A method for synthesizing D-allulose by escherichia coli using a D-glucose / glycerol composite carbon source system

Abstract

The application relates to a method for synchronously synthesizing D-allulose by using a D-glucose / glycerol composite carbon source system, and belongs to the field of synthetic biology, and solves the problem of low yield in the production of D-allulose. The method is characterized in that the pgi gene and the glk gene are overexpressed on Escherichia coli, the alse gene and the a6pp gene are combined, the pfkA gene is partially knocked out, the Mlc gene and the glpk G913S gene are overexpressed, and the recombinant Escherichia coli capable of growing by using glycerol is constructed; the aldO gene is introduced, the metabolic pathway for synthesizing D-allulose by using glycerol as a substrate is constructed by using the rhaD gene and the yqaB gene, and then the D-glucose / glycerol composite carbon source system is used to synchronously synthesize D-allulose. The application firstly proposes a D-allulose synthesis strategy based on integrated aldol reaction and glycolysis pathway, realizes the co-utilization of glycerol and D-glucose, and provides a new strategy for industrial production.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of synthetic biology, and particularly relates to a method for synthesizing D-allulose by using D-glucose / glycerol compound carbon source system in E. coli. BACKGROUND

[0002] D-allulose does not participate in human physiological metabolism due to its natural physical and chemical properties, and has multiple physiological functions such as reducing blood sugar and reducing blood lipids, and has been widely concerned in recent years. Due to the great attention of D-allulose in the food industry in recent years, how to reduce the cost and more efficiently produce D-allulose from the time efficiency has become the main concern of related enterprises, so it is of practical significance to develop a D-allulose production strategy with lower cost and higher efficiency.

[0003] Due to the advantages in production cost and production efficiency, in recent years, the catalytic pathway for de novo synthesis of D-allulose from glucose has gradually become a research hotspot. Compared with the traditional glucose isomerase (GI) and D-allulose 3-epimerase (DAEase) coupling method for synthesizing D-allulose, the in vivo phosphorylation synthesis method using glycolysis pathway has higher irreversibility and thermodynamic effect, which also makes it increasingly become a focus in the field of D-allulose synthesis. However, when the accumulation of fructose-6-phosphate is insufficient, D-allulose cannot be synthesized and the carbon metabolic flow generated by glycolysis preferentially flows into the TCA cycle to meet the basic growth needs of E. coli. Therefore, many scholars have knocked out the two pfkA gene and pfkB gene encoding phosphofructokinase (PFK) in E. coli to regulate the carbon metabolic flow, but the knockout of this enzyme inevitably affects the growth ability of the strain, ultimately leading to a decrease in the conversion rate of the product. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a method for efficiently synthesizing D-allulose by using compound carbon source (D-glucose / glycerol) in view of the deficiencies of the prior art, which can improve the yield of D-allulose.

[0005] To solve the above technical problems, the technical solution of the present application is:

[0006] The method for synthesizing D-allulose by using D-glucose / glycerol compound carbon source system in E. coli according to the present application is characterized in that D-glucose / glycerol is used as a substrate, and is prepared by fermentation of recombinant E. coli; the recombinant E. coli is recombinant E. coli Ec02 and / or recombinant E. coli Ec03.

[0007] The recombinant E. coli Ec02 overexpresses pgi gene, glk gene, alse gene, a6pp gene, and overexpresses Mlc gene and glpk G913S gene, and knocks out pfkA gene;

[0008] The recombinant E. coli Ec03 overexpresses pgi gene, glk gene, alse gene, a6pp gene, and overexpresses Mlc gene and glpk G913S gene, and knocks out pfkA gene, and overexpresses aldO gene, rhaD gene and yqaB gene.

[0009] The recombinant E. coli Ec02 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host bacterium, overexpressing pgi gene, glk gene, alse gene, a6pp gene, and knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain the recombinant E. coli Ec02.

[0010] The recombinant E. coli Ec03 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host bacterium, overexpressing pgi gene, glk gene, alse gene, a6pp gene, and knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain the recombinant E. coli Ec02; on the basis of the recombinant E. coli Ec02, overexpressing aldO gene, rhaD gene and yqaB gene to obtain the recombinant E. coli Ec03.

[0011] The a6pp gene is derived from Bacteroides fragilis NCTC 9343; and the aldO gene is derived from Streptomyces coelicolor M145.

[0012] The fermentation uses IPTG as an inducer.

[0013] The fermentation conditions are as follows: the IPTG concentration is 0.1-0.5 mM; the concentration ratio of D-glucose to glycerol is (9~1): (1~9); and the fermentation time is 12-72 h.

[0014] The construction process of the recombinant E. coli Ec02 is specifically as follows:

[0015] The pgi gene and the glk gene are connected on the vector pCDFDuet-1 to obtain a recombinant plasmid pCDFDuet-pgi-glk; the a6pp gene and the alse gene are connected on the vector pETDuet-1 to obtain a recombinant plasmid pETDuet-a6pp-alse; the recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse are transformed into E. coli BL21 (DE3), and the pfkA gene is knocked out by using the CRISPR / Cas9 technology to obtain a recombinant E. coli Ec01;

[0016] The Mlc gene and the glpK G913S gene are connected on the vector pRSFDuet-1 to obtain a recombinant plasmid pRSFDuet-Mlc-glpK G913S ; the recombinant plasmid pRSFDuet-Mlc-glpK G913S is transformed into the recombinant E. coli Ec01 to obtain a recombinant E. coli Ec02.

[0017] The construction process of the recombinant E. coli Ec03 is specifically as follows:

[0018] The aldO gene, the rhaD gene and the yqaB gene are connected on the vector PACYCDuet-1 to obtain a recombinant plasmid PACYCDuet-aldO-rhaD-yqaB; the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB is transformed into the recombinant E. coli Ec02 to obtain the recombinant E. coli Ec03.

[0019] The fermentation is performed according to the following method: the recombinant E. coli Ec02 or the recombinant E. coli Ec03 is inoculated into an LB liquid medium to obtain a seed liquid; the seed liquid is inoculated into a fermentation liquid to perform fermentation; wherein the inoculation amount of the recombinant E. coli Ec02 or the recombinant E. coli Ec03 into the fermentation liquid is 1%; the LB liquid medium is prepared according to the following formula: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride.

[0020] The fermentation liquid adopts different formulas for different strains, wherein: the corresponding fermentation liquid of the recombinant E. coli Ec02 is: a composite carbon source, 5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, 15 g / L agar powder, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin; the composite carbon source is D-glucose and glycerol, D-glucose 5 g / L, glycerol 4 g / L;

[0021] The corresponding fermentation broth of the recombinant E. coli Ec03 is: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, complex carbon source 20-50 g / L, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, 50 μg / mL chloramphenicol; the complex carbon source is D-glucose and glycerol, and the ratio of D-glucose / glycerol is (9:1)-(1:9).

[0022] The beneficial effects of the present application are as follows:

[0023] The recombinant E. coli Ec02 enhances the utilization ability of glycerol and reduces the glucose effect on the basis of the recombinant E. coli Ec01, a D-glucose / glycerol co-utilization system is constructed, the strain growth ability is maintained by glycerol, D-allulose is synthesized efficiently by taking D-glucose as a substrate, the phenomenon of insufficient cell mass and too long lag phase caused by knocking out pfkA is avoided, and the final OD of the recombinant E. coli Ec02 is 2.34, which is higher than that of the recombinant E. coli Ec01 (1.54). 600 The final OD of the recombinant E. coli Ec02 is 2.34, which is higher than that of the recombinant E. coli Ec01 (1.54).

[0024] On the basis of the recombinant E. coli Ec02, the recombinant E. coli Ec03 for synthesizing D-allulose by aldol reaction with glycerol as a substrate is constructed, the aldol reaction for synthesizing D-allulose is successfully coupled with the complex carbon source utilization platform, a D-allulose synthesis system with D-glucose / glycerol as a substrate is constructed, the problems of growth inhibition of the recombinant E. coli and further alleviation of the glucose effect are solved, and the final D-allulose yield reaches 2.89 g / L, and the yield is increased to 5.40 g / L after optimization of the fermentation conditions. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The cell factory diagram for the E. coli described in the present application to synthesize D-allulose by using a D-glucose / glycerol complex carbon source system.

[0026] In the figure, glk: glucose kinase gene; pgi: 6-phosphogluconate isomerase gene; alse: D-allulose-6-phosphate epimerase gene; a6pp: D-allulose-6-phosphate-phosphatase gene; Mlc: transcriptional repressor gene; glpk G913S : glycerol kinase mutant gene; pfkA / pfkB: phosphofructokinase gene; aldO: sugar alcohol oxidase gene; rhaD: L-rhamnose-1-phosphate aldolase gene; yqaB: acid phosphatase gene.

[0027] Figure 2A schematic diagram for constructing pCDFDuet-pgi-glk.

[0028] Figure 3 A schematic diagram for constructing pETDuet-a6pp-alse.

[0029] Figure 4 pRSFDuet-Mlc-glpK G913S Construct a schematic diagram.

[0030] Figure 5 A schematic diagram of the construction of PACYCDuet-aldO-rhaD-yqaB. Detailed Implementation

[0031] The following examples will further illustrate this point. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0032] The raw materials and reagents used in the embodiments of this invention are all conventional chemical reagents and can be purchased through commercial channels. The LB liquid culture medium is prepared with the following components: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride; the LB solid culture medium is prepared with the following components: agar powder (15 g / L) is added to the LB liquid culture medium to solidify it.

[0033] Figure 1 This is a cellular factory diagram of the synchronous synthesis of D-allulose by *E. coli* using a D-glucose / glycerol complex carbon source system as described in this invention. Two pathways for D-allulose synthesis were constructed in this invention: (1) using *E. coli* as the substrate host bacterium, overexpressing the pgi and glk genes, and combining them with the alse and a6pp genes to construct a pathway for D-allulose synthesis using D-glucose as a substrate; (2) based on the above, knocking out the pfkA gene and overexpressing the Mlc and glpk genes. G913S Genes were used to construct recombinant Escherichia coli that can utilize glycerol for growth; in addition, the aldO gene was introduced, and the rhaD and yqaB genes were used to construct a metabolic pathway for the synthesis of D-allulose using glycerol as a substrate, thereby achieving the simultaneous synthesis of D-allulose using a D-glucose / glycerol complex carbon source system.

[0034] Example 1

[0035] This embodiment describes the construction and fermentation of D-allulose using recombinant Escherichia coli Ec01. The specific construction process is as follows:

[0036] Construction of recombinant plasmid pCDFDuet-pgi: Using the pgi gene in the wild-type BL21(DE3) genome as a template, PCR amplification was performed using pgi-F: AGATATACATATGGCAGATCTCATGAAAAACATCAATCCAACGCAG as the upstream primer and pgi-R: GGTTTCTTTACCAGACTCGAGTTAACCGCGCCACGCTTTATA as the downstream primer. The obtained 1650bp target gene fragment was then directionally cloned into plasmid pCDFDuet-1 treated with Xho I / Bgl II restriction endonucleases to obtain recombinant plasmid pCDFDuet-pgi.

[0037] Construction of recombinant plasmid pCDFDuet-pgi-glk: Using the glk gene from the wild-type BL21(DE3) genome as a template, PCR amplification was performed using glk-F: CCACAGCCAGGATCCGAATTCAATGAGCCTGACCACCGC as the upstream primer and glk-R: GCATTATGCGGCCGCAAGCTTTTAACCACGCGCGCCC as the downstream primer. The obtained 960 bp target gene fragment was directionally cloned into plasmid pCDFDuet-pgi treated with BamHI / NotI restriction endonucleases to obtain the recombinant plasmid pCDFDuet-pgi-glk. A schematic diagram of its construction is shown below. Figure 2 As shown.

[0038] Construction of recombinant plasmid pETDuet-alse: Using the alse gene from the wild-type BL21(DE3) genome as a template, PCR amplification was performed using alse-F: AGATATACATATGGCAGATCTAATGCGTTACTTCAAAGAAGAAGTTG as the upstream primer and alse-R: GGTTTCTTTACCAGACTCGAGTTAGATACCGAAAACGTGCCTAC as the downstream primer. The obtained 696 bp target gene fragment was then directionally cloned into plasmid pETDuet-1, which was treated with BamHI / HindIII restriction endonuclease, to obtain recombinant plasmid pETDuet-alse.

[0039] Construction of recombinant plasmid pETDuet-a6pp-alse: Using the a6pp gene from Bacteroides fragilis NCTC 9343 as a template, PCR amplification was performed using a6pp-F: TCATCACCACAGCCAGGATCCGATGAAAATCTCCCCCTCGTTAATG as the upstream primer and a6pp-R: GCATTATGCGGCCGCAAGCTTTTATGCTGTTTTTGCATGAGGCT as the downstream primer. The obtained 669 bp target gene fragment was directionally cloned into plasmid pETDuet-alse treated with Xho I / Bgl II restriction endonucleases to obtain recombinant plasmid pETDuet-a6pp-alse.

[0040] Transformation of recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse: The recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse were co-transformed into Escherichia coli BL21(DE3) using chemical transformation. A schematic diagram of the construction is shown below. Figure 3 As shown.

[0041] Construction of recombinant Escherichia coli Ec01: The pfkA gene of recombinant E. coli transformed with recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse was knocked out. First, specific primers were designed. A 552 bp homologous fragment was amplified using upstream homologous arm primers pfkA-UP-F: GCATTTTGTGTATAAAATACCGCCATTTGG and pfkA-UP-R: CGATGATGTCGTGGTGAACCTTTGATGTCGTTGTCGATAGTGCCC. A 514 bp homologous fragment was amplified using downstream primers pfkA-DOWN-F: GGTTCACCACGACATCATCGAC and pfkA-DOWN-R: TACAATTCGCGCGTTGGATCATATGAAA. Next, a knockout cassette was constructed, and a knockout site was designed using the pfkA gene as a template. The knockout site was then integrated into the PTargetT plasmid using PTargetT-pfkA-1:GTATTTTATACACAAAATGCTGGCGAGCGGCATCTTATTTG and PTargetT-pfkA-2:GATCCAACGCGCGAATTGTAGTCGATTGGCTGAGCTCATGAAG. Finally, the two homologous fragments were seamlessly cloned into PTargetT to increase the success rate of subsequent knockout. The plasmid was then introduced into host bacteria containing the pCas9 plasmid using chemical transformation. After bacterial growth, positive strains were screened using colony PCR to obtain recombinant Escherichia coli Ec01.

[0042] Recombinant Escherichia coli Ec01 and recombinant Escherichia coli before pfkA gene knockout were cultured in the following manner.

[0043] Culture conditions: Recombinant Escherichia coli was activated by static incubation at 37°C on LB solid medium (containing 50 µg / mL ampicillin and 50 µg / mL streptomycin sulfate). Single colonies were picked and inoculated into 5 mL of LB liquid medium containing the two antibiotics, and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase to obtain the seed culture.

[0044] Fermentation: The seed culture was transferred at a 1% (v / v) inoculation rate to 50 mL of fermentation broth (5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, 10 g / L D-glucose, 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate), pH 7.0, and cultured under the same conditions until OD. 600When the concentration reached 0.4 or higher, IPTG at a final concentration of 0.1 mM was added to induce protein expression. The culture temperature was then adjusted to 30°C, and the mixture was continuously incubated with shaking for 72 h. Samples were taken every 12 h during this period, and the OD was measured. 600 and product output.

[0045] Fermentation product detection and analysis: D-allulose, D-fructose, and D-glucose in the reaction system were detected by high performance liquid chromatography (HPLC; G1362A, Agilent Technologies Inc., China). The detector was 1260 RID (G1362A), the column was Aminex HPX-87C, 300 mm × 7.8 mm, the column temperature was maintained at 80℃ during the detection process, ultrapure water was used as the mobile phase, the flow rate was kept constant at 0.6 mL / min, and the injection volume was 20 µL.

[0046] Fermentation Results: As shown in Table 1, the fermentation results using recombinant *E. coli* Ec01 were significantly improved, demonstrating that recombinant *E. coli* Ec01 has a significant advantage in increasing D-allulose production compared to the control group without pfkA gene knockout. However, the OD200 after pfkA gene knockout was significantly lower. 600 A noticeable change occurs starting after 60 hours, OD 600 Initially, the levels were significantly lower than those without the pfkA gene knocked out.

[0047] By 72 hours, the final D-allulose yield in the fermentation product of recombinant *E. coli* Ec01 was 2.04 g / L, while the D-allulose yield of recombinant *E. coli* without pfkA gene knockout was 1.16 g / L after fermentation. This indicates that pfkA gene knockout effectively balances the synthesis of D-allulose; however, pfkA gene knockout weakens the growth rate and final cell mass (final OD) of the producing strain. 600 The final OD value of the non-knockout recombinant E. coli was 1.54. 600 (1.71).

[0048] Example 2

[0049] This embodiment describes the construction and fermentation of D-allulose from recombinant Escherichia coli (Ecob. Eco2). The specific construction process is as follows:

[0050] Construction of recombinant plasmid pRSFDuet-Mlc: Using the Mlc gene from the wild-type BL21(DE3) genome as a template, Mlc-F: CCACAGCCAGGATCCGAATTCAGTGGTTGCTGAAAACCAGCCTG as the upstream primer and Mlc-R: GACTTAAGCATTATGCGGCCGCAAGCTTTTAACCCTGCAACAGACGAATCAACAA as the downstream primer, the obtained 1221 bp target gene fragment was directionally cloned into plasmid pRSFDuet-1 treated with EcoR I / Hind III restriction endonuclease to obtain recombinant plasmid pRSFDuet-Mlc.

[0051] Recombinant plasmid pRSFDuet-Mlc-glpK G913S Construction: Using glpK from the wild-type BL21(DE3) genome G913S Using the gene as a template, glpK-F was employed: GAAGGAGATATACATATGGCAGATCTAATGACTGAAAAAAAATATATCGTTGCGCTCGA,glpK G913S -R: CACCGCACTTTCCAACGC and glpK G913S -F: GCGTTGGAAAGTGCGGTG, glpK-R: GCAGCGGTTTCTTTACCAGACTCGAGTTATTCGTCGTGTTCTTCCCACGC After PCR amplification using primers, the obtained 1608 bp target gene fragment was directionally cloned into the plasmid pRSFDuet-Mlc treated with Bgl I / Xho I restriction endonucleases, resulting in the recombinant plasmid pRSFDuet-Mlc-glpK. G913S The schematic diagram of its construction is as follows Figure 4 As shown.

[0052] Construction of recombinant Escherichia coli Ec02: The recombinant plasmid pRSFDuet-Mlc-glpK was constructed. G913S Recombinant Escherichia coli Ec01 was transformed into recombinant Escherichia coli Ec02 using a chemical transformation method.

[0053] Culture conditions: Recombinant *E. coli* were activated on plates by static incubation at 37°C using LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, and 50 µg / mL kanamycin). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, and 50 µg / mL kanamycin) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0054] Fermentation: Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (D-glucose 5 g / L, glycerol 4 g / L, sodium chloride 10.0 g / L, peptone 10.0 g / L, yeast extract 5.0 g / L, ampicillin 50 µg / mL, streptomycin sulfate 50 µg / mL, kanamycin 50 µg / mL), pH 7.0, and maintain the same conditions until OD. 600 When the concentration reached 0.4 or higher, IPTG at a final concentration of 0.1 mM was added to induce protein expression. The culture temperature was then adjusted to 30°C, and the mixture was continuously cultured with shaking for 72 h. Samples were taken every 12 h to measure the OD. 600 and product output.

[0055] Fermentation results: As shown in Table 2, the OD of recombinant Escherichia coli Eco2 after 72 hours of fermentation was [data missing]. 600 The OD value reached 2.34, while glycerol consumption was 1.80 g / L. Ultimately, in a medium with 5 g / L D-glucose as the synthesis substrate, the D-allulose yield reached 1.22 g / L. 600 Both the yield and the product were improved compared to Example 1. The results indicate that the combination of appropriate retention of key node genes and the strategy of synergistic utilization of complex carbon sources can effectively coordinate the contradiction between microbial growth and product synthesis.

[0056] Example 3

[0057] This embodiment describes the construction and fermentation of recombinant Escherichia coli Eco03 to prepare D-allulose. The specific construction process is as follows:

[0058] Construction of recombinant plasmid PACYCDuet-aldO: Using the aldO gene from Streptomyces cerevisiae M145 as a template, PCR amplification was performed using primer pairs aldO-F: ATGCAAAACATTACCCAGTCCTGG and aldO-R: AGCATTATGCGGCCGCAAGCTTTTAGCCAGCCAGAACGCCAC. The obtained 1257bp was then bound to the MCS1 region of the PACYCDuet vector to obtain the recombinant plasmid PACYCDuet-aldO.

[0059] Construction of the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB: Using the wild-type BL21(DE3) genome as a template, the target genes were amplified using primer pairs: rhaD-F: ATGCAAAACATTACCCAGTCCTGG, rhaD-R: GCTGCCGCCGCCTCCTTACAGCGCCAGCGCAC; yqaB-F: GGAGGCGGCGGCAGCATGTACGAGCGTTATGCAGG, yqaB-R: TCACAGCAAGCGAACATCCACG. The two target genes were then linked using the previously validated flexible linker GGGGS and integrated into the MCS2 region of the PACYCDuet-aldO recombinant vector. This reduced the distance between downstream enzyme systems and improved the final transformation efficiency, resulting in the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB. A schematic diagram of its construction is shown below. Figure 5 As shown.

[0060] Construction of recombinant Escherichia coli Ec03: The recombinant plasmid PACYCDuet-aldO-rhaD-yqaB was transformed into recombinant Escherichia coli Ec02 by chemical transformation to obtain recombinant Escherichia coli Ec03.

[0061] Culture conditions: Recombinant *E. coli* were activated by static incubation at 37°C on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0062] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, 10 g / L glycerol, and 10 g / L D-glucose, and 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 When the concentration reached 0.4 or higher, IPTG at a final concentration of 0.1 mM was added to induce protein expression. The culture temperature was then adjusted to 30°C, and the cells were continuously cultured with shaking for 72 h. Samples were taken every 12 h during this period, and OD was measured. 600 and product output.

[0063] Fermentation results: As shown in Table 3, the yield of D-allulose increased to 2.89 g / L, and OD... 600 The yield was 8.2, with 0.92 g / L of D-sorbose produced, and the glycerol consumption rate was also improved to a certain extent, resulting in a certain increase in yield compared to the synthesis route before the introduction of the aldol reaction.

[0064] Example 4

[0065] This embodiment is an example of finding the optimal fermentation conditions for recombinant Escherichia coli Eco3 by optimizing and adjusting the fermentation conditions.

[0066] (1) Fermentation was carried out at IPTG concentration gradients of 0.1-0.5 mM.

[0067] Fermentation was carried out at IPTG concentrations ranging from 0.1 to 0.5 mM. Recombinant *E. coli* were activated by static incubation at 37°C on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0068] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, 10 g / L glycerol, and 10 g / L D-glucose; containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 When the concentration reached 0.4 or higher, IPTG at a final concentration of 0.1-0.5 mM was added to induce protein expression. The culture temperature was then adjusted to 30℃, and the cells were continuously cultured with shaking for 72 h. Samples were taken every 12 h during this period, and OD was measured. 600 and product output.

[0069] The addition of IPTG altered the yield of D-allulose, and the change was not linear, as shown in Table 4. Table 4 reveals that IPTG concentrations of 0.1–0.5 mM all showed good effects; however, the optimal effect was observed at an IPTG concentration of 0.3 mM.

[0070] (2) Different OD values ​​when adding inducing agents 600 Fermentation will proceed below.

[0071] Gradient OD in the range of 0.3–1.1 600 IPTG was added to the culture medium. Recombinant *E. coli* was activated by static incubation at 37°C on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0072] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, 10 g / L glycerol, and 10 g / L D-glucose; and 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 Protein expression was induced by adding IPTG at a final concentration of 0.5 mM within a gradient ranging from 0.3 to 1.1. The culture temperature was then adjusted to 30°C, and the cells were continuously cultured with shaking for 72 h. Samples were taken every 12 h during this period, and OD was measured. 600 and product output.

[0073] Different initial OD values ​​were observed upon addition of the inducer IPTG at a concentration of 0.5 mM. 600 D-allulose and the final OD 600 As shown in Table 5, it can be seen that when the inducer IPTG is added, the initial OD... 600 It showed good results in the range of 0.3 to 1.1; initial OD 600 The effect is better when the OD is between 0.5 and 0.9, but when the initial OD... 600 When the value is greater than 0.9, the effect actually decreases.

[0074] (3) D-allulose and OD under optimal fermentation conditions 600 Changes

[0075] At 0.7 OD 600IPTG was added to the culture medium. Recombinant *E. coli* was activated by static incubation at 37°C on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0076] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, 10 g / L glycerol, and 10 g / L D-glucose; and 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 Once the concentration reached 0.7, IPTG was added to a final concentration of 0.3 mM to induce protein expression. The culture temperature was then adjusted to 30°C, and the mixture was continuously incubated with shaking for 72 h. Samples were taken every 12 h during this period, and OD was measured. 600 and product output.

[0077] The results are shown in Table 6, at OD 600 After inducing fermentation for 72 h with IPTG at a final concentration of 0.3 mM when the concentration was 0.7, the final D-allulose yield increased to 3.46 g / L, and the final OD... 600 The result was improved to 9.2. The results confirmed that the optimized culture conditions significantly improved the cell count and yield.

[0078] (4) Changes under different ratios of D-glucose and glycerol

[0079] Using a total carbon source of 20 g / L as substrate, D-glucose and glycerol concentrations of 9:1, 4:1, 3:2, 1:1, 2:3, 1:4, and 1:9 were employed for fermentation production. Recombinant *E. coli* was activated on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and incubated at 37°C. Single colonies were inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0080] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, and a total of 20 g / L of carbon source in varying proportions of D-glucose and glycerol; and 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 Once the concentration reached 0.7, IPTG was added to a final concentration of 0.3 mM to induce protein expression. The culture temperature was then adjusted to 30°C, and the mixture was continuously incubated with shaking for 72 h. Samples were taken every 12 h during this period, and OD was measured. 600 and product output.

[0081] The fermentation results are shown in Table 7.

[0082] After optimization, when the D-glucose:glycerol ratio was 1:1, OD was used. 600 When the concentration of D-allulose was 0.7, the addition of 0.3 mM IPTG for induction resulted in a final D-allulose yield of 3.46 g / L and a final OD value of [missing value]. 600 The yield was increased to 9.2; under a fixed total carbon source of 20 g / L, the ratio of D-glucose to glycerol was gradually adjusted (9:1-1:9), and the optimal fermentation effect was achieved with a composite carbon source of 4:1 D-glucose:glycerol ratio (16 g / L D-glucose + 4 g / L glycerol): D-allulose yield was 3.92 g / L, OD... 600 Upgraded to 10.4.

[0083] (5) Changes under different total carbon source concentrations

[0084] Fermentation was carried out using a total carbon source of 30-50 g / L as the substrate and a D-glucose to glycerol concentration of 4:1. Recombinant *E. coli* was activated on LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and incubated at 37°C with static culture. Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.

[0085] Transfer 1% (v / v) inoculum to 50 mL of fermentation broth (containing 12 g / L peptone, 24 g / L yeast extract, 2.31 g / L potassium dihydrogen phosphate, 12.54 g / L dipotassium hydrogen phosphate, and a total of 30-50 g / L of D-glucose and glycerol in a 4:1 carbon source ratio, and 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol), pH 7.0, and maintain the same conditions until OD. 600 The concentration of the protein was increased to 0.7, and IPTG was added to a final concentration of 0.3 mM to induce protein expression. The culture temperature was then adjusted to 30°C and cultured with shaking for 72 h. Samples were taken every 12 h during the period, and the product yield was measured.

[0086] The fermentation results are shown in Table 8.

[0087] Using a carbon source of 30-50 g / L (D-glucose:glycerol ratio of 4:1) as the substrate, OD was used... 600 When 0.7 g of IPTG was added for induction, the yield of D-allulose reached 5.40 g / L when the total carbon source concentration was 50 g / L.

[0088] Table 1. D-allulose and OD in recombinant E. coli at different time points before and after pfkA knockout. 600 Changes

[0089]

[0090] Table 2. D-allulose and OD at different time points during fermentation of D-glucose / glycerol by recombinant Escherichia coli Eco2. 600 Changes

[0091]

[0092] Table 3. D-allulose and OD at different time points during fermentation of D-glucose / glycerol by recombinant Escherichia coli Eco03. 600 Changes

[0093]

[0094] Table 4. Recombinant Escherichia coli Eco03 D-allulose and OD2 induction at different IPTG levels 600 Changes

[0095]

[0096] Table 5. Different OD values ​​of recombinant Escherichia coli Eco03 upon addition of inducing agent 600 D-allulose and OD 600 Changes

[0097]

[0098] Table 6. D-allulose and OD under optimal fermentation conditions 600 Changes

[0099]

[0100] Table 7. D-allulose and OD at different ratios of D-glucose and glycerol 600 Changes

[0101]

[0102] Table 8. Changes in D-allulose at total carbon source concentrations of 30-50 g / L

[0103]

[0104] This invention, based on metabolic engineering of the glycolysis pathway in *E. coli*, partially knocks out the phosphofructokinase (pfkA) gene to regulate carbon flux allocation and constructs a D-glucose / glycerol co-utilization system to optimize D-allulose synthesis. In Example 1, recombinant *E. coli* Ec01 with the pfkA gene knocked out achieved a D-allulose yield of 2.04 g / L in 10 g / L D-glucose fermentation; however, OD... 600 The OD of recombinant E. coli with the pfkA gene not knocked out was only 1.54. 600 The value was 1.71. To further balance the growth and synthesis of recombinant E. coli, glycerol was introduced as an auxiliary carbon source in Example 2, and Mlc-glpk was constructed. G913S Gene overexpression systems alleviate the effects of glucose. In a complex carbon source of 5 g / L D-glucose and 4 g / L glycerol, the OD of recombinant *E. coli* Ec02... 600 The D-allulose yield increased to 2.34 g / L, with glycerol consumption at 1.80 g / L. Experiments confirmed that the pfkA gene is a key node regulating fructose-6-phosphate partitioning; its partial knockout combined with a metabolic specialization strategy effectively coordinates cell growth and product synthesis. Simultaneously, the utilization of a complex carbon source reduced acetic acid accumulation and maintained TCA cycle function, providing a new approach for the efficient biosynthesis of D-allulose. In Example 3, a hydroxyl reaction synthesis system was constructed to achieve the synthesis of D-allulose using glycerol as a substrate. In recombinant *E. coli* Ec03, after fermentation with 10 g / L glycerol for 72 h, the D-allulose yield increased to 2.89 g / L, but due to the glucose effect and plasmid metabolic burden, the cell OD... 600 The value decreased to 8.2 with significant carbon source residue. In Example 4, by optimizing the induction conditions, it was determined that at OD... 600Adding 0.3 mM IPTG to a concentration of 0.7 μg / L induced a balance between protein expression and cell growth, increasing D-allulose production to 3.46 g / L. Further adjustment of the carbon source ratio, achieving a D-glucose:glycerol ratio of 4:1, resulted in a significant increase in cell OD500. 600 The D-allulose yield reached 3.92 g / L, with a carbon source concentration of 10.4 g / L. Finally, by increasing the carbon source concentration to 50 g / L, the D-allulose yield reached 5.40 g / L. The experiment confirmed that the synergistic effect of the aldol reaction pathway and the glycolysis pathway can effectively broaden the carbon metabolic flux, while dynamic regulation of the carbon source ratio can significantly alleviate the glucose effect and reduce metabolic stress. This strategy provides a new reference for the synthesis of rare ketoses.

[0105] The above description is merely a preferred embodiment of the present invention and does not limit the present invention. All modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0106] The principle of this invention is as follows:

[0107] This invention successfully constructed a D-allulose synthesis platform based on glycolysis and aldol reaction, using *E. coli* as the chassis cell, through exploration of multi-module carbon metabolism engineering strategies. First, a glycolysis-based D-allulose synthesis system was constructed, enabling the synthesis of D-allulose from D-glucose via glycolysis. Next, the carbon metabolic flux allocation in this pathway was explored, verifying that the pfkA gene is a key carbon metabolism gene in the synthesis pathway. Knocking out the pfkA gene improved the final conversion rate, but also led to a further decrease in cell mass. Further, a glucose effector inhibitor (Mlc gene) and a glycerol kinase mutant (glpk) were introduced. G913S The gene enables metabolic specialization and synergistic utilization from a single carbon source (D-glucose) to a complex carbon source (D-glucose / glycerol). Glycerol satisfies the cell growth requirements, while more D-glucose is directed to D-allulose synthesis. Next, a system for synthesizing D-allulose via an aldol reaction using glycerol as a substrate was constructed. After successfully synthesizing D-allulose and the byproduct D-sorbose, this system was combined with a complex carbon source utilization system. This broadened the downstream glycerol utilization capacity, mitigating the glucose effect, while increasing the final D-allulose yield. Finally, the fermentation conditions were optimized, achieving a higher D-allulose yield while maintaining sufficient cell volume.

Claims

1. A method for the simultaneous synthesis of D-allulose from *Escherichia coli* using a D-glucose / glycerol complex carbon source system, characterized in that: The product was prepared by fermentation of recombinant Escherichia coli using D-glucose / glycerol as a substrate; the recombinant Escherichia coli was recombinant Escherichia coli EcO2 and / or recombinant Escherichia coli EcO3. The recombinant Escherichia coli Ec02, based on E. coli BL21 (DE3), overexpresses the pgi, glk, alse, and a6pp genes, and also overexpresses the Mlc and glpk genes. G913S Gene, knock out the pfkA gene; The recombinant Escherichia coli Ec03, based on E. coli BL21 (DE3), overexpresses the pgi gene, glk gene, alse gene, a6pp gene, and also overexpresses the Mlc gene and glpk gene. G913S Genes, knock out the pfkA gene, and simultaneously overexpress the aldO, rhaD, and yqaB genes; The culture conditions for the recombinant Escherichia coli Eco2 and recombinant Escherichia coli Eco3 are as follows: pick a single colony and inoculate it into LB liquid medium, then shake and culture until the logarithmic growth phase; The fermentation conditions for the recombinant Escherichia coli Eco2 and recombinant Escherichia coli Eco3 were as follows: 1% (v / v) inoculum was transferred to the fermentation broth; pH 7.0; and the temperature was adjusted to OD. 600 When the concentration reaches 0.4 or higher, add IPTG as an inducer at a concentration of 0.1-0.5 mM; then adjust the culture temperature to 30℃ and ferment for 12-72 hours. The initial OD of the recombinant Escherichia coli Eco2 and recombinant Escherichia coli Eco3 600 The value ranges from 0.3 to 1.

1. The concentration ratio of D-glucose to glycerol was (9~1):(1~9); The recombinant Escherichia coli Ec02 has a complex carbon source of D-glucose and glycerol, wherein D-glucose is 5 g / L and glycerol is 4 g / L. The recombinant Escherichia coli Eco3 has a complex carbon source of D-glucose and glycerol, wherein the complex carbon source has a concentration of 20-50 g / L. The method for constructing the recombinant Escherichia coli Ec02 is as follows: Recombinant E. coli Ec01 was obtained by overexpressing the pgi, glk, alse, and a6pp genes and knocking out the pfkA gene using E. coli BL21(DE3) as the chassis host bacterium. Mlc gene, glpK G913S The gene was ligated into the vector pRSFDuet-1 to obtain the recombinant plasmid pRSFDuet-Mlc-glpK. G913S The recombinant plasmid pRSFDuet-Mlc-glpK G913S The bacteria were transformed into recombinant Escherichia coli Ec01 to obtain recombinant Escherichia coli Ec02. The method for constructing Ec03 is as follows: The aldO gene, rhaD gene, and yqaB gene were ligated into the vector PACYCDuet-1 to obtain the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB; the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB was transformed into recombinant Escherichia coli Ec02 to obtain recombinant Escherichia coli Ec03.

2. The method for synthesizing D-allulose according to claim 1, characterized in that: The a6pp gene is derived from Bacteroides fragilis NCTC 9343; the aldO gene is derived from Streptomyces fragilis M145.

3. The method for synthesizing D-allulose according to claim 1, characterized in that: The specific construction process of the recombinant Escherichia coli Ec02 is as follows: The pgi and glk genes were ligated into the vector pCDFDuet-1 to obtain the recombinant plasmid pCDFDuet-pgi-glk; the a6pp and alse genes were ligated into the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-a6pp-alse; the recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse were transformed into Escherichia coli BL21(DE3), and the pfkA gene was knocked out to obtain recombinant Escherichia coli Ec01; Mlc gene, glpK G913S The gene was ligated into the vector pRSFDuet-1 to obtain the recombinant plasmid pRSFDuet-Mlc-glpK. G913S ; The recombinant plasmid pRSFDuet-Mlc-glpK G913S The bacteria were transformed into recombinant Escherichia coli Ec01 to obtain recombinant Escherichia coli Ec02.

4. The method for synthesizing D-allulose according to claim 1, characterized in that: The fermentation is carried out by the following method: recombinant Escherichia coli Eco2 or recombinant Escherichia coli Eco3 is inoculated into LB liquid medium and cultured to obtain seed liquid; The seed culture is then inoculated into the fermentation broth for fermentation. The inoculum size of recombinant Escherichia coli Eco2 or recombinant Escherichia coli Eco3 in the fermentation broth was 1%; LB liquid medium was prepared according to the following formula: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.

5. The method for synthesizing D-allulose according to claim 1 or claim 4, characterized in that: The fermentation broth uses different formulations for different strains. Specifically, the fermentation broth for recombinant *Escherichia coli* Eco2 consists of: a complex carbon source, 5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, 15 g / L agar powder, 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, and 50 µg / mL kanamycin; the complex carbon source is D-glucose and glycerol, with D-glucose at 5 g / L and glycerol at 4 g / L. The fermentation broth corresponding to recombinant Escherichia coli Eco03 is as follows: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, complex carbon source 20-50 g / L, 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, 50 µg / mL kanamycin, and 50 µg / mL chloramphenicol; the complex carbon source is D-glucose and glycerol, and the ratio of D-glucose to glycerol is (9:1)-(1:9).

Images