Method for wrapping stem cells by adopting programmable DNA hydrogel and application thereof
By forming a three-dimensional network under physiological conditions using programmable DNA hydrogels, the shortcomings of traditional culture environments and hydrogel materials are overcome, enabling reversible encapsulation and release of stem cells, maintaining cell viability and stemness, avoiding immune activation, and restoring proliferative capacity.
Patent Information
- Application Number
- CN202510893835.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-11-04
AI Technical Summary
Traditional two-dimensional culture environments and natural matrices have many drawbacks. Artificially synthesized hydrogels have harsh gelation conditions, are toxic, and are difficult to degrade, making it difficult to effectively maintain the activity and stemness of stem cells.
A programmable DNA hydrogel is used to initiate a hybridization chain reaction between the DNA strand and the hairpin structure, forming a three-dimensional DNA hydrogel under isothermal physiological conditions. Its mechanical stiffness can be controlled to achieve reversible encapsulation and release of stem cells, which can then be rapidly degraded using nucleases.
Under physiological conditions, it forms a controllable 3D package in situ, maintains the activity and stemness of stem cells, rapidly degrades and releases them, avoids immune activation, and restores cell proliferation capacity.
Smart Images

Figure CN120888490A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of DNA nanotechnology, and more particularly to a method for encapsulating stem cells with programmable DNA hydrogel and application thereof. BACKGROUND
[0002] Stem cells have wide application value in developmental biology, oncology, reproductive medicine and regenerative medicine due to their ability to differentiate into different types and functional cells. However, the activity and stemness maintenance of stem cells face challenges in in vitro culture environment. Traditional two-dimensional culture environment (e.g., plastic culture dish) is difficult to provide complex biochemical / biophysical cues (especially mechanical environment) required for cell fate regulation. Although culturing stem cells with feeder cells or specific medium formula has been proved to be beneficial to maintain their activity, the two-dimensional culture environment is prone to cause up-regulation of stress-related genes of stem cells, weaken their stemness and self-renewal ability, and thus limit their clinical application.
[0003] Natural extracellular matrix, such as Matrigel of animal origin, can provide a three-dimensional mechanical environment for stem cells, which is beneficial to maintain their activity and stemness. However, its components are complex, and it is difficult to precisely control its structure and properties, and there is a large batch-to-batch difference. Moreover, its complex heterologous animal components may also bring biological safety and medical ethics problems, hindering its application transformation. Artificially synthesized hydrogel materials can mimic the mechanical environment provided by the extracellular matrix, and the components are clear and controllable, which can solve many problems of natural matrix. It is still difficult to generate hydrogel in situ under physiological conditions for the controllable encapsulation and release of stem cells and maintain their activity and stemness. For example, some polymer hydrogels need to be gelled under non-physiological conditions (e.g., higher temperature, non-physiological salt ion concentration, pH condition, etc.); some hydrogels (e.g., polyacrylamide hydrogel) need to introduce toxic reagents or produce toxic intermediates during preparation. These hydrogels need to be purified after preparation is completed and cannot be used for in situ encapsulation of stem cells. Many polymer hydrogels are difficult to degrade and release encapsulated cells. These all limit their application for stem cell encapsulation.
[0004] DNA has good biocompatibility and biodegradability. Thanks to the development of DNA nanotechnology, DNA can generate microstructure and mechanically controllable hydrogel in situ in a mild physiological environment, and can be controllably degraded. Therefore, it is of great significance to construct DNA hydrogel with programmable properties to provide controllable 3D encapsulation for stem cell application. SUMMARY
[0005] The application aims to provide a method for wrapping stem cells with programmable DNA hydrogel and application thereof, so as to solve the problems that the conventional two-dimensional culture environment and natural matrix have many defects, and the artificial synthetic hydrogel also has the phenomena of harsh gel forming conditions, toxicity, and difficult degradation, which lead to the problem that it is difficult to effectively maintain the activity and stemness of stem cells.
[0006] In order to solve the above problems, the application adopts the following technical scheme:
[0007] According to a first aspect of the application, a method for wrapping stem cells with programmable DNA hydrogel is provided, in which a three-dimensional DNA hydrogel is formed by a hybridization chain reaction of an initiator strand (I) and a hairpin structure DNA under isothermal physiological conditions to realize reversible wrapping and releasing of stem cells, the hairpin structure DNA is formed by denaturation-annealing treatment of at least two DNA monomer building blocks with complementary self-assembly domains, and the mechanical stiffness of the hydrogel is realized by regulating the molar ratio of the initiator strand (I) to the total amount of the DNA monomer building blocks; the DNA hydrogel can reversibly wrap and release stem cells, and the wrapped stem cells can maintain activity and stemness and restore normal proliferation ability after being released.
[0008] According to a preferred scheme of the application, the method comprises the following steps: 1) respectively dissolving the initiator strand (I) and the DNA monomer building blocks (H1, H2) in a cell basic culture medium; 2) respectively performing heating denaturation-annealing treatment on the solutions of the DNA monomer building blocks (H1, H2) to form first and second hairpin structures; 3) mixing the first and second hairpin structures, adding a stem cell suspension, the initiator strand (I), and a cell adhesion molecule, and then placing the mixture in a culture container to incubate under isothermal physiological conditions to form a system of DNA hydrogel wrapped stem cells; and 4) using a nuclease to cleave the DNA hydrogel to release the stem cells.
[0009] Preferably, the storage modulus of the DNA hydrogel ranges from 200 Pa to 2000 Pa, and is realized by regulating the molar ratio of the initiator strand (I) to the total amount of the DNA monomer building blocks (H1, H2).
[0010] Preferably, the molar ratio of the initiator strand (I) to the total amount of the DNA monomer building blocks (H1, H2) is between 1:50 and 1:20000.
[0011] According to the research of the application, the higher the ratio of the initiator strand is, the smaller the DNA building blocks formed are, and the looser the structure of the hydrogel is; on the contrary, the structure is tighter and the mechanical strength is higher.
[0012] Preferably, the stem cells include female reproductive stem cells or mesenchymal stem cells, and the cell basal medium is MEM-alpha medium containing 10% fetal bovine serum, bFGF, EGF, GDNF and LIF.
[0013] Preferably, in step 3), the cell adhesion molecule is an RGD polymerized polypeptide. In the present application, the cell adhesion molecule provides a connection site for cells and DNA hydrogel, thereby providing the necessary mechanical signal to regulate cell activity. According to the research of the present application, any positively charged polypeptide can be adsorbed on the DNA gel framework by electrostatic adsorption, so that any positively charged polypeptide or polymer with cell adhesion ability is suitable for the present application in principle.
[0014] According to a preferred embodiment of the present application, the cell adhesion molecule is an RGD polymerized polypeptide, and the sequence is KKKKKK-(PEG3)-GRGDS.
[0015] Preferably, in step 3), the system of DNA hydrogel encapsulating stem cells is formed by incubation at 30-37°C for 1-5 hours.
[0016] Preferably, in step 4), the nuclease is DNase I, the nuclease concentration is 0.5-2 U / μL, and the lysis time is 15-60 minutes.
[0017] According to the second aspect of the present application, the method is applied to prepare a stem cell three-dimensional culture system. By adjusting the molar ratio of the initiator (I) to the DNA monomer building block (H1, H2), DNA hydrogels with different storage moduli are formed, the stem cell activity is maintained at ≥95%, and the expression of stemness markers is stable, which is used for large-scale expansion of stem cells in vitro.
[0018] According to the third aspect of the present application, the method is applied as a stem cell transplantation carrier in the field of regenerative medicine.
[0019] It should be understood that the method of the present application is not limited to the DNA sequence used in the examples. The basic design principle is: 1) DNA forms different hairpin structures, and continuous strand displacement reactions can occur between different hairpin structures to form assemblies; 2) the sequences of the stem and loop parts of the multiple hairpin structures need to be strictly avoided from cross-reaction to ensure that the cascade reaction is triggered only by a specific initiator; 3) the reaction extension direction of the hairpin structure is in three dimensions. Any person skilled in the art can design the DNA sequence according to this principle.
[0020] It should also be understood that in step 1), in addition to using two hairpin structures, three hairpin structures or more hairpin structures can also be used.
[0021] The principle of the present application is illustrated as follows, taking two DNA monomer building blocks (H1 and H2) and one catalytic trigger (I) as an example: The present application designs an isothermal three-dimensional hierarchical organization method similar to catalytic assembly, which assembles DNA into DNA hydrogel with adjustable mechanical strength. Two basic DNA hairpin structures H1 and H2 serve as two metastable monomers for supramolecular copolymerization. The hairpin domains of the two monomers will be opened by fulcrum-mediated hybridization chain reaction under the trigger of trigger I, and induce the mutual hybridization of complementary sequences in the subsequent copolymerization process. The macro-scale assembly of high-concentration DNA hydrogel is regulated by the steric hindrance of the reaction. Trigger I acts as a "catalytic core" to catalyze the dynamic copolymerization of H1 and H2 around it. Due to the domain restriction effect formed during the polymerization process, the more catalytic sites I, the smaller the molecular weight of the DNA supramolecules formed by the reaction. These supramolecules serve as "DNA building blocks" and further crosslink to form DNA hydrogels with different architectural structures, thus having adjustable mechanical properties. Under the condition that the total concentration and sequence of H1 and H2 remain unchanged, the more triggers I, the smaller the primary DNA building blocks formed, resulting in looser DNA hydrogel structures. In contrast, reducing the number of I will result in larger DNA building blocks, resulting in DNA hydrogels with tighter structures.
[0022] It should be understood that the method described in the present application is applicable to various mammalian stem cells, including but not limited to female germ stem cells, mesenchymal stem cells, etc.
[0023] The core inventive point of the present application is to use programmable DNA hydrogel to realize three-dimensional wrapping and regulation of stem cells, solving many technical problems of traditional culture environment and existing hydrogel materials in stem cell culture. Firstly, through the hybridization chain reaction (HCR) of the initiator strand (I) and the hairpin structure DNA (H1, H2), a three-dimensional DNA hydrogel is formed in situ at 37°C physiological conditions, without high temperature, extreme pH or toxic reagents, avoiding damage to stem cells. Secondly, at least two DNA monomer building blocks (H1, H2) with complementary self-assembly domains are used to construct a hairpin structure through denaturation-recombination treatment, and a cascade hybridization reaction is triggered by the initiator strand to realize programmable construction of the hydrogel network. The design principle ensures that the hairpin structure is triggered only by a specific initiator, avoiding cross-reactions and ensuring the specificity and controllability of assembly. Thirdly, the dual optimization of hydrogel performance and stem cell regulation is realized. By adjusting the molar ratio of the initiator strand (I) to the DNA monomer building block (H1, H2) (1:50 to 1:20000), the storage modulus of the hydrogel can be adjusted in the range of 200~2000 Pa, simulating the mechanical microenvironment of different tissues. Fourthly, the DNA hydrogel can be quickly cleaved (15-60 minutes) by nucleases (such as DNase I) to release stem cells, and the activity of the released stem cells is ≥95%, the expression of stemness markers is stable, and the normal proliferation ability (such as Ki67 and EdU positive rate) is restored without difference from untreated cells. Compared with natural substrates (such as Matrigel) which are difficult to degrade or artificial synthetic hydrogels which have harsh degradation conditions, the present method realizes the reversibility and controllability of the wrapping-release process. Fifthly, the composition of the DNA hydrogel is clear (only containing DNA and cell adhesion molecules), and there is no animal-derived component, avoiding immune activation (such as TNF-α, IL-6, etc. pro-inflammatory factor levels have no difference with the control group) caused by heterologous substances.
[0024] According to the method for wrapping stem cells by using programmable DNA hydrogel and the application thereof provided by the present application, the following advantages are achieved compared with the prior art:
[0025] 1) The gelation reaction condition of the DNA hydrogel is mild, and the polymerization and assembly of DNA can occur in situ under normal cell culture conditions to form 3D wrapping of stem cells;
[0026] 2) The DNA hydrogel has controllable degradation ability under normal cell culture conditions, and can be quickly degraded and release the wrapped cells under the action of nucleases;
[0027] 3) The DNA hydrogel has good biocompatibility, the encapsulated stem cells can maintain activity and stemness, have no obvious immune activation effect (immunotoxicity), and can restore cell proliferation ability after being released, which is comparable to that of unencapsulated stem cells. Therefore, the system can provide a new tool for in vitro culture and engineering application of stem cells.
[0028] In summary, the present application provides a method for encapsulating stem cells with programmable DNA hydrogel and its application, which reversibly encapsulates and releases stem cells by forming a 3D network in situ under isothermal physiological conditions through programmable DNA hydrogel. The method significantly maintains the activity and stemness of stem cells, has no obvious immune activation, and the stem cells can restore normal proliferation ability after being released. The method provides a new tool for in vitro culture and engineering application of stem cells, which has significant innovation and practicality. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 A flowchart of a method for encapsulating stem cells with programmable DNA hydrogel according to the present application;
[0030] Figure 2 A laser confocal photo of female germ stem cells as an example, which are labeled with PKH-26 fluorescent dye and distributed in a three-dimensional DNA hydrogel;
[0031] Figure 3 MTS test results of female germ stem cells after being encapsulated in DNA hydrogel for different times;
[0032] Figure 4 Cytokine expression levels (TNF-α, IL6, IFN-β) of female germ stem cells treated with DNA hydrogel components (H1, H2); 0 pg / mL and 31.250 pg / mL are the concentrations of standard samples in the kit test process, ssDNA-H1 refers to H1 single-strand without forming a hairpin, and H2 hairpins refer to H2 hairpin structures obtained by denaturation and renaturation treatment;
[0033] Figure 5 Female germ stem cells as an example, after being encapsulated in DNA hydrogel and released for culture, the proportion of cells positive for cell proliferation markers Ki67 and EdU immunostaining. DETAILED DESCRIPTION
[0034] The present application is further described below in connection with the detailed examples. It should be understood that the examples below solely serve to illustrate the present application and are not intended to limit the scope of the present application. Unless otherwise specified, the technical means used in the examples are routine operations in the art, or are in accordance with the experimental methods suggested by the manufacturers of the kits and apparatuses. The reagents and materials used in the examples are commercially available unless otherwise specified.
[0035] Example 1 encapsulating three-dimensional culture of female germ stem cells using different DNA hydrogels
[0036] 1.1 A method for encapsulating female germ stem cells using different DNA hydrogels is provided, the flow chart of which is shown in Figure 1 , and specifically comprises the following steps:
[0037] (1) Three DNA strands H1, H2, and I (sequences are shown in Table 1) are respectively dissolved in MEM-α basic medium, with a final concentration of 2 mM for H1, 4 mM for H2, and 100 μM for I.
[0038] (2) H1 (2 mM, 12 μL) and H2 (4 mM, 6 μL) solutions are taken and added to different PCR tubes, heated at 95°C for 5 minutes, and then quickly placed on ice for 120 minutes to form hairpin structures.
[0039] (3) Female germ stem cells are seeded on a mitomycin-treated STO cell feeder layer that no longer has mitotic activity, and cultured in MEM-α medium supplemented with 10% fetal bovine serum, 10 ng / mL basic fibroblast growth factor (bFGF), 10 ng / mL human epidermal growth factor (EGF), 10 ng / mL human glial cell line-derived neurotrophic factor (GDNF), 10 ng / mL human leukemia inhibitory factor (LIF), 1 mM NEAA, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM β-mercaptoethanol, and 1% penicillin-streptomycin double-antibiotic solution, and cultured in a 6 cm diameter cell culture dish.
[0040] (4) The medium in the solution obtained in step (3) is removed, washed with PBS, and 0.05% EDTA-trypsin is added, and the cells are digested at 37°C for 1 minute. The digestion is terminated by adding complete medium, and the cells are centrifuged at 1000 rpm for 5 minutes, resuspended in complete medium, and counted.
[0041] (5) H1 (2 mM, 12 μL) and H2 (4 mM, 6 μL) in step (2) are mixed in the same centrifuge tube, and 20 μL of the cell suspension in (4) is added, with a total cell number of 3 x 10 4One, according to different reaction ratio, add different volume of initiation chain I, and 1 μL of RGD polymerization polypeptide (20 mM, as shown in Table 2), the total volume of the system is 40 μL, after mixing, add to the 96-well plate, incubate at 37°C for 3 hours, form the DNA hydrogel encapsulation system of female germ stem cells, continue to culture in the cell incubator.
[0042] (6) The DNA hydrogel in step (5) is cleaved by DNase I (1 U / μL), and the female germ stem cells are extracted therefrom and added to a 6 cm culture dish coated with mitomycin-treated STO cells, complete culture medium is added, and the cells are cultured for 24 hours to restore proliferative activity.
[0043] (7) EdU (10 μM) is added to the culture medium in step (5) and incubated for 4 hours. The DNA hydrogel is cleaved by DNase I (1 U / μL), and the female germ stem cells are extracted therefrom, the cells are fixed with 4% paraformaldehyde and permeabilized with 0.4% Triton X-100, then blocked in 1% BSA, and incubated with Ki67 primary antibody at 4°C overnight. After washing with PBS for three times, secondary antibody fluorescent antibody is used. The cell nucleus is stained with Hoechst 33342. Immunostaining pictures are obtained by taking pictures with a laser confocal fluorescence microscope.
[0044] Table 1. DNA sequence
[0045] DNA name DNA sequence (5'-3') I CTAGAGCACAATCACAGGAGCCAG H1 GATCGCGATCCTGGCTCCTGTGATTGTGCTCTAGACATCGCTAGAGCACAATCACAGG H2 CTAGAGCACAATCACAGGAGCCAGTTTTCCTGTGATTGTGCTCTAGCGATGT
[0046] Table 2. RGD polymerization polypeptide sequence
[0047] Polypeptide name Sequence (N-C) RGD KKKKKK-(PEG3)-GRGDS
[0048] 1.2 Laser confocal detection of three-dimensional distribution of female germ stem cells labeled with PKH-26 fluorescent dye in DNA hydrogel
[0049] Taking female germ stem cells as an example, the female germ stem cells are labeled with PKH-26 fluorescent dye, and the DNA hydrogel prepared in 1.1 is encapsulated for 48 hours, and then observed by laser confocal.
[0050] The results are shown in Figure 2 , the fluorescence signal is still in a three-dimensional distribution state, indicating that the stem cells are in a three-dimensional culture state of DNA hydrogel encapsulation.
[0051] 1.3 MTS test of DNA hydrogel toxicity to stem cells
[0052] As an example, female reproductive stem cells were encapsulated in soft DNA hydrogel for different time length (from 24 hours to 72 hours) and MTS test was performed to verify whether the DNA hydrogel was toxic to the stem cells.
[0053] As shown in Figure 3 , the MTS test results remained basically unchanged, indicating that the number of living cells remained basically unchanged, indicating that the DNA hydrogel had no obvious toxicity to the stem cells.
[0054] 1.4 Detection of the immunostimulatory effect of DNA hydrogel components on stem cells
[0055] After female reproductive stem cells (total amount 1 x 10 4 were inoculated in a 24-well plate for 48 hours, they were treated with double-stranded DNA (H2 hairpin structure, final concentration 200 μM) or single-stranded DNA (H1, final concentration 200 μM) for 24 hours. ELISA kit was used to detect the levels of TNF-a, IL6, IFN-b proinflammatory factors in the cell supernatant.
[0056] As shown in Figure 4 , as an example, after treatment with high-concentration DNA hydrogel components (H1, H2), the cytokine expression levels (TNF-a, IL6, IFN-b) of female reproductive stem cells had no obvious difference from the control group (without DNA treatment), indicating that the DNA hydrogel components had no obvious immunostimulation to the stem cells.
[0057] 1.5 Detection of the cell cycle state and proliferation ability of female reproductive stem cells after encapsulation and release of DNA hydrogel
[0058] Ki67 positive marker is in the active cell cycle (S, G1, G2 and M phase), while EdU positive specifically indicates S phase cells. Based on this double labeling technique, the cell cycle state can be accurately analyzed (for example, Ki67 and EdU double negative cells indicate resting phase / G0 phase). Female reproductive stem cells (total amount 3 x 10 4 were embedded in DNA hydrogel and cultured in a 96-well plate for 48 hours. EdU was added to the culture medium (final concentration 10 μM) during the EdU labeling stage and incubated for 4 hours. Then the cells were recovered by DNase I lysis of the DNA hydrogel, fixed with 4% paraformaldehyde, perforated with 0.4% Triton X-100 and blocked with 1% BSA, then incubated with Ki67 primary antibody at 4°C overnight, washed with PBS for three times, then added with fluorescent secondary antibody, and imaged by confocal microscope. The same operation was performed on 2D cultured cells for labeling and staining.
[0059] As shown in Figure 5As shown, under standard 2D adherent culture conditions, female germline stem cells exhibited high levels of cell proliferation marker Ki67 (Ki67+) and high DNA replication activity (EdU+). After releasing the encapsulated female germline stem cells from the gel by using DNase (DNase I), the released female germline stem cells were recovered to 2D adherent culture. After 24 hours of culture, the released female germline stem cells showed high levels of Ki67 and EdU positivity, which was not significantly different from the cells without DNA hydrogel treatment, indicating that the female germline stem cells encapsulated by DNA hydrogel could recover the proliferation activity after releasing from the gel.
[0060] The above description is only the preferred embodiment of the present application, not to limit the scope of the present application, the above embodiment of the present application can also be made various changes. Any simple, equivalent changes and modifications made in accordance with the content of the claims and the description of the present application, all fall within the scope of the present application. The present application is not described in detail, all are conventional technical content.
Claims
1. A method for encapsulating stem cells using a programmable DNA hydrogel, characterized in that, Under isothermal physiological conditions, a three-dimensional DNA hydrogel is formed through a hybridization chain reaction of the initiating chain (I) and hairpin structure DNA to achieve reversible encapsulation and release of stem cells. The hairpin structure DNA is formed by denaturation-renaturation treatment of at least two DNA monomer building blocks with complementary self-assembly domains. The mechanical stiffness of the hydrogel is achieved by regulating the molar ratio of the initiating chain (I) to the total amount of DNA monomer building blocks. The DNA hydrogel can reversibly encapsulate and release stem cells, and the encapsulated stem cells can maintain their activity and stemness, and restore their normal proliferative capacity after release.
2. The method according to claim 1, characterized in that, Includes the following steps: 1) Dissolve the initiating chain (I) and DNA monomer building blocks (H1, H2) separately in the cell basal medium; 2) The solutions of DNA monomer building blocks (H1, H2) were subjected to heating denaturation annealing to form the first hairpin structure and the second hairpin structure, respectively; 3) Mix the first hairpin structure and the second hairpin structure, add stem cell suspension, priming chain (I) and cell adhesion molecules, mix and place in a culture container, incubate under physiological conditions to form a system in which DNA hydrogel encapsulates stem cells; 4) Use nucleases to lyse DNA hydrogels and release stem cells.
3. The method according to claim 1, characterized in that, The storage modulus of the DNA hydrogel ranges from 200 to 2000 Pa, which is achieved by adjusting the molar ratio of the initiation chain (I) to the total amount of DNA monomer building blocks (H1, H2).
4. The method according to claim 1, characterized in that, The molar ratio of the initiating chain (I) to the total amount of DNA monomer building blocks (H1, H2) is between 1:50 and 1:20000.
5. The method according to claim 2, characterized in that, The stem cells include female germline stem cells or mesenchymal stem cells, and the cell basal culture medium is MEM-α medium containing 10% fetal bovine serum, bFGF, EGF, GDNF, and LIF.
6. The method according to claim 2, characterized in that, In step 3), the cell adhesion molecule is an RGD polymeric polypeptide.
7. The method according to claim 2, characterized in that, In step 3), the cells are incubated at 30-37°C for 1-5 hours to form a DNA hydrogel-encapsulated stem cell system.
8. The method according to claim 2, characterized in that, In step 4), the nuclease includes DNase I, the nuclease concentration is 0.5-2 U / μL, and the lysis time is 15-60 minutes.
9. The application of the method according to any one of claims 1 to 8 in the preparation of a three-dimensional stem cell culture system, characterized in that, By regulating the molar ratio of the total amount of initiating chain (I) to DNA monomer building blocks (H1, H2), DNA hydrogels with different storage moduli can be formed, maintaining stem cell activity ≥95% and stable expression of stem cell markers, which can be used for large-scale in vitro expansion of stem cells.
10. The application of the method as described in any one of claims 1 to 8 in the field of regenerative medicine as a stem cell transplantation vector.
Citation Information
Cited By
A DFN-guided dual-lock hydrogel interface for cell membrane surface, its preparation method and application
CN122405553A