An epigenetic editing method for improving the nutritional components of cow milk by activating lactation gene expression

Abstract

The present application provides an epigenetic editing method for improving the nutritional components of cow milk by activating lactation gene expression, and belongs to the technical field of genetic engineering. The sgRNA plasmid is mixed with pCMV-dCas9-VPR-GFP and pCMV-dCas9-P300-mCherry plasmids respectively, mixed with P3000 and MEM medium to obtain diluted nucleic acids, lipo3000 is mixed with MEM medium to obtain a diluted reagent, and the two are mixed and incubated to transfect cells. The present application establishes an epigenetic editing system in cow cells by co-transfecting epigenetic regulation tool plasmids and target sgRNA plasmids, can specifically act on the cis-acting region of the lactation trait gene of bovine mammary epithelial cells, significantly improves the mRNA expression level of the target gene, and effectively enhances the content of nutritional components in cow milk.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an epigenetic editing method for improving the nutritional components of cow's milk by activating the expression of lactation genes. Background Technology

[0002] Lactation in domestic cattle is regulated by many factors. Currently, the most common method of inducing lactation is through hormone induction. Studies have shown that many genes are involved in this process, so theoretically, upregulating lactation-related genes can increase milk production. A common method for gene upregulation is to directly copy the gene's open reading frame and introduce it into cells to achieve gene overexpression. However, this method is cumbersome. Novel gene editing technologies have attracted much attention since their inception and have been applied in many fields such as basic scientific research and medicine. However, gene editing technologies, represented by CRISPR, require cutting genomic DNA, posing potential biosafety risks and a high off-target rate, which greatly limits the application of these gene expression regulation tools. Therefore, epigenetic editing systems based on histone acetylation and transcription factor recruitment can regulate gene expression more safely and effectively; however, current research on epigenetic regulation in livestock is limited. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide an epigenetic editing method for improving the nutritional composition of milk by activating the expression of lactation genes.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] This invention provides an sgRNA that targets the cis-regulatory region of bovine lactation trait genes, wherein the bovine lactation trait genes include STAT5A, STAT5B, and PER2;

[0006] The nucleotide sequence of the sgRNA targeting STAT5A is shown in SEQ ID NO:1-8;

[0007] The nucleotide sequence of the sgRNA targeting STAT5B is shown in SEQ ID NO:9-11;

[0008] The nucleotide sequence of the sgRNA targeting PER2 is shown in SEQ ID NO:12-15.

[0009] An sgRNA plasmid comprising the sgRNA and an sgRNA backbone plasmid, wherein the nucleotide sequence of the sgRNA backbone plasmid is shown in SEQ ID NO:16.

[0010] This invention also provides a method for preparing the sgRNA plasmid, comprising the following steps:

[0011] The sgRNA backbone plasmid was digested with BbsI restriction enzyme, and the digested sgRNA backbone plasmid and the sgRNA were ligated with T4 DNA ligase to obtain the sgRNA plasmid.

[0012] The present invention also provides the application of the sgRNA or the sgRNA plasmid in improving the nutritional content of milk.

[0013] Preferably, it includes the following steps:

[0014] 1) Using dCas9-VPR plasmid as the original vector, replace the Ac5 promoter on the dCas9-VPR plasmid with the CMV promoter, and connect P2A and GFP sequentially after VPR on the dCas9-VPR plasmid to construct the pCMV-dCas9-VPR-GFP plasmid.

[0015] 2) Using dCas9-P300 plasmid as the original vector, P2A and mCherry were sequentially linked after P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid.

[0016] 3) The sgRNA plasmid was mixed with pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid respectively to obtain two plasmid mixtures. The two plasmid mixtures were mixed with P3000 and MEM culture medium respectively to obtain two diluted nucleic acids. Lipo3000 was mixed with MEM culture medium to obtain a dilution reagent. The two diluted nucleic acids and the dilution reagent were mixed and incubated to obtain a transfection complex. The transfection complex was transfected into cells respectively.

[0017] Preferably, the nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid in step 1) is shown in SEQ ID NO:17, and the nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid in step 2) is shown in SEQ ID NO:18.

[0018] Preferably, in step 3), the mass ratio of the sgRNA plasmid to the pCMV-dCas9-VPR-GFP plasmid is 1:1 to 3, and the mass ratio of the sgRNA plasmid to the pCMV-dCas9-P300-mCherry plasmid is 1:1 to 3.

[0019] The volume ratio of lipo3000 to MEM culture medium is 3.75–7.5 μL: 125 μL; the incubation time is 15 min.

[0020] Preferably, the cells include bovine mammary epithelial cells (BMEC) and bovine mammary epithelial cells (MAC-T); the cells are transfected when they reach 70-90% confluency.

[0021] Preferably, the nutrients include casein and triglycerides.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention designs and modifies sgRNA plasmids targeting the cis-regulatory regions of key genes controlling lactation traits in domestic cattle. Histone acetylation factor P300 and transcription factor recruitment factor VPR are fused with dCas9 plasmids for expression, constructing an epigenetic editing system. By transfecting this system with the cis-regulatory regions of genes specifically targeting lactation traits in domestic cattle, the epigenetic modification status of specific genomic regions is altered, resulting in targeted and controllable gene expression activation. The mRNA expression level of the target gene significantly increases, and the nutrient content in domestic cattle milk significantly improves. Attached Figure Description

[0024] Figure 1 It is the open chromatin region of the upstream promoter of the STAT5A gene;

[0025] Figure 2 It is the open chromatin region of the upstream promoter of the STAT5B gene;

[0026] Figure 3 It is the open chromatin region of the upstream promoter of the PER2 gene;

[0027] Figure 4 This is a schematic diagram of the sgRNA backbone plasmid;

[0028] Figure 5 This is a schematic diagram of the pCMV-dCas9-VPR-GFP plasmid;

[0029] Figure 6 This is a schematic diagram of the pCMV-dCas9-P300-mCherry plasmid;

[0030] Figure 7 This is a flowchart of the transfection process;

[0031] Figure 8 It represents the mRNA expression level of the STAT5A gene in BMEC cell lines treated with different sgRNAs targeting the STAT5A gene.

[0032] Figure 9 The mRNA expression level of the PER2 gene in BMEC cell lines treated with different sgRNAs targeting the PER2 gene is shown.

[0033] Figure 10 It represents the mRNA expression levels of the STAT5A and PER2 genes in the BMEC cell line treated with a mixture of sgRNA plasmids.

[0034] Figure 11 It refers to the total casein and triglyceride content of the STAT5A and PER2 genes in the BMEC cell line treated with sgRNA plasmid mixtures;

[0035] Figure 12 The mRNA expression levels of the STAT5A gene in MAC-T cell lines treated with sgRNAs targeting the STAT5A gene are as follows:

[0036] Figure 13 The expression levels of STAT5B gene mRNA in MAC-T cell lines treated with sgRNAs targeting the STAT5B gene are as follows:

[0037] Figure 14 The mRNA expression level of the PER2 gene in MAC-T cell lines treated with different sgRNAs targeting the PER2 gene;

[0038] Figure 15 It represents the mRNA expression levels of STAT5A, STAT5B, and PER2 genes in MAC-T cell lines treated with a mixture of sgRNA plasmids.

[0039] Figure 16 It represents the total casein and triglyceride content of the STAT5A, STAT5B, and PER2 genes in MAC-T cell lines treated with a mixture of sgRNA plasmids. Detailed Implementation

[0040] This invention provides an sgRNA that targets the cis-regulatory region of bovine lactation trait genes, wherein the bovine lactation trait genes include STAT5A, STAT5B, and PER2;

[0041] The nucleotide sequences of the sgRNA targeting STAT5A are shown in SEQ ID NO:1-8.

[0042] Specifically, SEQ ID NO:1 is GAAGGAGAGAGCAACGCAGA.

[0043] Specifically, SEQ ID NO:2 is CCCGCAAGGCCTGTAGGCAG.

[0044] Specifically, SEQ ID NO:3 is GAGAGGCGACCGAGGCTGGGA.

[0045] Specifically, SEQ ID NO:4 is GAGGAGGAAATCGCTGCTCT.

[0046] Specifically, SEQ ID NO:5 is CCGGACCGCCCGGCACGACC.

[0047] Specifically, SEQ ID NO:6 is AGCGGTGGCCGAGCCGTCCA.

[0048] Specifically, SEQ ID NO:7 is CACCGTCTTTCTTCCCGCAC.

[0049] Specifically, SEQ ID NO:8 is AGTCCACGCCTGTGACGAGA;

[0050] The nucleotide sequence of the sgRNA targeting STAT5B is shown in SEQ ID NO:9-11.

[0051] Specifically, SEQ ID NO:9 is GAGGCAGCTGACCTTTTGGA.

[0052] Specifically, SEQ ID NO:10 is CTTCTTCCTGTAACAGTGCA.

[0053] Specifically, SEQ ID NO:11 is TCTGCCGCTATCCTGGCTGC;

[0054] The nucleotide sequence of the sgRNA targeting PER2 is shown in SEQ ID NO:12-15.

[0055] Specifically, SEQ ID NO:12 is CCGCCGCCAATGGCGGGCGC.

[0056] Specifically, SEQ ID NO:13 is TGACAGCGGCGAGTCCGCGC.

[0057] Specifically, SEQ ID NO:14 is GCTTTTCGGCCGCAGCGGCGG.

[0058] The SEQ ID NO:15 is specifically GCCGCGCGCGGATCGTCCAG.

[0059] This invention also provides an sgRNA plasmid, the sgRNA plasmid comprising the sgRNA and the sgRNA backbone plasmid, the nucleotide sequence of the sgRNA backbone plasmid being shown in SEQ ID NO:16, specifically as follows:

[0060]

[0061] This invention also provides a method for preparing the sgRNA plasmid, comprising the following steps:

[0062] The sgRNA backbone plasmid was digested with BbsI restriction enzyme, and the digested sgRNA backbone plasmid and the sgRNA were ligated with T4 DNA ligase to obtain the sgRNA plasmid.

[0063] The present invention also provides the application of the sgRNA or the sgRNA plasmid in improving the nutritional content of milk.

[0064] The present invention includes the following steps:

[0065] 1) Using dCas9-VPR plasmid as the original vector, replace the Ac5 promoter on the dCas9-VPR plasmid with the CMV promoter, and connect P2A and GFP sequentially after VPR on the dCas9-VPR plasmid to construct the pCMV-dCas9-VPR-GFP plasmid.

[0066] 2) Using dCas9-P300 plasmid as the original vector, P2A and mCherry were sequentially linked after P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid.

[0067] 3) The sgRNA plasmid was mixed with pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid respectively to obtain two plasmid mixtures. The two plasmid mixtures were mixed with P3000 and MEM culture medium respectively to obtain diluted nucleic acids. Lipo3000 was mixed with MEM culture medium to obtain dilution reagent. The two diluted nucleic acids and dilution reagent were mixed and incubated to obtain transfection complex. The transfection complex was transfected into cells respectively.

[0068] In this invention, the dCas9-VPR plasmid is used as the original vector. The Ac5 promoter on the dCas9-VPR plasmid is replaced with a CMV promoter. P2A and GFP are sequentially linked after VPR on the dCas9-VPR plasmid to construct the pCMV-dCas9-VPR-GFP plasmid. The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid is shown in SEQ ID NO:17, specifically...

[0069]

[0070]

[0071]

[0072] In this invention, the dCas9-P300 plasmid is used as the original vector. P2A and mCherry are sequentially linked after P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid. The nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid is shown in SEQ ID NO:18, specifically...

[0073]

[0074]

[0075]

[0076]

[0077] In this invention, the sgRNA plasmid is mixed with pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid respectively to obtain two plasmid mixtures. The plasmid mixtures are then mixed with P3000 and MEM culture medium to obtain two diluted nucleic acids. Lipo3000 is mixed with MEM culture medium to obtain a dilution reagent. The two diluted nucleic acids and the dilution reagent are mixed and incubated to obtain a transfection complex. The transfection complex is then transfected into cells. The preferred mass ratio of the sgRNA plasmid to the pCMV-dCas9-VPR-GFP plasmid is 1:1 to 3, more preferably 1:2; the preferred mass ratio of the sgRNA plasmid to the pCMV-dCas9-P300-mCherry plasmid is 1:1 to 3, more preferably 1:2; the preferred volume ratio of lipo3000 to MEM culture medium is 3.75 to 7.5 μL: 125 μL, more preferably 5 μL: 125 μL; the preferred incubation time is 15 min; the cells include bovine mammary epithelial cells (BMEC) and bovine mammary epithelial cells (MAC-T); transfection is performed when the cells reach 70% to 90% confluency.

[0078] The nutrients described in this invention include casein and triglycerides.

[0079] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0080] Example 1

[0081] 1. Construction of sgRNA plasmid

[0082] Using the key lactation genes STAT5A, STAT5B, and PER2 reported in the literature as targets, and referencing sequences from the NCBI Reference Genome ARS-UCD2.0 (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 9913 / ), and identifying the open chromatin regions of the upstream promoters (e.g., ...) through the domestic bovine genome bioinformatics database (https: / / data.faang.org / genome_browser), we determined the chromatin open regions of the upstream promoters. Figures 1-3 As shown in Table 1), sgRNAs with low predicted off-target probabilities were selected as candidates by BLAST alignment with the whole genome. Using Zhang Feng's method (https: / / doi.org / 10.1038 / nprot.2013.143), these sgRNAs were constructed onto the laboratory-preserved original sgRNA backbone plasmid (nucleotide sequence shown in SEQ ID NO:16). A schematic diagram of the sgRNA backbone plasmid is shown below. Figure 4 The specific steps are as follows: 1) Digest the sgRNA backbone plasmid using BbsI restriction enzyme; 2) Order and synthesize upstream and downstream primers for sgRNA, dilute them to 10 μM, take 10 μL of each and mix them, add Nuclease Freewater to 50 μL, and anneal at 95℃ for 5 min; 0.1 s / cycle (-2℃ / cycle, down to 85℃); 0.1 s / cycle (-0.1℃ / cycle, down to 25℃); store at 4℃ for later use; 3) Mix the digested sgRNA backbone and the annealed sgRNA, ligate with T4 DNA ligase, and after transformation, select single clones with correct sequencing and extract high-concentration endotoxin-free sgRNA plasmid using the Tiangen Da Endotoxin-Free Plasmid Extraction Kit for transfection.

[0083] Table 1. sgRNA sequences targeting key lactation genes STAT5A, STAT5B, and PER2.

[0084] STAT5A-gRNA1 GAAGGAGAGAGCAACGCAGA(SEQ ID NO:1) STAT5A-gRNA2 CCCGCAAGGCCTGTAGGCAG(SEQ ID NO:2) STAT5A-gRNA3 GAGAGCGACCGAGGCTGGGA(SEQ ID NO:3) STAT5A-gRNA4 GAGGAGGAAATCGCTGCTCT(SEQ ID NO:4) STAT5A-gRNA5 CCGGACCGCCCGGCACGACC(SEQ ID NO:5) STAT5A-gRNA6 AGCGGTGGCCGAGCCGTCCA(SEQ ID NO:6) STAT5A-gRNA7 CACCGTCTTCTTCCCGCAC(SEQ ID NO:7) STAT5A-gRNA8 AGTCCACGCCTGTGACGAGA(SEQ ID NO:8) STAT5B-gRNA1 GAGGCAGCTGACCTTTTGGA(SEQ ID NO:9) STAT5B-gRNA2 CTTCTTCCTGTAACAGTGCA(SEQ ID NO:10) STAT5B-gRNA3 TCTGCCGCTATCCTGGCTGC(SEQ ID NO:11) PER2-gRNA1 CCGCCGCCAATGGCGGGCGC (SEQ ID NO:12) PER2-gRNA2 TGACAGCGGCGAGTCCGCGC(SEQ ID NO:13) PER2-gRNA3 GCTTTCGGCCGCAGCGGCGG(SEQ ID NO:14) PER2-gRNA4 GCCGCGCGCGGATCGTCCAG(SEQ ID NO:15)

[0085] 2. Construction of pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid

[0086] (1) Construction of pCMV-dCas9-VPR-GFP plasmid

[0087] Purchase commercially available dCas9-VPR plasmid (purchased from Fenghui Biotechnology Co., Ltd.), replace the Ac5 promoter with the CMV promoter, and link P2A and GFP after VPR. The plasmid was synthesized by Nanjing Genscript Biotech Co., Ltd. and sequenced to ensure accuracy before use.

[0088] The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid is shown in SEQ ID NO:17, and a schematic diagram of the pCMV-dCas9-VPR-GFP plasmid is shown below. Figure 5 As shown.

[0089] (2) Construction of pCMV-dCas9-P300-mCherry plasmid

[0090] Purchase commercial dCas9-P300 plasmid (purchased from Changsha Ruiying Biotechnology Co., Ltd.), link P2A and mCherry to P300, and have Nanjing Genscript Biotech Co., Ltd. synthesize and sequence it to ensure accuracy for future use.

[0091] The nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid is shown in SEQ ID NO:18, and a schematic diagram of the pCMV-dCas9-P300-mCherry plasmid is shown in [image missing]. Figure 6 As shown.

[0092] 3. Transfection

[0093] Two bovine mammary epithelial cell lines, BMEC and MAC-T (Shanghai Meiwan Biotechnology Co., Ltd.), were selected as experimental materials. Using a 6-well plate as an example, each experimental group had six replicates, each co-transfected with a single sgRNA plasmid or a mixture of sgRNA plasmids (STAT5A was a proportional mixture of STAT5A-gRNA1 to STAT5A-gRNA8 plasmids (sgRNA plasmid mixture 1), and PER2 was a proportional mixture of PER2-gRNA1 to PER2-gRNA4 plasmids (sgRNA plasmid mixture 2) and pCMV-dCas9-VPR-GFP plasmid, respectively. The sgRNA plasmid mixture (STAT5B is a mixture of STAT5B-gRNA1 to STAT5B-gRNA3 in equal proportions (sgRNA plasmid mixture 3)) and pCMV-dCas9-P300-mCherry plasmid were used. The control groups of STAT5A and PER2 were co-transfected with the sgRNA plasmid backbone (non-targeting sgRNA) and pCMV-dCas9-VPR-GFP plasmid in six replicates each. The control group of STAT5B was co-transfected with the sgRNA plasmid backbone (non-targeting sgRNA) and pCMV-dCas9-P300-mCherry plasmid in six replicates each. Following the instructions for Thermo Fisher Scientific's Lipo 3000 transfection reagent, transfection was performed when cells reached 80% confluency. First, a single sgRNA plasmid or a mixture of sgRNA plasmids 1-2 was mixed with pCMV-dCas9-VPR-GFP plasmid at a mass ratio of 1:2 to obtain plasmid mixture A. Then, a single sgRNA plasmid or a mixture of sgRNA plasmids 3 was mixed with pCMV-dCas9-P300-mCherry plasmid at a mass ratio of 1:2 to obtain plasmid mixture B. The two plasmid mixtures A and B were then mixed with 5 μL of P3000 and 125 μL of MEM medium, respectively, to obtain diluted nucleic acids. Next, 5 μL of Lipo 3000 was mixed with 125 μL of MEM medium to obtain a dilution reagent. Finally, the diluted nucleic acids and dilution reagent were completely mixed and incubated at room temperature for 15 min to obtain the transfection complex (transfection flowchart shown below). Figure 7 (As shown). 250 μL of the transfection complex was added to each well of cells.

[0094] Cell parameters were measured 48 hours after transfection:

[0095] (1) Total RNA was isolated using the guanidine isothiocyanate method (TRizol). Taking a 12-well plate as an example, 1 mL of TRizol was added to each well for lysis, followed by 200 μL of chloroform. The mixture was vigorously shaken to mix. After incubation on ice for 5 min, the layers separated and then centrifuged at 12,000 rpm for 15 min in a pre-cooled centrifuge at 4°C. The supernatant was collected, and 1 μL of glycogen was added. An equal volume of isopropanol was added to the supernatant, and the mixture was incubated overnight at -20°C for precipitation. After centrifugation at 13,000 rpm for 30 min, the supernatant was discarded, and the RNA precipitate was collected at the bottom of the tube. 500 μL of 75% ethanol (prepared with RNase-free water) was added to the RNA precipitate, and the tube was washed twice. The tube was then centrifuged at 7500 rpm for 5 min at 4°C, and the supernatant was discarded. The precipitate at the bottom was the RNA. After drying the precipitate at room temperature for 30 minutes, add 25 μl of RNase-free water to the precipitate and gently tap the tube wall to fully dissolve the RNA. Then, measure the RNA concentration using nanodrop. Take 1 μg of RNA and synthesize cDNA using the Tiangen FastKing reverse transcription kit. After diluting it five times, perform a quantitative experiment (q-PCR) using Tiangen Quantitative Mix to determine gene expression.

[0096] (2) The contents of the corresponding metabolites were detected using the Casein (bovine total casein) assay kit and Solarbiotase triglyceride (TG) assay kit from Shanghai Enzyme-Link Biotechnology Co., Ltd.

[0097] ①For BMEC cell lines

[0098] Experimental results: such as Figures 8-10 As shown, compared with the untransfected target sgRNA group, transfection with four single sgRNAs, STAT5A-sgRNA8 and PER2, in single sgRNA plasmids significantly increased mRNA levels. The mRNA expression levels of STAT5A and PER2 genes were also significantly increased in the sgRNA plasmid mixture transfected group.

[0099] like Figure 11 As shown. Crtl was not treated in any way, Blank was the control group. Compared with the group without transfection of the targeting sgRNA, the total casein content of STAT5A and PER2 was significantly increased in the sgRNA plasmid mixture treatment, and the triglyceride content of PER2 showed an upward trend.

[0100] ②For MAC-T cell lines

[0101] Experimental results: such as Figures 12-15 As shown in the figure, compared with the group without target sgRNA, the mRNA expression levels of STAT5A and PER2 genes were significantly increased in the group transfected with a single sgRNA plasmid, and the mRNA expression levels of STAT5A, STAT5B and PER2 genes were all significantly increased in the group transfected with a mixture of sgRNA plasmids.

[0102] like Figure 16 As shown. Crtl was not treated in any way, Blank was the control group. Compared with the untransfected target sgRNA group, the total casein content of STAT5A, STAT5B and PER2 was significantly increased in the sgRNA plasmid mixture treatment group, the triglyceride content of STAT5B was significantly increased, and the triglyceride content of STAT5A and PER2 showed an upward trend.

[0103] As can be seen from the above embodiments, the present invention establishes an intracellular epigenetic editing system for domestic cattle by co-transfecting epigenetic regulatory tool plasmids and targeting sgRNA plasmids. This system specifically targets the cis-regulatory regions of genes related to lactation traits in bovine mammary epithelial cells, achieving precise activation of the expression of key genes in domestic cattle lactation. The mRNA expression level of the target genes increases significantly, and the nutrient content in domestic cattle milk is significantly improved.

[0104] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A sgRNA composition targeting the cis-regulatory region of the bovine lactation trait gene STAT5B, characterized in that, The sgRNA composition targeting STAT5B consists of sgRNAs with nucleotide sequences as shown in SEQ ID NO:9-11.

2. A mixture of sgRNA plasmids, characterized in that, The sgRNA plasmids comprise the sgRNA composition and the sgRNA backbone plasmid as described in claim 1, respectively; The nucleotide sequence of the sgRNA is shown in SEQ ID NO:9-11; The nucleotide sequence of the sgRNA backbone plasmid is shown in SEQ ID NO:

16.

3. The method for preparing the sgRNA plasmid mixture according to claim 2, characterized in that, Includes the following steps: The sgRNA backbone plasmid was digested with BbsI restriction enzyme, and the digested sgRNA backbone plasmid and the sgRNA described in claim 1 were ligated with T4 DNA ligase to obtain a sgRNA plasmid mixture.

4. The application of the sgRNA composition of claim 1, the sgRNA plasmid mixture of claim 2, or the sgRNA plasmid mixture prepared by the preparation method of claim 3 in improving the nutritional content of milk.

5. The application according to claim 4, characterized in that, Includes the following steps: 1) Using dCas9-VPR plasmid as the original vector, replace the Ac5 promoter on the dCas9-VPR plasmid with the CMV promoter, and connect P2A and GFP sequentially after VPR on the dCas9-VPR plasmid to construct the pCMV-dCas9-VPR-GFP plasmid. 2) Using dCas9-P300 plasmid as the original vector, P2A and mCherry were sequentially linked after P300 on the dCas9-P300 plasmid to construct the pCMV-dCas9-P300-mCherry plasmid. 3) The sgRNA plasmid mixture described in claim 2 is mixed with pCMV-dCas9-VPR-GFP plasmid and pCMV-dCas9-P300-mCherry plasmid respectively to obtain two plasmid mixtures. The two plasmid mixtures are mixed with P3000 and MEM culture medium to obtain two diluted nucleic acids. Lipo3000 is mixed with MEM culture medium to obtain a dilution reagent. The two diluted nucleic acids and the dilution reagent are mixed and incubated to obtain a transfection complex. The transfection complex is transfected into cells respectively.

6. The application according to claim 5, characterized in that, The nucleotide sequence of the pCMV-dCas9-VPR-GFP plasmid in step 1) is shown in SEQ ID NO:17, and the nucleotide sequence of the pCMV-dCas9-P300-mCherry plasmid in step 2) is shown in SEQ ID NO:

18.

7. The application according to claim 5, characterized in that, Step 3) The mass ratio of the sgRNA plasmid mixture of claim 2 to the pCMV-dCas9-VPR-GFP plasmid is 1:1 to 3, and the mass ratio of the sgRNA plasmid mixture of claim 2 to the pCMV-dCas9-P300-mCherry plasmid is 1:1 to 3. The volume ratio of lipo3000 to MEM culture medium is 3.75–7.5 μL: 125 μL; the incubation time is 15 min.

8. The application according to claim 5, characterized in that, The cells include bovine mammary epithelial cells (BMEC) and bovine mammary epithelial cells (MAC-T); transfection is performed when the cells reach 70-90% confluency.

9. The application according to claim 4, characterized in that, The nutrients include casein and triglycerides.

Images