A kit for assessing the progression of cholangiocarcinoma based on the CCNE1 gene.

The fluorescent labeling detection kit based on the CCNE1 gene has solved the problem of the lack of efficient assessment tools in the diagnosis and treatment of cholangiocarcinoma, and has enabled accurate assessment of the malignancy, metastatic potential and prognosis of cholangiocarcinoma, thereby improving the specificity and sensitivity of diagnosis and treatment.

CN120866528BActive Publication Date: 2026-01-30ZHEJIANG CANCER HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511370550.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-24
Publication Date
2026-01-30
Estimated Expiration
2045-09-24

AI Technical Summary

Technical Problem

Current technologies lack efficient and specific tools to assess the malignancy, metastatic potential, and patient prognosis of cholangiocarcinoma, leading to diagnostic difficulties and inadequate treatment strategies.

Method used

To develop a fluorescent labeling detection kit based on the CCNE1 gene, and to assess the malignancy, metastatic potential and prognosis of cholangiocarcinoma by constructing specific fluorescent probes, including the design and preparation of specific fluorescent probes and detection buffer systems.

Benefits of technology

It provides an efficient and specific assessment tool that can accurately reflect the CCNE1 gene expression level, stabilize the detection process, make up for the lack of specificity and sensitivity of existing diagnostic methods, and support the reliable assessment of cholangiocarcinoma progression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866528B_ABST
    Figure CN120866528B_ABST
Patent Text Reader

Abstract

This invention discloses a kit for assessing the progression of cholangiocarcinoma based on the CCNE1 gene, belonging to the field of biomedical detection technology, and is used to assess the progression of cholangiocarcinoma. The kit includes a specific fluorescent probe, hybridization buffer, washing buffer, positive control, DAPI staining solution, and an anti-fluorescence quencher. The specific fluorescent probe is formed by coupling a fluorescent probe with an amino-modified CCNE1-specific nucleic acid. The fluorescent probe is based on a conjugated structure constructed from 5-methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde. By detecting the fluorescence signal intensity at 650 nm excitation and 690 nm emission, the expression level of the CCNE1 gene can be accurately reflected, thereby assessing the malignancy, metastatic potential, and patient prognosis of cholangiocarcinoma. It can also be used to predict progression-free survival and tumor metastasis risk, providing a reliable tool for the diagnosis and treatment of cholangiocarcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, specifically to a kit for assessing the progression of cholangiocarcinoma based on the CCNE1 gene. Background Technology

[0002] Cholangiocarcinoma is a highly aggressive malignant tumor originating from the epithelial cells of the bile ducts, and is one of the most common malignant tumors of the biliary system. In recent years, its global incidence and mortality rates have been on the rise. However, due to the insidious nature of early symptoms and the difficulty in diagnosis, most patients are diagnosed at an advanced stage, resulting in extremely poor prognosis, with a 5-year survival rate of less than 5%-20%. Currently, radical surgical resection is the only potentially curative treatment for cholangiocarcinoma; however, only about 30% of patients are eligible for surgery at the time of diagnosis, while the remaining patients lose the opportunity due to local tumor progression or distant metastasis. For patients who are not candidates for surgery, radiotherapy and chemotherapy have limited effectiveness, thus requiring more effective treatment strategies. In recent years, molecular targeted therapy has become a research hotspot due to its high specificity and low toxicity, and some targeted drugs have shown some efficacy in clinical trials. However, the high molecular heterogeneity of cholangiocarcinoma means that reliable specific biomarkers are still lacking for early diagnosis and precision treatment screening, which remains a key challenge in improving patient prognosis.

[0003] Based on this finding, we present CCNE1, a biomarker for cholangiocarcinoma patients, which is often highly expressed in cholangiocarcinoma. Its expression level is closely related to tumor malignancy, metastatic potential, and patient survival, making it an important biomarker for assessing cholangiocarcinoma progression. CCNE1 can serve as a prognostic biomarker, used for patient risk stratification, and for constructing prognostic assessment models. It also has application value as a diagnostic, therapeutic, and potential drug target. Summary of the Invention

[0004] The purpose of this invention is to provide a highly efficient and specific fluorescent labeling detection kit based on CCNE1 gene expression levels to address the current lack of efficient and specific progression assessment tools in the diagnosis and treatment of cholangiocarcinoma. This kit, by constructing specific fluorescent probes, effectively assesses the malignancy, metastatic potential, and patient prognosis of cholangiocarcinoma, overcoming the deficiencies in specificity and sensitivity of existing diagnostic methods and providing reliable evidence for assessing cholangiocarcinoma progression in clinical practice.

[0005] The technical solution adopted by the present invention to achieve the above objectives is as follows:

[0006] A kit based on the CCNE1 gene, comprising a specific fluorescent probe and a detection buffer system.

[0007] Preferably, the specific fluorescent probe is formed by coupling a fluorescent probe with an amino-modified CCNE1 specific nucleic acid.

[0008] Preferably, the nucleotide sequence of the amino-modified CCNE1-specific nucleic acid is as shown in SEQ ID No.1, which is 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'.

[0009] Preferably, the mass ratio of amino-modified CCNE1-specific nucleic acid to fluorescent probe is 80-120:264.

[0010] Preferably, the preparation of the specific fluorescent probe includes a functional agent.

[0011] Preferably, the functional agent includes N-hydroxysuccinimide and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride.

[0012] Preferably, the fluorescent probe is prepared by reacting an intermediate with 4-(9H-carbazole-9-yl)benzaldehyde under the catalysis of p-toluenesulfonic acid.

[0013] Preferably, the intermediate is prepared by reacting 5-methoxy-2,3,3-trimethylindole with 4-(2-bromoacetyl)benzoic acid in the presence of potassium carbonate.

[0014] Preferably, the mass ratio of 4-(9H-carbazole-9-yl)benzaldehyde to the intermediate is 200-300:256.

[0015] Preferably, the mass ratio of 4-(2-bromoacetyl)benzoic acid to 5-methoxy-2,3,3-trimethylindole is 287:170-200.

[0016] 5-Methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde jointly construct a stable conjugated structure, laying the core foundation for the function of the fluorescent probe. The electron-donating properties of 5-methoxy enhance the electron cloud density of the intermediate, providing sufficient electronic support for the formation of the conjugated system and promoting π electron delocalization. The carbazole group contained in 4-(9H-carbazole-9-yl)benzaldehyde possesses a strong conjugated system, which can further expand the π electron delocalization range and significantly improve the stability of the conjugated structure. By enhancing the activity of the fluorescent group, the fluorescence intensity is improved, and a suitable spatial conformation is provided for the coupling of the probe with amino-modified CCNE1 specific nucleic acid, ensuring the structural matching when the probe and target sequence bind complementaryly, thereby improving the specificity of target binding.

[0017] Preferably, the detection buffer system includes a buffer solution and a detection reagent.

[0018] Preferably, the buffer solution includes hybridization buffer and washing buffer.

[0019] Preferably, the detection reagent includes a dye solution and an anti-fluorescence quencher.

[0020] Preferably, the hybridization buffer comprises formamide, 15-25×SSC, dextran sulfate, and salmon sperm DNA.

[0021] Preferably, the washing buffer comprises 15-25×SSC and SDS.

[0022] Preferably, the excitation wavelength of the kit is 648-652 nm, and the emission wavelength is 688-692 nm. The expression level of the CCNE1 gene is assessed by the fluorescence signal intensity.

[0023] The use of a CCNE1 gene-based kit in assessing the progression of cholangiocarcinoma.

[0024] Preferably, assessing the progression of cholangiocarcinoma includes predicting progression-free survival based on CCNE1 gene expression levels and assessing the risk of tumor metastasis.

[0025] More preferably, the specific fluorescent probe further includes ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, and the mass ratio of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate to the fluorescent probe is 80-120:264.

[0026] Ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate participates in and enhances the probe's conjugated system. Its core skeleton forms a linear conjugated chain, which, combined with the electron-donating properties of 4-(diethylamino)phenyl, enhances the intramolecular electron delocalization ability. Working together with the original conjugated system of the probe, it expands the π-electron delocalization range, improves the electronic transition efficiency of the fluorescent group, and enhances the probe's fluorescence emission intensity. It also optimizes the probe's spatial conformation, making it easier for the probe to form a stable complementary pairing structure with the target sequence after coupling with the amino-modified CCNE1 specific nucleic acid, thereby improving the binding affinity between the probe and the target sequence and enhancing the specificity and sensitivity of the detection.

[0027] The present invention also provides a method for preparing an intermediate, comprising:

[0028] 5-Methoxy-2,3,3-trimethylindole, 4-(2-bromoacetyl)benzoic acid, and potassium carbonate were added to N,N-dimethylformamide. Nitrogen gas was introduced, and the mixture was reacted at 95-105°C under stirring and reflux for 2-4 hours. The reaction solution was cooled to room temperature, and the reaction solution was added to the precipitation solvent to precipitate the product. The precipitate was filtered, washed with diethyl ether, purified by column chromatography, and dried to obtain the intermediate.

[0029] Preferably, the mass-to-volume ratio of 5-methoxy-2,3,3-trimethylindole to N,N-dimethylformamide is 170-200 mg: 20 mL.

[0030] Preferably, the mass ratio of 4-(2-bromoacetyl)benzoic acid to 5-methoxy-2,3,3-trimethylindole is 287:170-200.

[0031] Preferably, the mass ratio of potassium carbonate to 5-methoxy-2,3,3-trimethylindole is 276:170-200.

[0032] Preferably, the precipitation solvent is diethyl ether, and the volume ratio of diethyl ether to the reaction solution is 150:10-30.

[0033] Preferably, the column chromatography eluent is petroleum ether and ethyl acetate, with a volume ratio of petroleum ether to ethyl acetate of 4-6:1.

[0034] This invention also provides a method for preparing a fluorescent probe, comprising:

[0035] An intermediate, 4-(9H-carbazole-9-yl)benzaldehyde, and p-toluenesulfonic acid were added to ethanol, nitrogen gas was introduced, and the reaction was carried out at 75-85℃ under stirring and reflux for 8-10 hours. The reaction solution was cooled to room temperature, the solvent was removed by rotary evaporation under reduced pressure, purified by column chromatography, and dried to obtain the fluorescent probe.

[0036] Preferably, the mass-volume ratio of the intermediate to ethanol is 256 mg: 15-25 mL.

[0037] Preferably, the mass ratio of 4-(9H-carbazole-9-yl)benzaldehyde to the intermediate is 200-300:256.

[0038] Preferably, the mass ratio of p-toluenesulfonic acid to the intermediate is 10-20:256.

[0039] Preferably, the column chromatography eluent is dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 10:0.5-1.5.

[0040] This invention also provides a method for preparing a specific fluorescent probe, comprising:

[0041] A fluorescent probe, N-hydroxysuccinimide, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, and amino-modified CCNE1-specific nucleic acid were added to dichloromethane and reacted at room temperature with stirring for 3-5 h. The mixture was then extracted with PBS solution at pH 7.3-7.5, purified by column chromatography, and dried to obtain the specific fluorescent probe.

[0042] Preferably, the mass-to-volume ratio of the fluorescent probe to dichloromethane is 264 mg: 15-25 mL.

[0043] Preferably, the mass ratio of N-hydroxysuccinimide to the fluorescent probe is 95-115:264.

[0044] Preferably, the mass ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the fluorescent probe is 145-165:264.

[0045] Preferably, the mass ratio of amino-modified CCNE1-specific nucleic acid to fluorescent probe is 80-120:264.

[0046] Preferably, the column chromatography eluent is dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 20:1.

[0047] Preferably, the nucleotide sequence of the amino-modified CCNE1-specific nucleic acid is as shown in SEQ ID No.1, which is 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'.

[0048] More preferably, the specific fluorescent probe also includes ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate.

[0049] More preferably, the mass ratio of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate to the fluorescent probe is 80-120:264.

[0050] The present invention also provides a method for preparing a reagent kit, comprising:

[0051] The specific fluorescent probe was dissolved in PBS buffer to obtain the specific fluorescent probe solution; formamide, 15-25×SSC, dextran sulfate, and salmon sperm DNA were dissolved in deionized water to obtain the hybridization buffer; 15-25×SSC and SDS were dissolved in deionized water to obtain the washing buffer; 30-70 μL of the specific fluorescent probe solution, 450-550 μL of the hybridization buffer, 200-300 μL of the washing buffer, 50-150 μL of the positive control, 100-200 μL of 0.5-1.5 μg / mL DAPI staining solution, and 100-200 μL of anti-fluorescence quencher were combined to assemble the kit.

[0052] Preferably, in the specific fluorescent probe solution, the mass-to-volume ratio of the specific fluorescent probe to the PBS buffer is 1 mg: 0.5-1.5 mL.

[0053] Preferably, the volume ratio of formamide to deionized water in the hybridization buffer is 40-60:30.

[0054] Preferably, the volume ratio of 20×SSC to deionized water in the hybridization buffer is 5-15:30.

[0055] Preferably, in the hybridization buffer, the mass-to-volume ratio of dextran sulfate to deionized water is 5-15 g: 30 mL.

[0056] Preferably, the mass-to-volume ratio of salmon sperm DNA to deionized water in the hybridization buffer is 5-15 mg: 30 mL.

[0057] Preferably, the volume ratio of 20×SSC to deionized water in the washing buffer is 0.1-1:100.

[0058] Preferably, the mass-to-volume ratio of SDS to deionized water in the washing buffer is 0.05-0.15 g: 100 mL.

[0059] Preferably, the positive control is genomic DNA of a cholangiocarcinoma cell line containing high expression of the CCNE1 gene.

[0060] The present invention also provides a detection method for a reagent kit, comprising:

[0061] Genomic DNA was extracted from cholangiocarcinoma tissue, and its integrity was verified by agarose gel electrophoresis. 5-15 μL of the DNA was dried and fixed onto a glass slide at 60-70℃. A specific fluorescent probe solution was diluted 50-150 times with hybridization buffer, and 10-30 μL was used to cover the sample area. The slide was then sealed and denatured at 90-100℃ for 5-15 min, followed by hybridization at 40-44℃ for 15-20 h. The slide was removed, and the sample was washed 2-4 times with washing buffer at 36-38℃ for 3-10 min each time. After rinsing with deionized water, the sample was air-dried. 4-6 μL of DAPI staining solution was added and incubated in the dark for 3-10 min. After rinsing with deionized water, the slide was mounted with an anti-fluorescence quencher. The CCNE1 gene expression level was assessed using a fluorescence microscope or confocal microscope with an excitation wavelength of 648-652 nm and an emission wavelength of 688-692 nm, based on the fluorescence signal intensity.

[0062] This invention utilizes a fluorescent probe with a stable conjugated structure constructed from 5-methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde. This probe is then coupled with an amino-modified CCNE1-specific nucleic acid to prepare a specific fluorescent probe, resulting in a CCNE1-based kit. This kit offers the following advantages: the specific fluorescent probe exhibits high fluorescence intensity and strong affinity for the CCNE1 gene target, accurately reflecting CCNE1 gene expression levels; the kit's detection process is stable, effectively assessing the malignancy, metastatic potential, and patient prognosis of cholangiocarcinoma, overcoming the limitations of existing diagnostic methods in terms of specificity and sensitivity. Therefore, this invention provides a highly efficient and specific fluorescent labeling detection kit based on CCNE1 gene expression levels, offering a reliable clinical tool for assessing the progression of cholangiocarcinoma. Attached Figure Description

[0063] Figure 1This is a schematic diagram of a scanning electron microscope image of a specific fluorescent probe.

[0064] Figure 2 This is a schematic diagram of the results of a univariate Cox analysis related to PFS.

[0065] Figure 3 This is a schematic diagram illustrating the CCNE1 transcriptional level in RBE cells transiently transfected with CCNE1 to knock down the CCNE1 transcription level.

[0066] Figure 4 This is a schematic diagram of CCNE1 transcription levels in cells transiently transfected with CCNE1-overexpressing RBE cells.

[0067] Figure 5 This is a schematic diagram of the transcriptional level of E2F1, a downstream gene of CCNE1.

[0068] Figure 6 This is a schematic diagram of the transcriptional level of CDK-2, a downstream gene of CCNE1.

[0069] Figure 7 This is a schematic diagram illustrating the CCNE1 protein expression levels in RBE cells transiently transfected with CCNE1 overexpression and knocked down.

[0070] Figure 8 This is a scratch diagram illustrating how CCNE1 promotes the migration and invasion of cholangiocarcinoma cells.

[0071] Figure 9 This is a schematic diagram illustrating the migration rate of CCNE1 in promoting the migration and invasion of cholangiocarcinoma cells.

[0072] Figure 10 A schematic diagram of the liver of mice with knockdown and overexpression of CCNE1 in cholangiocarcinoma.

[0073] Figure 11 A schematic diagram illustrating liver weight in mice with knockdown and overexpression of CCNE1 in cholangiocarcinoma.

[0074] Figure 12 This is a schematic diagram of HE staining of cholangiocarcinoma mice with knockdown and overexpression of CCNE1.

[0075] Figure 13 This is a schematic diagram of immunohistochemical staining in mice with knockdown and overexpression of CCNE1 in cholangiocarcinoma. Detailed Implementation

[0076] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0077] The concepts involved in this application will first be described with reference to the accompanying drawings. It should be noted that the following descriptions of various concepts are only for the purpose of making the content of this application easier to understand and do not constitute a limitation on the scope of protection of this application; furthermore, the embodiments and features in the embodiments of this application can be combined with each other unless otherwise specified. This application will now be described in detail with reference to the accompanying drawings and embodiments.

[0078] Example 1:

[0079] Preparation of intermediate: 5-methoxy-2,3,3-trimethylindole, 4-(2-bromoacetyl)benzoic acid and potassium carbonate were added to N,N-dimethylformamide. Nitrogen gas was introduced and the mixture was reacted at 100°C under stirring and reflux for 3 hours. The reaction solution was cooled to room temperature, and the reaction solution was added to the precipitation solvent to precipitate the product. The precipitate was filtered, washed with diethyl ether, purified by column chromatography, and dried to obtain the intermediate. The mass-to-volume ratio of 5-methoxy-2,3,3-trimethylindole to N,N-dimethylformamide was 189 mg:20 mL; the mass ratio of 4-(2-bromoacetyl)benzoic acid to 5-methoxy-2,3,3-trimethylindole was 287:189; and the mass ratio of potassium carbonate to 5-methoxy-2,3,3-trimethylindole was 276:189. The precipitation solvent was diethyl ether, with a volume ratio of diethyl ether to the reaction solution of 150:20. The column chromatography eluent was petroleum ether and ethyl acetate, with a volume ratio of petroleum ether to ethyl acetate of 5:1.

[0080] Preparation of the fluorescent probe: An intermediate, 4-(9H-carbazole-9-yl)benzaldehyde, and p-toluenesulfonic acid were added to ethanol. Nitrogen gas was introduced, and the reaction was carried out at 80°C under stirring and reflux for 9 hours. The reaction solution was cooled to room temperature, and the solvent was removed by rotary evaporation under reduced pressure. After purification by column chromatography and drying, the fluorescent probe was obtained. The mass-volume ratio of the intermediate to ethanol was 256 mg:20 mL, the mass ratio of 4-(9H-carbazole-9-yl)benzaldehyde to the intermediate was 224:256, and the mass ratio of p-toluenesulfonic acid to the intermediate was 15.2:256. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 10:1.

[0081] Preparation of specific fluorescent probe: The fluorescent probe, N-hydroxysuccinimide, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, and amino-modified CCNE1 specific nucleic acid were added to dichloromethane and reacted at room temperature with stirring for 4 h. The mixture was then extracted with PBS solution at pH 7.4, purified by column chromatography, and dried to obtain the specific fluorescent probe. The mass-to-volume ratio of the fluorescent probe to dichloromethane was 264 mg:20 mL, the mass ratio of N-hydroxysuccinimide to the fluorescent probe was 108:264, the mass ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the fluorescent probe was 154:264, and the mass ratio of the amino-modified CCNE1-specific nucleic acid to the fluorescent probe was 100:264. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 20:1. The nucleotide sequence of the amino-modified CCNE1-specific nucleic acid is shown in SEQ ID No. 1, which is 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'.

[0082] Kit preparation: Dissolve the specific fluorescent probe in PBS buffer to obtain the specific fluorescent probe solution; dissolve formamide, 20×SSC, dextran sulfate and salmon sperm DNA in deionized water to obtain the hybridization buffer; dissolve 20×SSC and SDS in deionized water to obtain the washing buffer; assemble the kit together with 50 μL of the specific fluorescent probe solution, 500 μL of the hybridization buffer, 250 μL of the washing buffer, 100 μL of the positive control, 150 μL of 1 μg / mL DAPI staining solution and 150 μL of anti-fluorescence quencher. In the specific fluorescent probe solution, the mass-to-volume ratio of the specific fluorescent probe to PBS buffer was 1 mg:1 mL; in the hybridization buffer, the volume ratio of formamide to deionized water was 50:30, the volume ratio of 20×SSC to deionized water was 10:30, the mass-to-volume ratio of dextran sulfate to deionized water was 10 g:30 mL, and the mass-to-volume ratio of salmon sperm DNA to deionized water was 10 mg:30 mL; in the washing buffer, the volume ratio of 20×SSC to deionized water was 0.5:100, and the mass-to-volume ratio of SDS to deionized water was 0.1 g:100 mL; the positive control was genomic DNA from a cholangiocarcinoma cell line containing high expression of the CCNE1 gene.

[0083] Detection using the kit: Genomic DNA was extracted from cholangiocarcinoma tissue, and its integrity was verified by agarose gel electrophoresis. 10 μL of the DNA was dried and fixed onto a glass slide at 65 °C. The specific fluorescent probe solution was diluted 100-fold with hybridization buffer, and 20 μL was used to cover the sample area. The slide was then sealed and denatured at 95 °C for 10 min, followed by hybridization at 42 °C for 16 h. The slide was then removed, and the sample was washed three times with washing buffer at 37 °C for 5 min each time. After rinsing with deionized water, the sample was air-dried. 5 μL of DAPI staining solution was added and incubated in the dark for 5 min. After rinsing with deionized water, the slide was mounted with an anti-fluorescence quencher. The CCNE1 gene expression level was assessed by fluorescence microscopy or confocal microscopy with an excitation wavelength of 650 nm and an emission wavelength of 690 nm.

[0084] Example 2: The only difference between this example and Example 1 is the preparation of the fluorescent probe.

[0085] Preparation of the fluorescent probe: An intermediate, 4-(9H-carbazole-9-yl)benzaldehyde, and p-toluenesulfonic acid were added to ethanol. Nitrogen gas was introduced, and the reaction was carried out at 80°C under stirring and reflux for 9 hours. The reaction solution was cooled to room temperature, and the solvent was removed by rotary evaporation under reduced pressure. After purification by column chromatography and drying, the fluorescent probe was obtained. The mass-volume ratio of the intermediate to ethanol was 256 mg:20 mL, the mass ratio of 4-(9H-carbazole-9-yl)benzaldehyde to the intermediate was 280:256, and the mass ratio of p-toluenesulfonic acid to the intermediate was 18:256. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 10:1.

[0086] Example 3: The only difference between this example and Example 1 is the preparation of the specific fluorescent probe.

[0087] Preparation of specific fluorescent probe: Fluorescent probe, ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, N-hydroxysuccinimide, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and amino-modified CCNE1 specific nucleic acid were added to dichloromethane and reacted at room temperature with stirring for 4 h. The reaction solution was filtered, the solvent was removed by rotary evaporation under reduced pressure, purified by column chromatography and dried to obtain the specific fluorescent probe. The mass-to-volume ratio of the fluorescent probe to dichloromethane was 264 mg:20 mL; the mass ratio of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate to the fluorescent probe was 92:264; the mass ratio of N-hydroxysuccinimide to the fluorescent probe was 108:264; the mass ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the fluorescent probe was 154:264; and the mass ratio of the amino-modified CCNE1-specific nucleic acid to the fluorescent probe was 100:264. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 20:1. The nucleotide sequence of the amino-modified CCNE1-specific nucleic acid is shown in SEQ ID No. 1, which is 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'.

[0088] Example 4: The only difference between this example and Example 1 is the preparation of the specific fluorescent probe.

[0089] Preparation of specific fluorescent probe: Fluorescent probe, ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, N-hydroxysuccinimide, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and amino-modified CCNE1 specific nucleic acid were added to dichloromethane and reacted at room temperature with stirring for 4 h. The reaction solution was filtered, the solvent was removed by rotary evaporation under reduced pressure, purified by column chromatography and dried to obtain the specific fluorescent probe. The mass-to-volume ratio of the fluorescent probe to dichloromethane was 264 mg:20 mL; the mass ratio of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate to the fluorescent probe was 115:264; the mass ratio of N-hydroxysuccinimide to the fluorescent probe was 108:264; the mass ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to the fluorescent probe was 154:264; and the mass ratio of the amino-modified CCNE1-specific nucleic acid to the fluorescent probe was 100:264. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 20:1. The nucleotide sequence of the amino-modified CCNE1-specific nucleic acid is shown in SEQ ID No. 1, which is 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'.

[0090] Comparative Example 1: The only difference between this comparative example and Example 1 is the preparation of the intermediate.

[0091] Preparation of the intermediate: Indole, 4-(2-bromoacetyl)benzoic acid, and potassium carbonate were added to N,N-dimethylformamide. Nitrogen gas was introduced, and the mixture was reacted at 100°C under stirring and reflux for 3 hours. The reaction solution was cooled to room temperature, and the reaction solution was added to the precipitation solvent to precipitate the intermediate. The precipitate was filtered, washed with diethyl ether, purified by column chromatography, and dried to obtain the intermediate. The mass-to-volume ratio of indole to N,N-dimethylformamide was 189 mg:20 mL, the mass ratio of 4-(2-bromoacetyl)benzoic acid to indole was 287:189, and the mass ratio of potassium carbonate to indole was 276:189. The precipitation solvent was diethyl ether, and the volume ratio of diethyl ether to the reaction solution was 150:20. The column chromatography eluent was petroleum ether and ethyl acetate, and the volume ratio of petroleum ether to ethyl acetate was 5:1.

[0092] Comparative Example 2: The only difference between this comparative example and Example 1 is the preparation of the fluorescent probe.

[0093] Preparation of the fluorescent probe: An intermediate, benzaldehyde, and p-toluenesulfonic acid were added to ethanol, nitrogen gas was introduced, and the reaction was carried out at 80°C under stirring and reflux for 9 hours. The reaction solution was cooled to room temperature, the solvent was removed by rotary evaporation under reduced pressure, purified by column chromatography, and dried to obtain the fluorescent probe. The mass-to-volume ratio of the intermediate to ethanol was 256 mg:20 mL, the mass ratio of benzaldehyde to the intermediate was 224:256, and the mass ratio of p-toluenesulfonic acid to the intermediate was 15.2:256. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 10:1.

[0094] Comparative Example 3: This comparative example differs from Example 1 in the preparation of the intermediate and the fluorescent probe.

[0095] Preparation of the intermediate: Indole, 4-(2-bromoacetyl)benzoic acid, and potassium carbonate were added to N,N-dimethylformamide. Nitrogen gas was introduced, and the mixture was reacted at 100°C under stirring and reflux for 3 hours. The reaction solution was cooled to room temperature, and the reaction solution was added to the precipitation solvent to precipitate the intermediate. The precipitate was filtered, washed with diethyl ether, purified by column chromatography, and dried to obtain the intermediate. The mass-to-volume ratio of indole to N,N-dimethylformamide was 189 mg:20 mL, the mass ratio of 4-(2-bromoacetyl)benzoic acid to indole was 287:189, and the mass ratio of potassium carbonate to indole was 276:189. The precipitation solvent was diethyl ether, and the volume ratio of diethyl ether to the reaction solution was 150:20. The column chromatography eluent was petroleum ether and ethyl acetate, and the volume ratio of petroleum ether to ethyl acetate was 5:1.

[0096] Preparation of the fluorescent probe: An intermediate, benzaldehyde, and p-toluenesulfonic acid were added to ethanol, nitrogen gas was introduced, and the reaction was carried out at 80°C under stirring and reflux for 9 hours. The reaction solution was cooled to room temperature, the solvent was removed by rotary evaporation under reduced pressure, purified by column chromatography, and dried to obtain the fluorescent probe. The mass-to-volume ratio of the intermediate to ethanol was 256 mg:20 mL, the mass ratio of benzaldehyde to the intermediate was 224:256, and the mass ratio of p-toluenesulfonic acid to the intermediate was 15.2:256. The column chromatography eluent was dichloromethane and methanol, with a volume ratio of dichloromethane to methanol of 10:1.

[0097] Experimental Example 1: Microstructural characterization of a specific fluorescent probe.

[0098] Test sample: The specific fluorescent probe prepared in Example 1.

[0099] Test method: The specific fluorescent probe was dispersed in anhydrous ethanol to obtain a probe dispersion with a concentration of 0.1 mg / mL. 10 μL of the dispersion was dropped onto the surface of a silicon wafer and dried in an oven at 37 °C for 2 h to allow the probe to adhere uniformly to the silicon wafer. The surface was then sputtered with gold and observed using a scanning electron microscope at 25 °C with an accelerating voltage of 20 kV.

[0100] Scanning electron microscope image of the specific fluorescent probe prepared in this invention is shown below. Figure 1 As shown, the probe exhibits a regular spherical structure with a smooth surface, no obvious aggregation, and a uniform particle size distribution, indicating that the specific fluorescent probe shown in the figure has been successfully obtained.

[0101] Experimental Example 2: Fluorescence intensity test of specific fluorescent probes.

[0102] Test samples: Specific fluorescent probes prepared for each example and comparative example.

[0103] Test method: Take each test sample and dilute it with PBS buffer at pH 7.4 to a probe solution concentration of 1 μmol / L. Sonicate for 5 min to ensure uniform dispersion of the solution. Add an equal volume of CCNE1 gene complementary nucleic acid sequence solution at a concentration of 1 μmol / L to each probe solution and incubate at 37℃ for 30 min to allow the probe to fully hybridize with the target. Use a fluorescence spectrophotometer to detect the fluorescence intensity of the hybridized solution. Set the excitation wavelength to 650 nm, the emission wavelength to 690 nm, the slit width to 5 nm, and the scan speed to 240 nm / min.

[0104] The fluorescence intensity test results of the specific fluorescent probe prepared in this invention are shown in Table 1.

[0105] Table 1. Fluorescence intensity test results of specific fluorescent probes

[0106]

[0107] Example 1 uses a basic ratio of 5-methoxy-2,3,3-trimethylindole to 4-(9H-carbazole-9-yl)benzaldehyde, and the conjugated structure formed by the two endows the probe with fluorescence emission capability. Example 2 increases the amount of 4-(9H-carbazole-9-yl)benzaldehyde, and the added carbazole conjugated system enhances the π-electron delocalization ability of the fluorescent group, making the conjugated structure more stable, improving the fluorescence emission efficiency, and the fluorescence intensity is higher than that of Example 1. Example 3 introduces ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, which significantly enhances the fluorescence emission capability of the probe through the conjugation effect, and the fluorescence intensity is further improved. Example 4 increases the amount of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, further strengthening the group. The enhanced conjugation effect of the group resulted in optimal fluorescence emission and the highest fluorescence intensity. Comparative Example 1 used indole but not 5-methoxy-2,3,3-trimethylindole, resulting in insufficient intermediate electron cloud density, hindered conjugation structure formation, and decreased fluorescence activity. Comparative Example 2 did not use 4-(9H-carbazole-9-yl)benzaldehyde, which could not effectively enhance the emission ability of the fluorescent group, and the fluorescence intensity was lower than that of Example 1. Comparative Example 3 did not use both 5-methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde, lacking both the electron-donating effect of methoxy groups and the support of a strong conjugated system, which doubly weakened the stability of the probe's conjugated structure and the activity of the fluorescent group, resulting in a significant reduction in fluorescence emission and the lowest fluorescence intensity.

[0108] Experimental Example 3: Targeting binding specificity test of specific fluorescent probes.

[0109] Test samples: Specific fluorescent probes prepared for each example and comparative example.

[0110] Test method: Surface plasmon resonance (SPR) was used for detection. The target sequence was immobilized on the surface of the CM5 sensor chip by amino coupling. Probe solutions of 0.1~10 μmol / L were injected into the chip channels according to the concentration gradient at a flow rate of 30 μL / min and a temperature of 25℃. The binding signal was recorded in real time. The binding-dissociation curve was fitted by BiacoreEvaluation software to calculate the dissociation binding force between the probe and the target sequence.

[0111] The targeting binding specificity test results of the specific fluorescent probes prepared in this invention are shown in Table 2.

[0112] Table 2. Target binding specificity test results of specific fluorescent probes.

[0113]

[0114] In Example 1, the conjugated structure formed by 5-methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde in a basic ratio provides a fundamental spatial matching and interaction basis for the complementary binding of the probe and target sequences, enabling the probe to bind to the target. Example 2 exhibits better binding affinity than Example 1 because it increases the amount of 4-(9H-carbazole-9-yl)benzaldehyde, making the conjugated structure more stable, thereby improving the complementary pairing stability of the probe and target sequences and enhancing binding affinity. Example 3... The binding affinity is further enhanced by the introduction of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate, which, through a conjugation effect, not only enhances fluorescence emission but also optimizes the probe's spatial conformation, resulting in a tighter binding between the probe and the target sequence. The molecular structure of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate binds only to the conjugated system of the fluorescent probe, increasing fluorescence intensity by enhancing π-electron delocalization. It does not interact with the CCNE1 gene promoter, coding region, or regulatory region, and therefore does not activate or inhibit CCNE1. Gene expression does not significantly interfere with the detection results. In Example 4, increasing the amount of ethyl 2-cyano-3-[4-(diethylamino)phenyl]acrylate further enhanced the conjugation effect of this group, resulting in better matching between the probe's spatial conformation and the target sequence, more stable complementary binding, and optimal binding affinity. The binding affinity of Comparative Examples 1 and 2 was weaker than that of Example 1, indicating that the formation of the conjugated structure was hindered, the complementary pairing stability between the probe and the target sequence decreased, and the binding affinity was reduced. Comparative Example 3 did not use 5-methoxy-2,3,3-trimethylindole and 4-(9H-carbazole-9-yl)benzaldehyde, which lacked both the electron-donating effect of the methoxy group to maintain the electron cloud density of the intermediate and the strong conjugated system to support the stable structure, thus doubly weakening the complementary binding stability between the probe and the target sequence, resulting in a significant reduction in binding affinity.

[0115] Experimental Example 4: Clinical Sample Analysis and Validation of the CCNE1 Gene

[0116] Methods: Clinical specimens were collected from patients with cholangiocarcinoma. Inclusion criteria: age ≥18 years; biopsy / pathological confirmation of unresectable, locally advanced or metastatic advanced disease; ECOG PS=0 / 1; no systemic therapy received. A total of 40 patients were included. The treatment regimen was sintilimab a + anlotinib hydrochloride b + gemcitabine combined with cisplatin c for 8 cycles, followed by sintilimab and anlotinib hydrochloride, with a maximum treatment duration of 2 years. a Sintilimab (200 mg, IV, D1, Q3W); b Anlotinib hydrochloride (8 mg, PO, D1-D14, Q3W); c Gemcitabine combined with cisplatin (days 1 and 8, gemcitabine 1000 mg / m²). 2 Cisplatin 25mg / m 2(Q3W). Progression-free survival (PFS) was statistically analyzed in 40 patients. Whole-genome sequencing was performed on clinical tissue samples from patients with cholangiocarcinoma, and univariate and multivariate Cox regression analyses were conducted in conjunction with the patients' clinical characteristics.

[0117] The results of the univariate Cox analysis related to PFS are as follows: Figure 2 As shown, CCNE1 showed a p-value of ≤0.1 in the univariate Cox analysis of PFS, suggesting a potential association between CCNE1 and progression-free survival in patients with cholangiocarcinoma. Patients with high CCNE1 expression were more likely to experience disease progression and had relatively shorter PFS.

[0118] Experimental Example 5: Test of CCNE1's ability to promote the migration and invasion of cholangiocarcinoma cells

[0119] Test method: The cholangiocarcinoma cell line RBE was used and divided into 4 groups: transient transfection empty vector control group CON, transient transfection CCNE1 knockdown group si1-CCNE1 and si2-CCNE1, transient transfection overexpression empty vector control group NC, and transient transfection CCNE1 overexpression group OE. The siRNA-CCNE1, shRNA-CCNE1, and CCNE1 overexpression plasmid used in this invention were all synthesized by Beijing Qingke Biotechnology Co., Ltd. siRNA-CCNE1 includes H898-siCCNE1-1 and H898-siCCNE1-2. The nucleotide sequence of H898-siCCNE1-1 is shown in SEQ ID No. 2, which is GCAAUUCUUCUGGAUUGGUUA(dT)(dT); the nucleotide sequence of H898-siCCNE1-2 is shown in SEQ ID No. 3, which is GACAGAGGAGCUUGUUCA(dT)(dT). shRNA-CCNE1 includes sh-CCNE1-1 and sh-CCNE1-2. The nucleotide sequence of sh-CCNE1-1 is shown in SEQ ID No. 4, which is CCGGAGATTTCTTTGACCGGTATATCTCGAGATATACCGGTCAAAGAAATCTTTTTTT, and is plasmid HZ0174100-1. The nucleotide sequence of sh-CCNE1-2 is shown in SEQ ID No. 5, which is CCGGACGTGCAAGCCTCGGATTATTCTCGAGAATAATCCGAGGCTTGCACGTTTTTTT, and is plasmid HZ0174100-2. The overexpression vector for CCNE1 is PLV-ZsGreen(2A)PURO-CMV.

[0120] The steps of instantaneous Si include:

[0121] S1. Seed the cells to be transfected into six-well plates, with the cell density at 75% before transfection.

[0122] S2. Replace with fresh complete culture medium 40 minutes in advance;

[0123] S3. Add 5 μL of Lipofectamine™ RNAiMAX Transfection Reagent and siRNA to 125 μL of serum-free culture medium to make the final concentration of siRNA 50 nM. Then mix them with a pipette and gently blow them to mix. Let them stand for 5 min.

[0124] S4. Add the mixed Transfection Reagent to the plasmid system and mix gently.

[0125] S5. Let stand at room temperature for 15 minutes to allow it to encapsulate and form liposomes. Within 2 minutes, slowly add the well-mixed culture medium dropwise to the corresponding well, gently shake well, and replace with fresh culture medium after 17 hours of incubation.

[0126] S6. Continue culturing in the cell incubator for 48 hours.

[0127] The steps for instantaneous Eo switch include:

[0128] S1. Seed the cells to be transfected into six-well plates, with the cell density at 75% before transfection.

[0129] S2. Replace with fresh complete culture medium 40 minutes in advance;

[0130] S3. Add 5 μL of polyjat and 1 μg of the target plasmid to 50 μL of serum-free culture medium, then gently mix them by pipetting and let them stand for 5 min.

[0131] S4. Add the mixed Transfection Reagent to the plasmid system and mix gently.

[0132] S5. Let stand at room temperature for 15 minutes to allow it to encapsulate and form liposomes. Within 2 minutes, slowly add the well-mixed culture medium dropwise to the corresponding well, gently shake well, and replace with fresh culture medium after 17 hours of incubation.

[0133] S6. Continue culturing in the cell incubator for 48 hours.

[0134] Transient transfection with CCNE1 knocks down CCNE1 transcription levels in RBE cells, as shown in the example. Figure 3 As shown, the CCNE1 transcription level in transiently transfected CCNE1-overexpressing RBE cells is as follows: Figure 4 As shown, the transcriptional level of the downstream gene E2F1 of CCNE1 is as follows: Figure 5 As shown, the transcriptional level of the downstream gene CDK-2 of CCNE1 is as follows: Figure 6As shown, the CCNE1 protein expression levels in transiently transfected CCNE1-overexpressed and knocked-down RBE cells are as follows: Figure 7 As shown, after transient transfection to construct a CCNE1 overexpression and knockdown cholangiocarcinoma cell line, qPCR successfully verified the efficiency of CCNE1 overexpression and knockdown. After CCNE1 overexpression and knockdown, the transcription levels of CCNE1 downstream genes E2F1 and CDK-2 also changed, proving that the RBE cell line with CCNE1 transient transfection overexpression and knockdown was successfully constructed.

[0135] On the bottom of a six-well plate, draw three horizontal lines with a marker and ruler as marker lines. Seed the cells according to their groupings. Once the cells have reached confluence, use a ruler as a guide and a 200µl pipette tip perpendicular to the wells and the marked lines to draw two perpendicular lines, intersecting the marked lines to create fixed detection points. Discard the old culture medium and gently wash the cells two to three times with PBS until all cells have been removed. Add culture medium and culture. Take a 20x magnification photograph under a microscope as a 0h control. Incubate at 37°C in a 5% CO2 incubator. Every 12 hours, remove the cells and observe the width of the scratch at the same location under a microscope, taking a photograph. Calculate the migration rate using the formula: Migration rate = (Initial scratch area − Scratch area at time t) / Initial scratch area × 100%.

[0136] CCNE1 promotes the migration and invasion of cholangiocarcinoma cells through scratches. Figure 8 As shown, CCNE1 promotes the migration and invasion of cholangiocarcinoma cells at a migration rate of [missing information]. Figure 9 As shown, CCNE1 knockdown inhibited the migration of cholangiocarcinoma cells compared to the control group, while CCNE1 overexpression promoted the migration ability of cholangiocarcinoma cells, indicating that CCNE1 promotes the migration and invasion of cholangiocarcinoma.

[0137] Experimental Example 6: Test of CCNE1's ability to promote the proliferation of bile duct cancer cells in vivo

[0138] Testing Methods: The animal experiments involved in this invention used C57 mice, 6-8 weeks old, housed at the Laboratory Animal Center of Zhejiang Cancer Hospital. All animal experiments were approved by the Animal Experiment Ethics Committee of Zhejiang Cancer Hospital and conducted in accordance with the guidelines for laboratory animal care and use. Using hydrodynamic transfection, AKT, YapS127A, and Sleeping Beauty transposon plasmids were mixed, drawn into a syringe, and injected into the mouse tail vein within 7 seconds using a 26-gauge needle. The injected plasmid contained a large amount of DNA. The solution was introduced into the inferior vena cava, causing rapid filling of the heart. The pressure caused the solution to flow back to the liver, inducing the formation and development of primary cholangiocarcinoma in mice. During the experiment, if the tumor growth exceeded 10% of the animal's original body weight, the average tumor diameter exceeded 15 mm in mice, or if the tumor metastasized or grew rapidly to the point of ulceration, causing infection or necrosis, the experiment was terminated and the animals were euthanized. The experimental mice were randomly divided into four groups: an overexpression control group, an overexpression group, a knockdown control group, and a knockdown group, with five mice in each group. The mice were simultaneously injected via the tail vein during tumor formation. The overexpression control group contained an empty carrier overexpressing the drug. The mice were administered CCNE1 plasmid (30 μg each) in two groups: overexpression group (30 μg of CCNE1 overexpression plasmid), knockdown control group (30 μg of knockdown empty vector plasmid), and knockdown group (30 μg of CCNE1 knockdown plasmid). Mouse weight was measured every 3 days, and feeding and general activity were observed and recorded. On day 21 after administration, diseased livers were dissected and samples were taken for immunohistochemical staining to assess tumor size and CCNE1 expression levels. Paraffin sections of cholangiocarcinoma tissue from mice were stained with hematoxylin and eosin (HE) to observe the degree of malignant invasion of tumors with CCNE1 knockdown or overexpression. Immunohistochemistry included CCNE1 and Ki67.

[0139] Liver tissues of mice with knockdown and overexpression of CCNE1 in cholangiocarcinoma, such as Figure 10 As shown, after establishing a cholangiocarcinoma mouse model, diseased livers were harvested. It was found that the livers of mice overexpressing CCNE1 showed grayish-white nodular masses on the surface and were enlarged, while the livers of mice with CCNE1 knockdown showed the opposite. The liver weights of mice with CCNE1 knockdown and those with CCNE1 overexpression were as follows: Figure 11 As shown, the livers expressing CCNE1 were heavier than those in the control group, while the livers expressing CCNE1 were lighter than those in the control group, indicating that CCNE1 promotes the proliferation of bile duct cancer cells in vivo.

[0140] HE staining and immunohistochemical staining of CCNE1-overexpressing cholangiocarcinoma mice, as shown in the following figures. Figure 12 As shown, the immunohistochemical staining of CCNE1 knocked-down cholangiocarcinoma mice is as follows: Figure 13As shown, the overexpression CCNE1 group had an increased nucleocytoplasmic ratio and significant differences in nucleus size and shape. The knockdown CCNE1 group had nuclei that were close to normal, slightly enlarged, and with uniform chromatin. Immunohistochemical CCNE1 index showed that the mouse model was successfully established. Immunohistochemical Ki-67 index showed that the knockdown CCNE1 group had a lower Ki-67 index than the control group, while the overexpression CCNE1 group had a higher Ki-67 index than the control group. This indicates that CCNE1 promotes tumor growth and invasion and has a worse prognosis.

[0141] The embodiments and / or implementation methods described above are merely preferred embodiments and / or implementation methods for implementing the technology of the present invention, and are not intended to limit the implementation methods of the technology of the present invention in any way. Any person skilled in the art can make some modifications or alterations to other equivalent embodiments without departing from the scope of the technical means disclosed in the content of the present invention, but they should still be regarded as the technology or embodiments that are substantially the same as the present invention.

[0142] This document uses specific examples to illustrate the principles and implementation methods of this application. The descriptions of the above embodiments are only for the purpose of helping to understand the methods and core ideas of this application. The above descriptions are only preferred embodiments of this application. It should be noted that due to the limitations of written expression, while there are objectively infinite specific structures, those skilled in the art can make several improvements, modifications, or changes without departing from the principles of this application, and can also combine the above technical features in an appropriate manner. These improvements, modifications, changes, or combinations, or the direct application of the inventive concept and technical solution to other situations without modification, should all be considered within the scope of protection of this application.

Claims

1. A kit based on the CCNE1 gene, characterized in that: The kit comprises a specific fluorescent probe and a detection buffer system, wherein the specific fluorescent probe is coupled by a fluorescent probe and an amino-modified CCNE1 specific nucleic acid, and the nucleotide sequence of the amino-modified CCNE1 specific nucleic acid is shown as SEQ ID No. 1, i.e. 5'-NH2-TCAAGTACCGAGACATTCCTGGAA-3'; The mass ratio of the amino-modified CCNE1 specific nucleic acid and the fluorescent probe is 80-120:264; The preparation of the specific fluorescent probe comprises a functional agent, and the functional agent comprises N-hydroxysuccinimide and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; The fluorescent probe is prepared by reacting an intermediate with 4-(9H-carbazole-9-yl)benzaldehyde under the catalysis of p-toluenesulfonic acid, and the intermediate is prepared by reacting 5-methoxy-2,3,3-trimethylindole with 4-(2-bromoacetyl)benzoic acid in the presence of potassium carbonate; The mass ratio of the 4-(9H-carbazole-9-yl)benzaldehyde and the intermediate is 200-300:256, and the mass ratio of the 4-(2-bromoacetyl)benzoic acid and the 5-methoxy-2,3,3-trimethylindole is 287:170-200.

2. The kit based on CCNE1 gene according to claim 1, characterized in that: The detection buffer system comprises a buffer and a detection reagent, wherein the buffer comprises a hybridization buffer and a washing buffer, and the detection reagent comprises a staining solution and an anti-fluorescence quencher.

3. A kit based on CCNE1 gene according to claim 2, characterized by: The hybridization buffer comprises formamide, 15-25×SSC, dextran sulfate and salmon sperm DNA.

4. The kit based on CCNE1 gene according to claim 2, characterized by the fact that it comprises: The washing buffer comprises 15-25×SSC and SDS.

5. The kit based on CCNE1 gene according to claim 1, characterized by: The excitation wavelength of the kit is 648-652 nm, and the emission wavelength is 688-692 nm, and the expression level of the CCNE1 gene is evaluated by the fluorescence signal intensity.

6. Use of the kit based on the CCNE1 gene according to any one of claims 1-5 in the preparation of a reagent for detecting the expression level of the CCNE1 gene.

Citation Information

Patent Citations

  • Application of biomarkers in bile in diagnosis of malignant tumor

    CN110129434A

  • Bicyclic amines as CDK2 inhibitors

    WO2024254245A1