAGMAPVGSVEF。

[0014] Preferably, the amino acid sequence shown in SEQ ID NO: 1 consists of 914 amino acid residues.

[0015] Preferably, the ZmARF6 protein is derived from corn.

[0016] Preferably, the tags include Flag tags, His tags, MBP tags, HA tags, myc tags, GST tags and / or SUMO tags.

[0017] A biomaterial, wherein the biomaterial is any one of the following:

[0018] B1) The nucleic acid molecule that encodes the ZmARF6 protein.

[0019] B2) An expression cassette containing the nucleic acid molecule described in B1).

[0020] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2).

[0021] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0022] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3).

[0023] B6) Transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3).

[0024] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3).

[0025] B8) A transgenic plant containing the nucleic acid molecule described in B1), or a transgenic plant containing the expression cassette described in B2), or a transgenic plant containing the recombinant vector described in B3).

[0026] B9) Tissue cultures produced from regenerative cells of the transgenic plant described in B8).

[0027] B10 contains protoplasts produced from the tissue cultures described above, as in B9).

[0028] B11) A recombinant vector or recombinant microorganism that inhibits the expression level of the nucleic acid molecule encoding the ZmARF6 protein, inhibits the activity of the ZmARF6 protein, and / or reduces the content of the ZmARF6 protein.

[0029] Preferably, the nucleic acid molecule encoding the ZmARF6 protein comprises a base sequence selected from the following:

[0030] E1) The base sequence shown in SEQ ID NO:2.

[0031] E2) has a base sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the base sequence shown in SEQ ID NO:2.

[0032] E3) The base sequence that hybridizes with SEQ ID NO:2 under stringent conditions; and encodes the amino acid sequence shown in SEQ ID NO:1.

[0033] E4) A base sequence derived from the base sequence shown in SEQ ID NO:2 by deletion, substitution, insertion and / or addition of one or more nucleotides.

[0034] Preferably, the base sequence has 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the base sequence shown in SEQ ID NO:2.

[0035]

[0036] Preferably, the expression cassette is a nucleic acid molecule capable of expressing the ZmARF6 protein in a host cell, and includes a promoter for initiating ZmARF6 gene transcription and a terminator for terminating ZmARF6 transcription.

[0037] Preferably, the expression box may further include an enhancer subsequence.

[0038] Preferably, the recombinant vector comprises a nucleic acid molecule encoding the ZmARF6 protein and a backbone plasmid. pBUEXUN- Myc .

[0039] The recombinant vector is constructed by amplifying the nucleic acid molecule encoding the ZmARF6 protein, recovering the PCR product, and then combining the recovered PCR product with... pBUEXUN-Myc Recombinant plasmids were obtained by ligation pBUEXUN-Myc-ZmARF6 .

[0040] Preferably, the recombinant microorganism is obtained by converting a recombinant vector into a microorganism.

[0041] Preferably, the microorganism is yeast or Agrobacterium.

[0042] Preferably, the Agrobacterium is EHA105.

[0043] Preferably, the transgenic plant organ is the root, stem, leaf, flower, fruit, or seed of the transgenic plant.

[0044] Preferably, the tissue culture may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, or anthers.

[0045] Preferably, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0046] The application of the biomaterial in regulating lateral root growth, low nitrogen tolerance, and / or grain weight per ear, wherein the application is any one of the following:

[0047] D1) Application in transgenic plants with increased lateral root elongation, enhanced tolerance to low nitrogen, and / or increased grain weight per ear.

[0048] D2) Application in products with enhanced lateral root elongation, low nitrogen tolerance, and / or increased grain weight per ear.

[0049] Application of D3 in gene knockout plants with shortened lateral roots, reduced tolerance to low nitrogen, and / or reduced grain weight per ear.

[0050] D4) Application in the preparation of gene knockout plant products with shortened lateral roots, reduced tolerance to low nitrogen and / or reduced grain weight per ear.

[0051] Application of D5 in plant breeding.

[0052] Preferably, the plant includes corn.

[0053] A method for improving plant traits involves increasing the expression level of nucleic acid molecules encoding ZmARF6 protein, the activity of ZmARF6 protein, and / or the content of ZmARF6 protein in plants to obtain improved plants, wherein the improved traits refer to promoting lateral root elongation and / or enhancing low nitrogen tolerance.

[0054] Preferably, by introducing a vector into the target plant that promotes the expression of nucleic acid molecules encoding ZmARF6 protein, the expression level, activity, and / or content of ZmARF6 protein in the plant can be increased.

[0055] Preferably, the vector for promoting the expression of nucleic acid molecules encoding ZmARF6 protein in the target plant is a DNA molecule containing the DNA molecules shown in positions 1 to 2742 of SEQ ID NO. 2. pBUEXUN-MYC Carrier.

[0056] Preferably, the vector that promotes the expression of nucleic acid molecules encoding ZmARF6 protein in the target plant is... pBUEXUN- MYC Its construction method is to... pBUEXUN-MYC The DNA fragment between the XcmI and XcmI restriction sites in the vector was replaced with the DNA fragment shown at positions 221-240 of SEQ ID NO. 2, while maintaining... pBUEXUN-MYC The other sequences of the vector remain unchanged.

[0057] Preferably, the plant is corn.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] This invention provides a ZmARF6 protein that regulates nitrogen uptake in plants. The amino acid sequence of the ZmARF6 protein is selected from any of the following: 1) the amino acid sequence shown in SEQ ID NO:1; 2) an amino acid sequence having at least 91% identity with the amino acid sequence shown in SEQ ID NO:1; 3) a fusion polypeptide obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:1; 4) an amino acid sequence derived from the deletion, substitution, insertion, and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO:1. This invention utilizes cloning maize... ZmARF6 Genes were constructed using Agrobacterium-mediated genetic transformation technology. ZmARF6We used overexpression materials and mutant materials to functionally validate ZmARF6, and for the first time discovered that the gene... ZmARF6 Overexpression in plants can promote lateral root elongation and enhance tolerance to low nitrogen, resulting in higher nitrogen content and grain weight per ear. This provides an excellent regulatory target for high-nitrogen-efficiency maize cultivation and offers a theoretical basis for the study of high-nitrogen-efficiency regulation mechanisms in maize. Attached Figure Description

[0060] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0061] Figure 1 for ZmARF6 Agarose gel electrophoresis image of the full-length PCR product of the gene.

[0062] Figure 2 35S::ZmARF6 -GFP Schematic diagram of the recombinant vector structure and subcellular localization diagram of ZmARF6 protein; Figure 2 In the given information, A is 35S::ZmARF6 -GFP Schematic diagram of the recombinant vector structure; B is the subcellular localization map of the ZmARF6 protein.

[0063] Figure 3 for ZmARF6 -Schematic diagram of His recombinant plasmid structure and Coomassie brilliant blue staining of ZmARF6-His protein; Figure 3 In the middle, A is ZmARF6 - Schematic diagram of His recombinant plasmid structure; B is a Coomassie brilliant blue staining image of ZmARF6-His protein.

[0064] Figure 4 for ZmARF6 Overexpression material identification results diagram and zmarf6 Mutant mutation type analysis diagram; Figure 4 In the middle, A is ZmARF6 Image of overexpression material identification results; B is zmarf6 Mutant mutation type analysis diagram.

[0065] Figure 5 for ZmARF6 Phenotypic diagram of overexpression materials; Figure 5 In the middle, A represents wild type and ZmARF6 Phenotypes of overexpression materials under normal nitrogen and low nitrogen treatment conditions; B represents wild type and... ZmARF6Root phenotypes of overexpression materials under normal nitrogen and low nitrogen treatment conditions; C represents wild type and ZmARF6 Total root length of overexpression materials under normal and low nitrogen treatment conditions; D represents wild type and... ZmARF6 Lateral root length of overexpression materials under normal nitrogen and low nitrogen treatment conditions; E represents wild type and... ZmARF6 Total root length of overexpression materials under normal and low nitrogen treatment conditions; F represents wild type and ZmARF6 Root surface area of ​​overexpression materials under normal nitrogen and low nitrogen treatment conditions.

[0066] Figure 6 for ZmARF6 Nitrogen content graph of overexpression materials; Figure 6 In the middle, A represents wild type and ZmARF6 Root dry weight of overexpression materials under normal nitrogen and low nitrogen treatment conditions; B represents wild-type and... ZmARF6 Dry weight of the aboveground parts of the overexpression material under normal nitrogen and low nitrogen treatment conditions; C represents wild type and ZmARF6 Root nitrogen content of overexpression materials under normal and low nitrogen treatment conditions; D represents wild type and... ZmARF6 Nitrogen content in the aboveground parts of the overexpression material under normal and low nitrogen treatment conditions; E represents wild-type and... ZmARF6 Overexpression materials under normal nitrogen and low nitrogen treatment conditions 15 N-labeled isotope content.

[0067] Figure 7 for zmarf6 Phenotypic diagram of the mutant; Figure 7 In the middle, A represents wild type and zmarf6 Phenotypes of mutant materials under normal nitrogen and low nitrogen treatment conditions; B represents wild type and... zmarf6 Root phenotypes of mutant materials under normal nitrogen and low nitrogen treatment conditions; C represents wild type and zmarf6 Total root length of mutant materials under normal nitrogen and low nitrogen treatment conditions; D represents wild type and... zmarf6 Lateral root length of mutant materials under normal nitrogen and low nitrogen treatment conditions; E represents wild type and... zmarf6 Total root length of mutant materials under normal nitrogen and low nitrogen treatment conditions; F represents wild type and... zmarf6 Root surface area of ​​mutant materials under normal nitrogen and low nitrogen treatment conditions.

[0068] Figure 8 for zmarf6 nitrogen content graph of mutants; Figure 8 In the middle, A represents wild type and zmarf6 Root dry weight of mutant materials under normal nitrogen and low nitrogen treatment conditions; B represents wild type and... zmarf6 Dry weight of the aboveground parts of the mutant material under normal nitrogen and low nitrogen treatment conditions; C represents wild type and zmarf6 Root nitrogen content of mutant materials under normal nitrogen and low nitrogen treatment conditions; D represents wild type and... zmarf6 Nitrogen content of the aboveground parts of mutant materials under normal nitrogen and low nitrogen treatment conditions; E represents wild type and... zmarf6 mutant materials under normal nitrogen and low nitrogen treatment conditions 15 N-labeled isotope content.

[0069] Figure 9 Yield of ZmARF6 transgenic material; Figure 9 In the text, A represents the wild type. zmarf6 Mutant materials and ZmARF6 Grain phenotypes of overexpressed materials under high-nitrogen and low-nitrogen treatment conditions; A represents wild-type, zmarf6 Mutant materials and ZmARF6 The spike phenotype of the overexpression material under high nitrogen and low nitrogen treatment conditions; C represents wild type, zmarf6 Mutant materials and ZmARF6 Yield per spike of overexpression material under high-nitrogen and low-nitrogen treatment conditions. Detailed Implementation

[0070] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0071] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0072] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0073] This invention uses the maize variety “B73-329” from the Crop Functional Genomics Platform and Molecular Breeding Research Center of China Agricultural University.

[0074] All primer sequences in this invention are 5'-3'.

[0075] Example 1

[0076] Discovery and Cloning of ZmARF6 Protein and its Encoding Gene

[0077] I. Discovery of ZmARF6 protein and its encoding gene

[0078] Genes related to the root transcriptome under nitrogen treatment were screened, and a target protein was obtained by searching the maize database. This protein was named ZmARF6, and its amino acid sequence, as shown in SEQ ID NO:1, consists of 914 amino acid residues. The gene encoding ZmARF6 was named... ZmARF6 Genes, the ones mentioned ZmARF6 The open reading frame of the gene, as shown in SEQ ID NO:2, consists of 2745 nucleotides.

[0079] two, ZmARF6 Cloning of genes

[0080] Template acquisition: RNA was extracted from maize leaves using the Adley kit (purchased from Beijing Adley Biotechnology Co., Ltd., extraction was performed according to the provided instructions). First-strand cDNA was synthesized using the M-MLV reverse transcription kit (purchased from Takara, performed according to the kit instructions). The obtained first-strand cDNA was used as a template for amplification. ZmARF6 Full-length gene.

[0081] Primer design: based on ZmARF6 Gene sequence was obtained, and two specific primers (upstream primer F1 as shown in SEQ ID NO:3, namely: CAAATCGACTCTAGAAAGCTTAGAATGAAGCTCTCGCCG and downstream primer R1 as shown in SEQ ID NO:4, namely: GCCCTTGCTCACCATGGTACCGAACTCGACCGAACCCAC) were designed for PCR amplification to obtain PCR products.

[0082] PCR amplification and recovery: Amplification was performed using Novizan's Planta® Max Super-Fidelity DNA Polymerase kit. ZmARF6 Full-length gene. Each 10 μL PCR reaction mixture included: 5 μL 2×PhantaMax Buffer, 0.2 μL dNTPMix (10 mM), 0.4 μL cDNA, 0.2 μL PhantaMax Super-Fidelity DNA Polymerase, 0.4 μL upstream primer, 0.4 μL downstream primer, and 3.4 μL ddH2O. The PCR amplification program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 1 min 30 s, 35 cycles; 72℃ for 5 min. The PCR products were electrophoresed on a 1.5% agarose gel as follows: Figure 1As shown. After electrophoresis, the target band was cut under UV light and recovered and purified using an agarose gel DNA recovery kit (purchased from Adley Biotechnology Co., Ltd., and the operation steps were in accordance with the kit's instruction manual).

[0083] Vector ligation, transformation, and identification: The recovered fragment was recombinated and ligated into the pSuper1300-GFP vector. A 10 μL recombination reaction mixture was prepared as follows: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] ZmARF6 1 μL of gene fragment, 3 μL of pSuper1300-GFP (digested), 2 μL of 5X CEII Buffer, 1 μL of Exnase® II, and ddH2O were added to a final volume of 10 μL; ligation was performed at 37℃ for 30 min. 5 μL of the ligation product was then transformed into *E. coli* DH5α using the heat shock method (competent cells purchased from Beijing Jinsha Biotechnology Co., Ltd.; the procedure was performed according to the instruction manual). Positive clones were screened on LB agar plates containing 50 mg / L ampicillin, and two clones were selected for sequencing (sequencing was performed by Beijing BGI Sequencing Co., Ltd.) to obtain the desired full-length gene CDS. ZmARF6 Gene. Sequencing results showed that the gene sequence was 2742 bp in length, encoding a complete ORF reading frame of 914 amino acids.

[0084] Example 2

[0085] ZmARF6 protein characterization analysis

[0086] I. Subcellular localization of ZmARF6

[0087] Protoplasts were used to study the subcellular localization of the ZmARF6 protein. The expression vector constructed above was used... pSuper1300-ZmARF6 - GFP Conduct experiments.

[0088] The methods for isolating and transforming maize protoplasts are as follows:

[0089] Maize protoplast isolation (Cellulase R10 and Macerozyme R10 were purchased from Onozuka, and other reagents were purchased from Sigma-Aldrich).

[0090] Enzymatic hydrolysate (10 mL): 1% Cellulase R10, 0.2% Macerozyme R10, 0.4 M mannitol, 20 mM MCl, 20 mM MES pH 5.7, 10 mM CaCl2.

[0091] WI solution: 20mM KCl, 0.5M mannitol, 4mM MES, pH 5.7.

[0092] W5 solution: 125mM CaCl2, 154mM NaCl, 5mM KCl, 2mM MES, pH 5.7.

[0093] MMg solution: 0.4M mannitol, 15mM MgCl2, 4mM MES, pH 5.7.

[0094] 40% (w / v) PEG conversion solution: 0.2M mannitol, 100mM CaCl2, 4g PEG 4000.

[0095] (1) Select healthy corn seedlings with two leaves and no damage to the leaves. Take the middle 8cm of the second leaf, remove the veins and cut it into strips 1mm wide. Put it into the enzymatic hydrolysis solution, vacuum for 30min, and then put it into a shaker at 28℃ at 45rpm for 4h until the enzymatic hydrolysis is complete.

[0096] (2) Rinse the enzymatically digested leaves with an equal volume of W5 solution, filter using a 400-mesh filter membrane, collect the protoplast solution in a round-bottom centrifuge tube, centrifuge at 700 rpm for 2 min, and carefully aspirate the supernatant.

[0097] (3) Add 5 mL of W5 to gently resuspend the protoplasts, centrifuge at 700 rpm for 2 min, and carefully aspirate the supernatant.

[0098] (4) Add 5 mL of W5 solution to gently resuspend the protoplasts, aspirate the resuspended droplet into a cell counter for counting, determine the subsequent MMG resuspended volume based on the counting results, incubate on ice for 30 min, centrifuge at 600 rpm for 3 min, and aspirate the supernatant.

[0099] (5) Add MMG solution to adjust the protoplast concentration to a suitable level.

[0100] (6) Take 100 μL of protoplasts and add them to a 2 mL round-bottom centrifuge tube. Add 2 μg of plasmid and add 110 μL of PEG solution in two portions. Quickly and gently mix the solutions and transform for 5 min.

[0101] (7) Then add 800 mL of W5 solution, mix by inverting horizontally, centrifuge at 700 rpm for 2 min, and aspirate the supernatant.

[0102] (8) Add 200 μL of WI solution, gently mix the protoplasts, and incubate at room temperature in the dark for 16 h.

[0103] (9) Use a pipette tip with the tip cut off to pick up a small amount of protoplasts and drop them onto a glass slide. Observe the expression of GFP under a laser confocal microscope.

[0104] The results showed that the GFP control plasmid exhibited GFP green fluorescence signals in protoplast chloroplasts, cell nuclei, and cytoplasm; while ZmARF6 showed GFP green fluorescence signals only in the cell nucleus. ZmARF6 was localized in the cell nucleus... Figure 2 As shown in B.

[0105] II. Purification of ZmARF6 protein

[0106] F-His, as shown in SEQ ID NO:5, is: GCTGATATCGGATCCGAATTCATGAAGCTCTCGCCGTC.

[0107] R-His, as shown in SEQ ID NO:6, is: GTGGTGGTGGTGGTGCTCGAGGAACTCGACCGAACCCAC.

[0108] Vector construction: based on the one obtained in Example 1 ZmARF6 Using the gene as a template, PCR amplification was performed using upstream primer F-His and downstream primer R-His to obtain a gene containing... ZmARF6 The product of the gene and vector homologous arms; the vector was digested with EcoRI and XhoI enzymes. pET-32a The purified product yields gene fragments and linear vectors; the gene fragments and linear vectors are then ligated to obtain... pET- 32a-ZmARF6 Recombinant plasmids such as Figure 3 As shown in A, it is about to pET-32a The DNA fragment between the EcoRI and XhoI restriction sites was replaced with SEQ ID NO:2. ZmARF6 Genes and maintain pET-32a The recombinant plasmid was obtained by keeping the other sequences unchanged.

[0109] Cell induction: pET-32a-ZmARF6 Recombinant plasmids were transformed into E. coli using the heat shock transformation method. BL21 After overnight incubation at 37°C, positive single clones were picked and inoculated into 4 mL of LB liquid medium containing antibiotics, and incubated overnight at 37°C and 200 rpm. The bacterial culture was then inoculated into 100 mL of LB liquid medium containing antibiotics and incubated at 37°C and 200 rpm until OD (Organic Depth) was reached. 600 The concentration was 0.8. The bacterial culture was transferred to a 16°C shaker, cooled for about 15 minutes, and then IPTG was added to a final concentration of 0.2 mM. The culture was then induced overnight at 16°C and 130 rpm.

[0110] His protein purification: The protein purification process is performed according to the following steps.

[0111] (1) Take 150 mL of bacterial culture after prokaryotic induction expression and centrifuge at 8000 rpm for 15 min at 4℃ to collect bacteria.

[0112] (2) Add 25 mL of Lysis Buffer (containing 250 μL 0.1 M PMSF and 25 μL 0.1 M lysozyme) to the bacterial cells, vortex to resuspend the bacterial cells, and let them stand on ice for 15 min. Then, resuspend the bacterial cells again and sonicate them (set the sonicator power to 50%, sonicate for 5 s, stop for 5 s). Stop sonicating when the bacterial cells are clear.

[0113] (3) Centrifuge at 8000 rpm for 10 min at 4℃, take the supernatant and centrifuge again.

[0114] (4) Add 300 μl His-Beads to the protein purification column, and add 5 mL Lysis Buffer each time. The liquid flows down by gravity. Repeat three times to complete the washing of the purification column.

[0115] (5) Load the supernatant from (3) onto the column. After all the supernatant has passed through the column, add 5 mL of Lysis Buffer to wash the column and repeat once. Then add 5 mL of Washing Buffer to wash the column and repeat once.

[0116] (6) After all the washing buffer has flowed out, add 0.15 mL of His-Elution buffer and pass it through the column. Let the first two drops of effluent flow out freely. The liquid flowing out of the column thereafter is the His protein solution. The collected solution is recorded as E1. Repeat the process by adding the same amount of His-Elution buffer. Collect all the effluent protein solution and record the collected solutions as E2, E3, and E4, respectively.

[0117] (7) The protein purification solutions E1-E4 were tested for protein concentration and Coomassie brilliant blue staining to determine the purification results. The proteins were aliquoted and stored at -80℃. The obtained protein supernatant was stained with Coomassie brilliant blue.

[0118] The constructed vector and Coomassie brilliant blue staining results are shown in the figure. Figure 3 As shown in A and 3B.

[0119] Example 3

[0120] Nitrogen stress phenotype of transgenic materials

[0121] I. Construction and Transformation of Transgenic Vectors

[0122] For overexpression vectors:

[0123] Step 1: Extract total RNA from leaves of maize variety “B73-329” and reverse transcribe it into cDNA.

[0124] Step 2: Using the cDNA obtained in Step 1 as a template, PCR amplification was performed using the primer pair composed of F3 and R3 to obtain the PCR amplification product, which was then purified and recovered as shown. The primer pair composed of F-Myc and R-Myc is shown below:

[0125] F-Myc, as shown in SEQ ID NO:7, is: CTGAAGAAGATCTTCCAATACTTGTATGGATGAAGCTCTCGCCGTCGGCCA.

[0126] R-Myc, as shown in SEQ ID NO:8, is: ATTCGGATCCCCAATACTTGTATGGTCAGAACTCGACCGAACCCA.

[0127] Step 3: Double digest with restriction endonucleases XcmI and XcmI pBUEXUN-Myc Carrier recycling carrier skeleton.

[0128] Step 4: Connect the recovered product from Step 2 with the vector backbone from Step 3 to obtain the recombinant plasmid. pBUEXUN-Myc- ZmARF6. For recombinant plasmids pBUEXUN-Myc-ZmARF6 Sequencing verification showed that the recombinant plasmid... pBUEXUN-Myc- ZmARF6 To be pBUEXUN-Myc The DNA fragment between the XcmI and XcmI restriction sites in the vector is replaced with the fragment shown in positions 1-2742 of SEQ ID NO:2. ZmARF6 After the gene fragment, and maintain pBUEXUN-Myc The vector is obtained by keeping the other sequences of the vector unchanged.

[0129] For gene knockout vectors:

[0130] Step 1: Design CRISPR target primers:

[0131] F-CRISPR, as shown in SEQ ID NO:9, is: GGCGACTATCCTAGTCTACCTCCG.

[0132] R-CRISPR, as shown in SEQ ID NO:10, is: AAACCGGAGGTAGACTAGGATAGT.

[0133] The primers were annealed using a touch-down procedure to obtain ligation fragments.

[0134] Step 3: Digest with restriction endonucleases BsaI and BsaI. pBUE411-BG Carrier recycling carrier skeleton.

[0135] Step 4: Connect the recovered product from Step 2 with the vector backbone from Step 3 to obtain the recombinant plasmid. pBUE411-BG- ZmARF6. For recombinant plasmids pBUE411-BG-ZmARF6 Sequencing verification showed that the recombinant plasmid... pBUE411-BG- ZmARF6 To be pBUE411-BG The DNA fragment between the BsaI and BsaI restriction sites in the vector is replaced with the fragment shown in positions 221-240 of SEQ ID NO:2. ZmARF6 After the gene fragment, and maintain pBUE411-BG The vector is obtained by keeping the other sequences of the vector unchanged.

[0136] Transgenic material conversion

[0137] Will pBUE411-BG-ZmARF6 and pBUEXUN-Myc-ZmARF6 Recombinant bacteria were obtained by chemically transforming Agrobacterium EHA105. pBUE411-BG-ZmARF6 / EHA105 and pBUEXUN-Myc-ZmARF6 / EHA105 was cultured in YEP liquid medium at 28℃ for 14 h, and the recombinant bacteria were collected when the OD=0.8. pBUE411-BG-ZmARF6 / EHA105 and pBUEXUN-Myc- ZmARF6 / EHA105 was used for maize endosperm transformation and transgenic material screening to obtain homozygous plants.

[0138] II. Identification of Genetically Modified Materials

[0139] for ZmARF6 Overexpression transgenic material: DNA was extracted from T2 generation plants and amplified by PCR using universal primers for the overexpression vector (F-Ubi as shown in SEQ ID NO:11: TTTTAGCCCTGCCTTCATACGC; R-Nos as shown in SEQ ID NO:12: AGACCGGCAACAGGATTCAATC). Positive bands were sequenced and the inserted DNA fragment was compared. Positive plants were retained, self-pollinated, and seeds were harvested. T3 generation plants were then tested. If all T3 generation plants were positive, the T2 plant was considered a homozygous overexpression material at the DNA level. RNA was also extracted and analyzed by quantitative real-time PCR (primers F-OE as shown in SEQ ID NO:13: AGATGACACTCCAGCCACTC; R-OE as shown in SEQ ID NO:14: GGAAACACCTTCTCAGCTGCTCG) with the wild type as a control. If the expression level of the overexpression line was significantly increased, the plant was considered a homozygous overexpression material at the RNA level.

[0140] for ZmARF6Gene knockout (CRISPR-Cas9) mutants: Primers were set 300 bp upstream and downstream of the editing target site. After extracting leaf DNA, the DNA was amplified using primers and sequenced. The sequence differences between the mutants and wild-type mutants were compared. Double-stranded homozygous knockout plants were retained and self-pollinated again to obtain seeds for subsequent experimental analysis.

[0141] The identification results are as follows Figure 4 As shown in A and 4B.

[0142] Example 4

[0143] ZmARF6 Positive regulation of low nitrogen tolerance

[0144] one, ZmARF6 Overexpression plants showed tolerance to low nitrogen stress

[0145] Obtained through genetic transformation ZmARF6 Overexpressing plants and control plants (B73-329) were cultured in hydroponics under low nitrogen (0.05 mM NO3) conditions. - ) and normal nitrogen (2mM NO3) - )deal with, ZmARF6 Overexpressing plants were more tolerant of low nitrogen stress compared to control plants. The plants obtained in step two... ZmARF6 Overexpressing plants and control plants (B73-329) were cultured in hydroponics with low nitrogen (0.05 mM NO3). - ) and normal nitrogen (2mM NO3) - Process, cut separately ZmARF6 The taproots of overexpressing plants and control plants (B73-329) were scanned using a root scanner to obtain root architecture photographs. Taproot length and average lateral root length were measured using a ruler; total root length and root surface area were statistically analyzed using WinRHIZO software. The results showed that... ZmARF6 Compared to control plants (B73-329), overexpressing plants had a more robust root architecture, such as... Figure 5 .

[0146] two, ZmARF6 Nitrogen content determination in overexpressing plants

[0147] The result obtained in step two ZmARF6 Overexpressing plants and control plants (B73-329) were cultured in hydroponics with low nitrogen (0.05 mM NO3). - ) and normal nitrogen (2mM NO3) -For the treatment, five uniformly growing maize seedlings were selected, and their above-ground and underground parts were cut apart, separating the stems and roots and placing them separately into sampling bags. The samples were then heated at 105℃ for 0.5 hours, followed by drying at 75℃ for 5 days. The biomass accumulation was obtained by weighing the samples. The dried plant samples were then ground and sieved through a 100-mesh sieve. 20 mg of the sieved powder was weighed, wrapped in a tin boat, and then placed in an elemental analyzer for determination. The final nitrogen content (mg / g) of the plant sample was obtained. Total nitrogen (mg) = nitrogen concentration (mg / g) × plant biomass (g). 15 In the nitrogen transient absorption experiment, maize seedlings treated with nitrogen for 3 days were placed in a 0.1 mM CaSO4 solution to equilibrate for 1 min, and then transferred to a solution containing 0.05 mM and 2 mM Ca(II)2. 15 NO3) 2 Place the roots in a 99% atom solution for 10 minutes. Then rinse the roots in a 0.1 mM CaSO4 solution for 1 minute to remove residual Ca(OH)2. 15 NO3) 2 Before sampling, the root surface moisture was blotted dry with absorbent paper and then placed in a 120℃ oven for 30 minutes, followed by 65℃ for 72 hours. After drying, the samples were ground and passed through a 100-mesh sieve. The plant sample powder was analyzed using isotope ratio mass spectrometry (DELTA™ Q, Thermo Scientific, USA). 15 Nitrogen content determination.

[0148] The results showed that ZmARF6 Compared to the control plants (B73-329), the overexpressing plants had higher nitrogen content, such as Figure 6 .

[0149] three, zmarf6 The mutant plants are sensitive to low nitrogen stress.

[0150] Obtained through genetic transformation ZmARF6 Gene knockout zmarf6 The mutant pure line and control plants (B73-329) were hydroponically cultured under low nitrogen (0.05 mM NO3) conditions. - ) and normal nitrogen (2mM NO3) - ) processing, discovery zmarf6 The mutant was more sensitive to low nitrogen stress compared to the control plants. For those identified as homozygous... ZmARF6 Overexpressing plants and control plants (B73-329) were cultured in hydroponics under low nitrogen (0.05 mM NO3) conditions. - ) and normal nitrogen (2mM NO3) - Process, cut separately ZmARF6The taproots of overexpressing plants and control plants (B73-329) were scanned using a root scanner to obtain root architecture photographs. Taproot length and average lateral root length were measured using a ruler; total root length and root surface area were statistically analyzed using WinRHIZO software. The results showed that... ZmARF6 Compared to the control plants (B73-329), the overexpressing plants had a more robust root architecture, as shown in the results. Figure 7 As shown.

[0151] Four, zmarf6 Nitrogen content determination of mutants

[0152] For those already identified as homozygous zmarf6 The mutant pure line and control plants (B73-329) were hydroponically cultured under low nitrogen (0.05 mM NO3) conditions. - ) and normal nitrogen (2mM NO3) - For the treatment, five uniformly growing maize seedlings were selected, and their above-ground and underground parts were cut apart, separating the stems and roots and placing them separately into sampling bags. The samples were then heated at 105℃ for 0.5 hours, followed by drying at 75℃ for 5 days. The biomass accumulation was obtained by weighing the samples. The dried plant samples were then ground and sieved through a 100-mesh sieve. 20 mg of the sieved powder was weighed, wrapped in a tin boat, and then placed in an elemental analyzer for determination. The final nitrogen content (mg / g) of the plant sample was obtained. Total nitrogen (mg) = nitrogen concentration (mg / g) × plant biomass (g). 15 In the nitrogen transient absorption experiment, maize seedlings treated with nitrogen for 3 days were placed in a 0.1 mM CaSO4 solution to equilibrate for 1 min, and then transferred to a solution containing 0.05 mM and 2 mM Ca(II)2. 15 Place the roots in a 99% atom (NO3)2 solution for 10 minutes. Then rinse the roots in a 0.1 mM CaSO4 solution for 1 minute to remove residual Ca(NO3)2. 15 NO3) 2. When sampling, the root surface moisture was blotted dry with absorbent paper and then placed in a 120℃ oven for 30 minutes, followed by 65℃ for 72 hours. After drying, the sample was ground and passed through a 100-mesh sieve. The plant sample powder was analyzed using isotope ratio mass spectrometry (DELTA™ Q, Thermo Scientific, USA). 15 Nitrogen content determination.

[0153] The results showed that zmarf6 The mutant had a lower nitrogen content than the control plant (B73-329). Figure 8 .

[0154] Example 5

[0155] ZmARF6 positively regulates nitrogen uptake and yield in plants.

[0156] ZmARF6 positively regulates plant yield.

[0157] For those already identified as homozygous ZmARF6 Overexpressing plants and control plants (B73-329) were subjected to low nitrogen (0 kg N / ha) and high nitrogen (225 kg N / ha) treatments in the field. For yield determination experiments, the low nitrogen (0 kg N / ha) and high nitrogen (225 kg N / ha) treatments were applied. At maturity, 30 maize plants with uniform growth were selected, and the ears were photographed to observe the phenotype and the weight of each ear was measured.

[0158] The results showed that ZmARF6 The overexpressing plants had higher nitrogen content and grain weight per ear compared to the control plants (B73-329). zmarf6 The mutant plants had lower nitrogen content and lower grain weight per ear compared to the control plants (B73-329). Figure 9 As shown.

[0159] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0160] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The application of ZmARF6-related biomaterials in regulating lateral root growth, low nitrogen tolerance, and / or grain weight per ear in plants, characterized in that, The biomaterial is any one of the following: B1) ZmARF6 protein; the amino acid sequence of the ZmARF6 protein is shown in SEQ ID NO:1, or is a fusion polypeptide obtained by attaching a tag to the N-terminus and / or C-terminus of the sequence shown in SEQ ID NO:1; B2) A nucleic acid molecule encoding the ZmARF6 protein; the base sequence of the nucleic acid molecule is as shown in SEQ ID NO:2, or is a sequence that hybridizes to the sequence shown in SEQ ID NO:2 under stringent conditions and encodes the amino acid sequence shown in SEQ ID NO:1; B3) An expression cassette containing the nucleic acid molecule described in B2); B4) A recombinant vector containing the nucleic acid molecule described in B2), or a recombinant vector containing the expression cassette described in B3); B5) Recombinant microorganisms containing the nucleic acid molecules described in B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4); B6) A transgenic plant cell line containing the nucleic acid molecule described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7) Transgenic plant tissue containing the nucleic acid molecules described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8) A transgenic plant organ containing the nucleic acid molecule described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4); B9) A transgenic plant containing the nucleic acid molecule described in B2), or a transgenic plant containing the expression cassette described in B3), or a transgenic plant containing the recombinant vector described in B4); B10) Tissue cultures produced from regenerative cells of the transgenic plant described in B9); B11) contains protoplasts produced from the tissue culture described in B10); The application can be any of the following: D1) Application in transgenic plants with lateral root elongation, enhanced low nitrogen tolerance, and / or increased grain weight per ear; D2) Application in products with increased lateral root elongation, enhanced low nitrogen tolerance, and / or increased grain weight per ear; The plant in question is corn.

2. The ZmARF6 protein as described in claim 1, characterized in that, The tags include Flag, His, MBP, HA, myc, GST and / or SUMO tags.

3. The biomaterial as described in claim 1, characterized in that, The recombinant vector contains a nucleic acid molecule encoding the ZmARF6 protein and a backbone plasmid; The recombinant vector is constructed by amplifying a nucleic acid molecule encoding the ZmARF6 protein, recovering the PCR product, and ligating the recovered PCR product with a backbone plasmid to obtain the recombinant vector.

4. The biomaterial as described in claim 1, characterized in that, The recombinant microorganisms mentioned are obtained by converting a recombinant vector into microorganisms.

5. The biomaterial as described in claim 4, characterized in that, The microorganisms mentioned are yeast or Agrobacterium.

6. A method for improving plant traits, characterized in that, An improved plant was obtained by increasing the expression level of nucleic acid molecules encoding ZmARF6 protein, the activity of ZmARF6 protein, and / or the content of ZmARF6 protein in a plant. The improved trait refers to promoting lateral root elongation and / or enhancing low nitrogen tolerance. The plant is maize. The amino acid sequence of the ZmARF6 protein is shown in SEQ ID NO:1.

Images