Application of exosome overexpressing CAP gene and LGR5 gene in preparation of medicine for treating cartilage inflammation

Abstract

The invention relates to the technical field of biomedicine, and particularly discloses application of an exosome overexpressing a CAP gene and an LGR5 gene in preparation of a medicine for treating cartilage inflammation. The exosome for overexpressing the CAP gene and the LGR5 gene has targeting and cartilage protection functions, can be swallowed by cartilage cells and targeted to the cartilage cells, can improve the levels of a gene Col2a1 for cartilage generation and a gene Sox9 for regulating cartilage development, and can reduce the level of a gene Mmp13 for cartilage degradation, so that the exosome can be applied to cartilage protection of cartilage cells. The cartilage abrasion of osteoarthritis mice is relieved, and knee joints are protected, so that cartilage generation can be promoted, cartilage aging is relieved, and cartilage degradation is reduced in a complex inflammation environment. Furthermore, the invention provides the mesenchymal stem cell exocrine for over-expression of CAP / LGR5, a new technical scheme is provided for targeted therapy based on stem cell engineering, and the mesenchymal stem cell exocrine has a wide application prospect.

Description

TECHNICAL FIELD

[0001] The application relates to the field of biomedical technology, and particularly discloses application of exosomes overexpressing CAP genes and LGR5 genes in preparation of a drug for treating cartilage inflammation. BACKGROUND

[0002] At present, conventional treatment methods for cartilage inflammation (such as arthritis) mainly include drug treatment and surgical treatment, wherein the drugs include non-steroidal anti-inflammatory drugs and glucocorticoids. However, these conventional treatment methods generally have the disadvantages of large side effects, serious adverse reactions, high cost or the need for further improvement of the efficiency.

[0003] In recent years, mesenchymal stem cells (MSCs) and exosomes secreted by the MSCs have gradually become a research hotspot for cartilage repair and inflammation treatment. However, the existing MSC exosomes have the following disadvantages in treating cartilage inflammation: (1) the effect of the exosomes on anti-inflammation and promotion of cartilage repair is limited, and the demand of a complex inflammation environment cannot be met; (2) the utilization rate of the exosomes is low, the function and yield of the exosomes are limited, and the exosomes have poor target specificity after joint cavity injection, and the demand of clinical application cannot be met. SUMMARY

[0004] In view of the deficiencies in the prior art, the application provides application of exosomes overexpressing CAP genes and LGR5 genes in preparation of a drug for treating cartilage inflammation. The exosomes overexpressing CAP genes and LGR5 genes provided in the application have cartilage targeting and functionality, can better combine with chondrocytes, improve the utilization rate of the exosomes, promote cartilage generation, relieve cartilage aging and reduce cartilage degradation in a complex inflammation environment.

[0005] To achieve the above application purposes, the application adopts the following technical solutions: In a first aspect, the application provides application of exosomes overexpressing CAP genes and LGR5 genes in preparation of a drug for treating cartilage inflammation.

[0006] The exosomes overexpressing CAP genes and LGR5 genes provided in the application have both targeting and cartilage inflammation treatment functions, specifically, the exosomes can be more phagocytosed by chondrocytes, target chondrocytes, have the ability to improve the levels of the cartilage generation gene Col2a1 and the cartilage development regulation gene Sox9 and reduce the level of the cartilage degradation gene Mmp13, and thus can promote cartilage generation, relieve cartilage aging and reduce cartilage degradation in a complex inflammation environment.

[0007] Preferably, the nucleotide sequence of the CAP gene is shown in SEQ ID No. 1.

[0008] In the present application, CAP, as a targeting peptide, has a cartilage targeting effect. Cell experiments show that the green fluorescence of the exosomes overexpressing CAP gene and LGR5 gene is more than that of the conventional exosomes not overexpressing CAP gene, which indicates that the exosomes overexpressing CAP gene and LGR5 gene are more likely to be phagocytosed by chondrocytes and have stronger targeting effect.

[0009] Exemplarily, LAMP2B is highly expressed on the surface of exosomes, and in the present application, the gene sequence of CAP is added at the end of the LAMP2B gene to construct a LAMP2B-CAP overexpression plasmid.

[0010] Preferably, the cartilage inflammation includes at least one of osteoarthritis, osteochondritis dissecans, tibial tuberosity osteochondritis, patellar chondromalacia or secondary cartilage inflammation.

[0011] In a second aspect, the present application provides a mesenchymal stem cell exosome overexpressing CAP / LGR5, which is an exosome of human umbilical cord-derived mesenchymal stem cells (UCMSCs) overexpressing CAP gene and LGR5 gene.

[0012] UCMSCs have multiple differentiation ability, low immunogenicity and paracrine effect, and can regulate local microenvironment and promote tissue repair and anti-inflammatory effect through exosome secretion. Therefore, the present application uses the exosome of human umbilical cord-derived mesenchymal stem cells as a carrier to overexpress CAP gene and LGR5 gene.

[0013] In a third aspect, the present application provides a preparation method of the above-mentioned mesenchymal stem cell exosome overexpressing CAP / LGR5, which comprises the following steps: after the coding gene of the targeting peptide CAP is connected with the coding gene of LGR5 protein, the connection is transfected into human umbilical cord-derived mesenchymal stem cells, cultured, and the precipitate is obtained by solid-liquid separation, resuspended and filtered to obtain the mesenchymal stem cell exosome overexpressing CAP / LGR5.

[0014] Preferably, the coding gene of the targeting peptide CAP is connected with the coding gene of LGR5 protein by using 2A peptide connection. The coding gene of the 2A peptide is shown in SEQ ID No. 3.

[0015] Preferably, the preparation method of the mesenchymal stem cell exosome overexpressing CAP / LGR5 specifically comprises the following steps: constructing a LGR5-LAMP2B-CAP overexpression plasmid, transfecting into human umbilical cord-derived mesenchymal stem cells, culturing for 48-60 hours, centrifuging to obtain supernatant, differentially centrifuging to obtain precipitate, resuspending, filtering to obtain the mesenchymal stem cell exosome overexpressing CAP / LGR5.

[0016] Exemplarily, the conditions of the differential centrifugation are: 4℃ 300g centrifugation for 10 minutes→4℃ 3000g centrifugation for 10 minutes→4℃ 10000g centrifugation for 30 minutes→4℃ 100000g centrifugation for 70 minutes, to obtain a precipitate; Exemplarily, after the precipitate is resuspended in PBS buffer, it is filtered through a 0.22-0.3 mu m filter screen to obtain the mesenchymal stem cell exosome overexpressing CAP / LGR5.

[0017] Preferably, the method for constructing the LGR5-LAMP2B-CAP overexpression plasmid comprises the following steps: synthesizing an LGR5-LAMP2B-CAP gene comprising an LGR5 gene, an LAMP2B gene and a CAP gene, and inserting the LGR5-LAMP2B-CAP gene into a GV658 plasmid to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

[0018] Preferably, the nucleotide sequence of the LGR5-LAMP2B-CAP gene is shown in SEQ ID No. 2.

[0019] Further preferably, the method for constructing the LGR5-LAMP2B-CAP overexpression plasmid specifically comprises the following steps: The LGR5-LAMP2B-CAP gene is subjected to KpnI / PacI double digestion together with the GV658 plasmid, and after homologous recombination, PCR amplification is performed to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

[0020] The present application realizes the co-expression of two functional proteins by connecting the targeting peptide CAP with the coding gene of the functional protein LGR5 and then co-transfecting them into human umbilical cord-derived mesenchymal stem cells, and prepares the mesenchymal stem cell exosome overexpressing CAP / LGR5, which has both targeting property and therapeutic function. Existing researches show that the LGR5 gene is highly expressed in the biological development process. In the present application, the UCMSCs transfected with the LGR5-LAMP2B-CAP overexpression plasmid overexpress the LGR5 gene, which changes the gene of the cells and further affects the phenotype of the cells, so that the UCMSCs have stronger stemness and the exosomes secreted by the UCMSCs have stronger targeting property, and have better therapeutic effect on osteoarthritis and the like.

[0021] The present application provides a mesenchymal stem cell exosome overexpressing CAP / LGR5 with synergistically enhanced targeting property and therapeutic function, which breaks through the technical bottleneck that the therapeutic effect of a single targeting peptide exosome is limited in the prior art. The hydrogel microspheres prepared by using the exosome can effectively relieve the cartilage wear of an osteoarthritis mouse and protect the knee joint. The present application can provide a new technical solution for targeted therapy based on stem cell engineering, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0023] Figure 1 Plasmid map of the LAMP2B-CAP overexpression plasmid in the embodiment 1 of the present application; Figure 2 Plasmid map of the LGR5-LAMP2B-CAP overexpression plasmid in the embodiment 1 of the present application; Figure 3 Plasmid map of the GV658 plasmid in the embodiment 1 of the present application; Figure 4 Transmission electron microscope images of the control exosome, the targeting peptide exosome and the LGR5 overexpression targeting peptide exosome in the embodiment 1 of the present application; Figure 5 Particle size distribution graph of the three kinds of exosomes in the embodiment 1 of the present application; Figure 6 Western blotting detection of the expression of three genes TSG101, CD9 and CD81 of the three kinds of exosomes in the embodiment 1 of the present application; Figure 7 Relative expression of Col2a1, Sox9 and Mmp13 genes in different groups in the embodiment 2 of the present application; Figure 8 Fluorescence images of the transfected chondrocytes of the control exosome and the LGR5 overexpression targeting peptide exosome in the embodiment 2 of the present application; Figure 9 Statistical result analysis of the fluorescence of the transfected chondrocytes of the control exosome and the LGR5 overexpression targeting peptide exosome in the embodiment 2 of the present application; Figure 10 Cell fluorescence images for determining the expression of LGR5 of the human umbilical cord mesenchymal stem cells and the LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells in the embodiment 2 of the present application; Figure 11 Statistical graph of the relative expression amount of LGR5 in the human umbilical cord mesenchymal stem cells and the LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells in the embodiment 2 of the present application; Figure 12 Microscope bright field image of the hydrogel microspheres containing the LGR5 overexpression targeting peptide exosome in the embodiment 3 of the present application; Figure 13Figure 1 is a chart of safranin O and fast green staining of sagittal paraffin sections of knee joint cartilage of mice in different groups in Example 3 of the present application. Figure 14 Figure 2 is a chart of OARSI score of knee joint of mice in different groups in Example 3 of the present application. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0025] Unless otherwise specified, the experimental methods, detection methods and preparation methods disclosed in the present application all adopt conventional techniques in the technical field.

[0026] In order to better illustrate the embodiments of the present application, the following examples are further illustrated.

[0027] In the present application, the primary human umbilical cord-derived mesenchymal stem cells are purchased from OriCell Company, and the item number is HUXUC-01001.

[0028] Example 1 The embodiments of the present application provide a preparation method of mesenchymal stem cell exosomes overexpressing CAP / LGR5, and the performance of the prepared exosomes is characterized. Specifically as follows: Firstly, the embodiments of the present application provide a preparation method of mesenchymal stem cell exosomes overexpressing CAP / LGR5, and the preparation method specifically includes the following steps: Shanghai Jikai Gene Medical Technology Co., Ltd. is commissioned to construct LAMP2B-CAP overexpression plasmid and LGR5-LAMP2B-CAP overexpression plasmid. The specific content is as follows: (1) Construction of LAMP2B-CAP overexpression plasmid According to the NCBI query of human LAMP2B gene and CAP gene, LAMP2B-CAP gene is spliced and designed, and enzyme digestion sites are introduced at both ends of the gene. The whole gene is synthesized. After the sequencing of the target fragment is correct, the primer amplification is arranged, the gel purification is recovered, and the LAMP2B-CAP gene is obtained. The primer sequence and amplification conditions of PCR are shown in Tables 1-2. The nucleotide sequence of the CAP gene is shown in SEQ ID No. 1, and the nucleotide sequence of the LAMP2B-CAP gene is shown in SEQ ID No. 4.

[0029] After double enzyme digestion of GV658 plasmid by KpnI / PacI, the recovered vector fragment was purified and mixed with the amplified and purified fragment in the previous step using a homologous recombination kit. The following reaction system was prepared in an ice water bath. The mixture was mixed gently by pipetting, centrifuged briefly, and air bubbles were avoided. The reaction was carried out at 37°C for 30 min, and then cooled in an ice water bath for 5 min before transformation. The LAMP2B-CAP recombinant plasmid was obtained after recombination. The reaction system is shown in Table 3.

[0030] Table 1

[0031] Table 2

[0032] Table 3

[0033] The above LAMP2B-CAP recombinant plasmid 10 μL was added to 100 μL competent E. coli, mixed gently by tapping the tube wall, and placed on ice for 30 min. 42°C heat shock for 90 s, ice water bath incubation for 2 min. Add 500 μL of antibiotic-free LB medium, and incubate at 37°C on a shaker for 1 h. Take an appropriate amount of bacterial solution and evenly coat on the plate containing the corresponding antibiotic, and incubate in a constant temperature incubator for 12-16 h. After colony screening, the target gene product was identified, and the primer sequence and amplification conditions of the identified gene are shown in Tables 4-5.

[0034] Table 4

[0035] Table 5

[0036] Sequencing result analysis, sequence consistent with the expected is the correct recombinant plasmid, recorded as LAMP2B-CAP overexpression plasmid. Among them, the plasmid map of LAMP2B-CAP overexpression plasmid is shown in Figure 1 , and the plasmid map of GV658 plasmid is shown in Figure 3 .

[0037] (2) Construction of LGR5-LAMP2B-CAP overexpression plasmid According to the NCBI query LGR5 gene (accession number NM_003667.4), splice design LGR5-LAMP2B-CAP gene. At the end of LAMP2B-CAP gene sequence with 2A peptide connected NM_003667.4, respectively, introduce restriction sites at both ends of the gene, arrange the whole gene synthesis. After sequencing the correct fragment, arrange the primer amplification, wherein the PCR primer sequence is shown in Table 6, and the amplification condition is shown in Table 2. The amplified product was recovered by gel purification, and the LGR5-LAMP2B-CAP gene was obtained. Among them, the nucleotide sequence of LGR5-LAMP2B-CAP gene is shown in SEQ ID No. 2, and the coding gene of 2A peptide is shown in SEQ ID No. 3.

[0038] After double enzyme digestion of GV658 plasmid by KpnI / PacI, the purified and recovered vector fragment was mixed with the amplified and purified fragment in the previous step using a homologous recombination kit, and the following reaction system was prepared in an ice water bath. Mix gently with a pipette, centrifuge briefly, and avoid air bubbles. React at 37°C for 30 min, then cool in ice water bath for 5 min, then transform immediately. The recombinant LGR5-LAMP2B-CAP recombinant plasmid was obtained. The reaction system is shown in Table 3.

[0039] Table 6

[0040] The above LGR5-LAMP2B-CAP recombinant plasmid 10 µL was added to 100 µL competent E. coli, mixed gently, and placed on ice for 30 min. Heat shock at 42°C for 90 s, and incubate in ice water bath for 2 min. Add 500 µL of antibiotic-free LB medium, and incubate at 37°C on a shaker for 1 h. Take an appropriate amount of bacterial solution and evenly spread on plates containing the corresponding antibiotic, and incubate in a constant temperature incubator for 12-16 h. After colony screening, the target gene product was identified, and the primer sequence for identifying the gene is shown in Table 7, and the amplification condition is shown in Table 5.

[0041] Table 7

[0042] The sequencing result analysis, the sequence is correct if it meets the expectation, is recorded as LAMP2B-CAP overexpression plasmid. Among them, the plasmid map of LGR5-LAMP2B-CAP overexpression plasmid is shown in Figure 2 .

[0043] Among them, the nucleotide sequence shown in SEQ ID No. 1 is: GACTGGAGAGTGATCATCCCACCAAGACCTTCTGCC.

[0044] The nucleotide sequence represented by SEQ ID No. 2 is specifically:

[0045] The nucleotide sequence represented by SEQ ID No. 3 is specifically: CGGCGGAAGCGGGGCAGCGGCGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT.

[0046] The nucleotide sequence represented by SEQ ID No. 4 is specifically:

[0047] (3) Preparation of exosomes The primary human umbilical cord-derived mesenchymal stem cells were subcultured to the fifth generation, and the cells were changed when they grew to 80%. LGR5-LAMP2B-CAP overexpression plasmid and LAMP2B-CAP overexpression plasmid were transfected, and a non-transfected group was used as a control group. After 6 hours, the exosome-free serum medium was used, and the supernatant was collected after 48 hours for differential centrifugation to obtain the precipitate, which was resuspended with 100 μL PBS and filtered through a 0.22 micron filter to obtain the corresponding exosomes.

[0048] Among them, the exosomes obtained by transfecting LGR5-LAMP2B-CAP overexpression plasmid are mesenchymal stem cell exosomes overexpressing CAP / LGR5, and are recorded as overexpressing LGR5-targeting peptide exosomes; The exosomes obtained by transfecting LAMP2B-CAP overexpression plasmid are mesenchymal stem cell exosomes overexpressing CAP, and are recorded as targeting peptide exosomes; The exosomes prepared without transfecting plasmid are conventional exosomes, which are recorded as control exosomes in the figures of the present application.

[0049] The transfection method in this embodiment is as follows: Lipo3000 kit (the kit contains two solutions of Lipo3000 and P3000) is used for transfection, 2.5 x 10 6 The cell amount is taken as an example: 125 μL of serum-free medium is mixed with 7.5 μL of lipo3000 for 3 seconds to form A liquid; 125 μL of serum-free medium, 2.5 μg of plasmid, and 5 μL of P3000 form B liquid. After mixing A liquid and B liquid at a volume ratio of 1:1 and standing for 15 minutes, they are added dropwise into the culture medium for transfection.

[0050] The conditions of differential centrifugation are as follows: 4℃ 300g centrifugation for 10 minutes→4℃ 3000g centrifugation for 10 minutes→4℃ 10000g centrifugation for 30 minutes→4℃ 100000g centrifugation for 70 minutes, to obtain the precipitate.

[0051] Secondly, the microstructure, particle size and its distribution, and the expression of related genes of the control exosomes, the targeting peptide exosomes, and the overexpressing LGR5-targeting peptide exosomes prepared above are investigated, wherein the transmission electron microscope images of the control exosomes, the targeting peptide exosomes, and the overexpressing LGR5-targeting peptide exosomes are shown in Figure 4 The particle size distribution graphs of the three kinds of exosomes are shown in Figure 5 The expression of the three genes TSG101, CD9, and CD81 of the three kinds of exosomes is detected by Western blotting, as shown in Figure 6

[0052] Figures 4-5 ​​It can be known that the three kinds of exosomes, the exosome, the targeting peptide exosome and the LGR5 targeting peptide exosome overexpressing have no significant difference in morphology, and all have spherical vesicle morphology; the average particle sizes of the exosome, the targeting peptide exosome and the LGR5 targeting peptide exosome overexpressing are 119.83 nm, 179.53 nm and 46.64 nm respectively, and the particle size and its distribution meet the requirements of the relevant standards.

[0053] By Figure 6 It can be known that the three kinds of exosomes, the exosome, the targeting peptide exosome and the LGR5 targeting peptide exosome overexpressing have no significant difference in morphology, and all have spherical vesicle morphology; the average particle sizes of the exosome, the targeting peptide exosome and the LGR5 targeting peptide exosome overexpressing are 119.83 nm, 179.53 nm and 46.64 nm respectively, and the particle size and its distribution meet the requirements of the relevant standards.

[0054] Example 2 The present application verifies the function and targeting of the LGR5 targeting peptide exosome overexpressing obtained in Example 1, and the specific steps are as follows: 1. Treatment function experiment on inflammatory chondrocytes The present application first prepares inflammatory chondrocytes, and the specific method is as follows: the joint cartilage of a 3-day-old newborn mouse is extracted, and the cells are subcultured when the cell density reaches 90%, and the first generation of chondrocytes is obtained after one subculture and two subcultures. The subculture medium is DMEM:F12 1:1 medium+10% serum+1% double antibody, and the culture conditions are 37℃, 5% carbon dioxide. The mouse recombinant interleukin β1 factor (manufacturer: Joe biological, product number: CM002-5MP) is added to the culture medium of the second generation of chondrocytes, and the concentration is 3ng / mL. After 24 hours, the culture medium is changed, and the inflammatory chondrocytes are obtained.

[0055] The control exosome, the targeting peptide exosome and the LGR5 targeting peptide exosome overexpressing are added to 2.5×10 6 Inflammatory chondrocytes at a concentration of 50μg / mL, and cultured at 37℃, 5% carbon dioxide for 72 hours. After that, RNA is extracted for reverse transcription and qPCR amplification to verify the treatment effect, and the results are shown in Figure 7 .

[0056] By Figure 7It can be seen that the targeted peptide exosome treatment group and the LGR5 overexpression targeted peptide exosome treatment group have better treatment effect after intervention on inflammatory chondrocytes, the genes Col2a1 promoting chondrogenesis and the gene Sox9 regulating cartilage development have an increasing trend and have statistical difference, the LGR5 overexpression targeted peptide exosome treatment group is significantly better than the targeted peptide exosome treatment group, and the targeted peptide exosome treatment group is significantly better than the control exosome treatment group. The gene Mmp13 promoting cartilage degradation has a decreasing trend and has statistical difference in the targeted peptide exosome treatment group and the LGR5 overexpression targeted peptide exosome treatment group, the LGR5 overexpression targeted peptide exosome treatment group is significantly lower than the targeted peptide exosome treatment group, and the targeted peptide exosome treatment group is significantly lower than the control exosome treatment group. Exosomes are small membrane vesicles containing complex RNA and proteins secreted by cells through exocytosis. After transfection of the LGR5-LAMP2B-CAP overexpression plasmid, the cells may have changed, making the exosomes have better treatment effect.

[0057] 2. Targeting experiment 50 μg of control exosomes and LGR5 overexpression targeted peptide exosomes were respectively labeled with 10 μM DIO, and were respectively added to 1 × 10 6 chondrocytes, and acted for 8 h.

[0058] 1 × 10 6 chondrocytes were dyed with 10 μM DID for 20 min, and then the fluorescence was observed by fluorescence microscope and the data was statistically analyzed. The fluorescence images of the transfected chondrocytes of the control exosomes and the LGR5 overexpression targeted peptide exosomes are specifically shown in Figure 8 , and the statistical results of the fluorescence of the transfected chondrocytes of the control exosomes and the LGR5 overexpression targeted peptide exosomes are shown in Figure 9 .

[0059] It can be seen from Figure 8 that the green fluorescence of the LGR5 overexpression targeted peptide exosomes is more than that of the exosomes, proving that the LGR5 overexpression targeted peptide exosomes are more phagocytosed by chondrocytes, and the red fluorescence of the two groups of exosomes is the same, proving the more targeted effect. Figure 9 Quantitative analysis of fluorescence intensity shows the same results, and it can be seen that the LGR5 overexpression targeted peptide exosomes have a targeted effect.

[0060] 3. Expression amount of LGR5 The expression amount of LGR5 in human umbilical cord mesenchymal stem cells and LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells was measured by cell fluorescence and qPCR technology, and the determination results are shown in Figures 10-11The untransfected group is human umbilical cord mesenchymal stem cells, and the transfected group is LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells.

[0061] Figure 10 To determine the cell fluorescence map of LGR5 expression in human umbilical cord mesenchymal stem cells and LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells, the green fluorescence is the spontaneous fluorescence of the cells after transfection of the plasmid, and the red fluorescence is the fluorescence of the LGR5-LAMP2B-CAP overexpression plasmid. Figure 10 It can be seen that the LGR5-LAMP2B-CAP overexpression plasmid is successfully transfected and expressed.

[0062] Figure 11 The relative expression amount of LGR5 in human umbilical cord mesenchymal stem cells and LGR5-LAMP2B-CAP overexpression plasmid transfected human umbilical cord mesenchymal stem cells is shown in the histogram. Figure 11 It can be seen that the LGR5 expression amount of the cells after transfection of the plasmid is increased by more than 2 times.

[0063] Example 3 The overexpression LGR5 targeting peptide exosome obtained in Example 1 is prepared into a hydrogel microsphere, and the effect of the exosome on an osteoarthritis model animal is verified through an animal experiment, and the specific process is as follows: 1. Preparation of hydrogel microspheres Hyaluronic acid (item number H874944, purchased from the company of Mercklin) is dissolved in PBS with a pH of 7.4 to prepare a hyaluronic acid solution with a mass concentration of 2%. The hyaluronic acid solution is mixed with methacrylic anhydride (item number M102519, purchased from the company of Aldrich) at a molar ratio of 2.6:1 in an ice bath with continuous stirring, and the pH value is kept at 8.0. After 12 hours of reaction, the reaction solution is purified by dialysis in deionized water for 3 days using a dialysis bag with a molecular weight cut-off of 100 kDa. The purified solution is freeze-dried to obtain methacrylated hyaluronic acid.

[0064] The methacrylated hyaluronic acid and the overexpression LGR5 targeting peptide exosome are prepared into hydrogel microspheres with a diameter of about 200 μm using microfluidic technology, and the composition and mass ratio of the microspheres are methacrylated hyaluronic acid: exosome: initiator = 40:6:4. The generated microspheres are irradiated by a 405 nm ultraviolet lamp for 5 minutes for crosslinking and solidification. After crosslinking and solidification, the hydrogel microspheres containing the overexpression LGR5 targeting peptide exosome are obtained. The initiator is lithium phenylphosphinate.

[0065] The microscope bright field image of the prepared hydrogel microspheres containing the overexpression LGR5 targeting peptide exosome is shown in Figure 12 As shown in Figure 12It can be seen that the hydrogel has been successfully prepared into microspheres. The microspheres have similar particle size and regular shape, and are uniformly dispersed in the field of view without adhesion or aggregation. The whole exhibits good uniformity and stability.

[0066] 2. Animal experiments Thirty-five 12-week-old male C57BL / 6J rats were randomly divided into five groups. Four groups underwent medial meniscus instability surgery (DMM), followed by intra-articular injections of appropriate hydrogel microspheres or PBS every two weeks for a total of four injections, 10 μl per injection. The remaining group was a sham-operated group, specifically: 1. Sham-operated group: only the joint capsule was opened, without medial meniscus instability surgery; 2. PBS group: intra-articular injection of PBS after medial meniscus instability surgery; 3. Empty microsphere group: intra-articular injection of empty microspheres after medial meniscus instability surgery; 4. Microsphere + CAP / EXO group: intra-articular injection of hydrogel microspheres containing mesenchymal stem cell exocrine bodies overexpressing CAP after medial meniscus instability surgery; 5. Microsphere + LGR5-CAP / EXO group: intra-articular injection of hydrogel microspheres containing exosomes overexpressing LGR5 targeting peptides after medial meniscus instability surgery.

[0067] The preparation method of the empty microspheres is basically the same as the preparation method of the "hydrogel microspheres of overexpressing LGR5 target peptide exosomes" in this embodiment. The only difference is that the composition and mass ratio of the microspheres are methacrylated hyaluronic acid: initiator = 40:4. All other steps are the same. The preparation method of "microspheres containing mesenchymal stem cell exocrine bodies overexpressing CAP" is basically the same as the preparation method of "hydrogel microspheres containing exosomes overexpressing LGR5 targeting peptide" in this embodiment. The only difference is that "exosomes overexpressing LGR5 targeting peptide" are replaced with an equal amount of "mesenchymal stem cell exocrine bodies overexpressing CAP". All other steps are the same.

[0068] (1) Eight weeks after the operation, mouse knee joint samples were collected, and sagittal paraffin sections of mouse knee joint cartilage were prepared and stained with safranin and fast green to assess the degree of articular cartilage wear.

[0069] Sagittal and Fast Green staining images of sagittal paraffin sections of knee cartilage from different groups of mice are shown below. Figure 13 As shown. By Figure 13 It can be seen that the cartilage wear in the PBS group was very severe, with very little safranin staining. The cartilage wear in the empty microsphere group, the microsphere + CAP / EXO group, and the microsphere + LGR5-CAP / EXO group was alleviated, and the safranin staining gradually deepened. The microsphere + LGR5-CAP / EXO group showed the most significant effect on alleviating the wear of articular cartilage.

[0070] (2) OARSI score Samples were prepared using consecutive 4μm thick sagittal sections. Ten consecutive sections (approximately 40μm apart) were selected from each mouse knee joint to ensure coverage of the entire joint surface and to perform a systematic assessment. This allowed for histological scoring of the entire joint surface, localization of the most severely damaged areas, and evaluation of the overall condition.

[0071] Statistical graphs of OARSI scores for knee joints in mice from different groups are shown below. Figure 14 As shown. By Figure 14 The results showed that the PBS group had the highest OARSI score, followed by the empty microsphere group, the microsphere + CAP / EXO group, and the microsphere + LGR5-CAP / EXO group, with the microsphere + LGR5-CAP / EXO group having the lowest OARSI score. These results indicate that the microsphere + LGR5-CAP / EXO group has the best therapeutic effect on knee osteoarthritis in mice.

[0072] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of an exosome overexpressing a CAP gene and a LGR5 gene in the preparation of a drug for treating cartilage inflammation.

2. Use according to claim 1, wherein The nucleotide sequence of the CAP gene is shown in SEQ ID No.

1.

3. Use according to claim 1 or 2, characterized in that, The cartilage inflammation includes at least one of osteoarthritis, osteochondritis dissecans, tibial tuberosity osteochondritis, patellar chondromalacia, or secondary cartilage inflammation.

4. A mesenchymal stem cell exosome overexpressing CAP / LGR5, characterized in that, It is an exosome of human umbilical cord-derived mesenchymal stem cells overexpressing a CAP gene and a LGR5 gene.

5. The method of claim 4, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The preparation method comprises the following steps: after a coding gene of a targeting peptide CAP and a coding gene of a LGR5 protein are connected, the coding gene is transfected into human umbilical cord-derived mesenchymal stem cells, and then the mesenchymal stem cells are cultured, solid-liquid separation is performed to obtain a precipitate, the precipitate is resuspended and filtered to obtain an exosome of mesenchymal stem cells overexpressing CAP / LGR5.

6. The method of claim 5, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The connection comprises using a 2A peptide to connect.

7. The method of claim 5, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The preparation method specifically comprises the following steps: constructing an LGR5-LAMP2B-CAP overexpression plasmid, transfecting the plasmid into human umbilical cord-derived mesenchymal stem cells, culturing the cells for 48-60 hours, performing solid-liquid separation to obtain a liquid phase, performing differential centrifugation on the liquid phase to obtain a precipitate, resuspending the precipitate to obtain an exosome of mesenchymal stem cells overexpressing CAP / LGR5.

8. The method of claim 7, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The construction method of the LGR5-LAMP2B-CAP overexpression plasmid comprises the following steps: synthesizing an LGR5-LAMP2B-CAP gene comprising an LGR5 gene, an LAMP2B gene and a CAP gene, inserting the gene into a GV658 plasmid to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

9. The method of claim 8, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The nucleotide sequence of the LGR5-LAMP2B-CAP gene is shown in SEQ ID No.

2.

10. The method of claim 8 or 9, wherein the preparation of the mesenchymal stem cell exosome overexpressing CAP / LGR5 is characterized by, The construction method of the LGR5-LAMP2B-CAP overexpression plasmid specifically comprises the following steps: The LGR5-LAMP2B-CAP gene is subjected to KpnI / PacI double digestion together with the GV658 plasmid, and then subjected to homologous recombination and PCR amplification to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

Images