Application of substance overexpressing Piezo2 in treatment of neurodegenerative diseases
By injecting a recombinant viral vector overexpressing Piezo2 into the dorsal root ganglion, the side effects of Piezo1 activators were resolved, achieving effective treatment of Alzheimer's disease and improving behavior and cognitive function in mice.
Patent Information
- Application Number
- CN202511122575.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-11-11
AI Technical Summary
In the prior art, Piezo1 activators such as Yoda1 used to treat Alzheimer's disease have side effects such as accelerated osteoarthritis progression and abnormal renal vasodilation, and the systemic administration method is inefficient. There is a lack of reports on effective Piezo2 as a therapeutic target for AD.
Recombinant viral vectors, particularly adenovirus vectors, that overexpress Piezo2 were directly injected into the dorsal root ganglion, significantly increasing the expression level of Piezo2 protein. This approach can be used to treat Alzheimer's disease, reducing side effects and improving treatment efficiency.
It significantly alleviates anxiety behavior in AD model mice, improves spatial learning and memory abilities, shortens the treatment cycle to 6 weeks, reduces side effects, and improves treatment efficiency.
Smart Images
Figure CN120919323A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a therapeutic agent for neurodegenerative diseases, and more particularly to the use of substances that overexpress Piezo2 in the treatment of neurodegenerative diseases. Background Technology
[0002] Alzheimer's disease (AD) is a common neurodegenerative disease in the elderly, characterized by comprehensive dementia including learning and memory impairment, aphasia, apraxia, agnosia, and personality and behavioral changes. AD has two main neuropathological features: 1) extracellular amyloid plaques composed of β-amyloid protein (Aβ), and 2) intracellular neurofibrillary tangles (NFTs) mainly formed by abnormally hyperphosphorylated tau protein. AD is the leading cause of dementia in the elderly, but currently there are no effective drugs to inhibit its progression (Chang, Shao et al. 2021; Chu and Liu 2021).
[0003] Piezo proteins are a family of mechanosensitive ion channels that convert mechanical stimuli into electrochemical signals, playing a crucial role in physiological processes such as touch, proprioception, and vascular regulation. Reports indicate that Piezo1 in microglia senses stiffness stimuli from Aβ fibrils, subsequently inducing Ca2+... 2+ Influx of calcium ions leads to microglia aggregation and phagocytosis of Aβ plaques. Using the drug Yoda1 to activate Piezo1 in microglia can improve brain Aβ deposition and cognitive impairment in AD model mice (Hu, Chen et al. 2023). However, this systemic administration method has significant limitations: 1) Yoda1 induces ferroptosis by activating Piezo1 channels, triggering calcium ion influx within chondrocytes and accelerating the progression of osteoarthritis (Wang, Li et al. 2022; Lin, Xu et al. 2025); 2) its mediated eNOS activation leads to abnormal renal vasodilation, potentially exacerbating vasomotor dysregulation in patients with acute hyperglycemia (Fei, Xu et al. 2023). Although Piezo1 has been reported as a therapeutic intervention target for AD, the protective effect of Piezo2 on AD has not yet been reported. Summary of the Invention
[0004] Objective of this invention: The objective of this invention is to provide the application of substances overexpressing Piezo2 in the preparation of therapeutic drugs for neurodegenerative diseases, drugs for enhancing cognition or reducing anxiety, and recombinant cells for treating neurodegenerative diseases, thereby addressing the problem of how to target Piezo2 to treat neurodegenerative diseases. Another objective of this invention is to propose a therapeutic drug for Alzheimer's disease, addressing the problem of how to treat Alzheimer's disease.
[0005] Technical solution: The application of the substance overexpressing Piezo2 described in this invention in any of the following:
[0006] Preparation of drugs for the treatment of neurodegenerative diseases;
[0007] To develop drugs that enhance cognition or reduce anxiety;
[0008] Prepare recombinant cells for the treatment of neurodegenerative diseases.
[0009] Preferably, the substance overexpressing Piezo2 is an expression vector capable of exogenously expressing biologically active Piezo2 protein in living cells.
[0010] In some embodiments, after the expression vector is transfected into nerve cells, it can significantly increase the expression level of active Piezo2 protein in the host cells.
[0011] Preferably, the expression vector is a viral vector or plasmid vector that clones the Piezo2 gene expression cassette, and the nucleotide sequence of the Piezo2 gene is shown in SEQ ID No. 2.
[0012] Preferably, the viral vector includes at least one of lentivirus, adenovirus, adeno-associated virus, and retrovirus, and the plasmid vector includes a shuttle plasmid, such as CV235 or pAdTrack-CMV plasmid.
[0013] Preferably, the living cells are cells from peripheral nerve tissue.
[0014] Furthermore, the peripheral nerve tissue is the dorsal root ganglion.
[0015] Preferably, the neurodegenerative disease includes Alzheimer's disease.
[0016] Preferably, the method for preparing recombinant cells for treating neurodegenerative diseases is as follows: transfecting cells in the dorsal root ganglion with a viral vector containing a cloned Piezo2 gene expression cassette to obtain recombinant cells, wherein the expression level of Piezo2 protein in the recombinant cells is significantly higher than that in wild-type cells.
[0017] In some embodiments, the Piezo2 gene expression cassette consists of a Piezo2 protein coding sequence and necessary expression elements. The expression elements may include a neuron-specific hSyn promoter, a WPRE element that enhances transcription, a T2A self-cleaving peptide sequence, etc. The gene expression cassette may also include an EGFP reporter gene, etc., to indicate the expression status of the Piezo2 protein in tissues or cells.
[0018] Furthermore, the transfection method is as follows: a viral vector containing a cloned Piezo2 gene expression cassette is added to the transfection system to obtain a viral suspension; then the viral suspension is mixed with cells for culture to complete the transfection.
[0019] A second aspect of this invention discloses a medicament for treating Alzheimer's disease, comprising a viral titer of at least 1 × 10⁻⁶ for transfecting cells. 12 A suspension of adenovirus at a concentration of vg / mL, wherein the adenovirus contains the aforementioned Piezo2 gene expression framework. Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0020] This invention involves injecting a recombinant virus overexpressing Piezo2 protein into the L4-6 dorsal root ganglia. This significantly alleviates open field anxiety in AD model mice and improves their spatial learning and memory abilities. Furthermore, compared to systemic injection of a Piezo1 activator, the treatment duration is drastically shortened (from 14 weeks to 6 weeks). The injection of the recombinant virus overexpressing Piezo2 protein requires only two administrations, while the Piezo1 activator Yoda1 requires daily intraperitoneal injections for 14 weeks. Therefore, Piezo2, as a therapeutic target for AD, can effectively improve treatment efficiency and reduce side effects. Attached Figure Description
[0021] Figure 1 The effects of injecting adenovirus Ad-Piezo2 and intraperitoneal injection of Yoda1 into the L4-5 dorsal root ganglia on the behavior of 3xTg-AD mice were investigated. Figure A shows the animal experimental protocol in Example 1; Figure B shows the dwell time in the central area of the open field experiment; Figure C shows the latency of mice finding the safe platform on the training day of the water maze experiment; Figure D shows the fastest time (latency) for mice to enter the safe island area on the test day of the water maze experiment. P < 0.05 was considered statistically significant.
[0022] Figure 2The study investigated the effects of Piezo1 protein overexpression in the dorsal root ganglia or Piezo2 protein overexpression in the brain on the behavior of 3xTG-AD mice. Figure A shows the animal experimental protocol in Example 2; Figure B shows the dwell time in the central region of the open field experiment; Figure C shows the latency of mice finding the safe platform on the water maze training day; Figure D shows the fastest time (latency) for mice to enter the safe island area on the water maze test day; Figure E shows brain slices after injection of Ad-Piezo2 virus into the hippocampus of mice, detecting EGFP signal to confirm viral expression; Figure F shows brain slices after injection of Ad-Piezo1 virus into the L4-6 dorsal root ganglia of mice, detecting EGFP signal to confirm viral expression. P < 0.05 was considered statistically significant.
[0023] Figure 3 The spectrum of the pAdTrack-CMV vector. Detailed Implementation
[0024] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0025] Example 1: The experimental method for treating AD by overexpressing Piezo1 protein (amino acid sequence as shown in SEQ ID No. 3) or Piezo2 protein (amino acid sequence as shown in SEQ ID No. 4) is as follows:
[0026] (1) Construct recombinant viruses overexpressing Piezo1 or Piezo2 proteins, as follows:
[0027] The complete coding sequences of Piezo1 (as shown in SEQ ID No. 1) and Piezo2 (as shown in SEQ ID No. 2) were obtained from the NCBI database, and the target gene fragments were obtained by PCR amplification.
[0028] Piezo1-Sense primer:CGCGGGCGGCCGCATGGAGCCGCACGTGCT
[0029] Piezo1-Antisense primer:TCGAGATATCCCTACTCCCTCTCACGTGTCCA
[0030] Piezo2-Sense primer: CGGGGGTACCATGGCTTCGGAAGTGGTGTG
[0031] Piezo2-Antisense primer:CGCGGGCGGCCGCTCAGTTTGTTTTTTCTCTAGTCC
[0032] Subsequently, the pAdTrack-CMV vector was used as the expression framework, with its multiple cloning site located at 9059-9109 bp. Figure 3 The vector and PCR-amplified Piezo1 gene fragment were digested with NotI and EcoRV, and the Piezo2 gene fragment was digested with Acc65I and NotI. After purification by agarose gel electrophoresis, ligation was performed overnight at 16°C using T4 DNA ligase. The ligation product was transformed into BJ5183 competent cells and screened on LB agar plates containing 50 μg / mL kanamycin. Positive clones were picked, and the correctness of the inserted sequence was verified by colony PCR and sequencing to ensure no frameshift mutations and the correct reading frame. The successfully validated recombinant plasmid was purified using an Endo-free large-scale extraction kit to obtain high-purity plasmids for subsequent virus packaging.
[0033] After linearization with PacI, the plasmid was transfected into HEK293A cells for virus packaging. Cells were cultured for 7-10 days until a significant cytopathic effect was observed. Cell lysates were collected, and viral particles were purified by repeated freeze-thaw cycles and cesium chloride density gradient centrifugation. Viral titer was then determined by qPCR. The final adenovirus particles (Ad-Piezo2 or Ad-Piezo1) were transferred to PBS + 5% glycerol buffer, aliquoted, and stored at -80°C for subsequent animal experiments. Viral genome titer was determined by qPCR to ensure a titer of 1 × 10⁻⁶. 12 Usage standards above vg / mL.
[0034] (2) In this invention, 3xTg-AD model mice were injected with Ad-Piezo2 virus into the L4-6 dorsal root ganglia to specifically induce overexpression of exogenous Piezo2 protein in the dorsal root nerves. The specific animal experimental protocol is as follows: Figure 1 As shown in Figure A, in the model group, 8-month-old 3xTg-AD mice were injected with 3 μL of Ad-EGFP virus (containing neither the Piezo2 nor Piezo1 gene sequence, but expressing only green fluorescent protein) into the dorsal root ganglia, and the injection was repeated 3 weeks later. The positive control group consisted of 6-month-old mice injected intraperitoneally with 3 mg / kg / day Yoda1. In the Piezo2 group, 8-month-old 3xTg-AD mice were injected with 3 μL of Ad-Piezo2 virus into the L4-6 dorsal root ganglia, and the injection was repeated 3 weeks later. Six weeks after the first viral injection, at 9.5 months of age, the following behavioral experiments were conducted:
[0035] Open field assays were performed using a 48cm×48cm×40cm white plastic apparatus. Analysis of 10 minutes of video tracking revealed that Piezo2 mice spent significantly more time in the central area (15cm×15cm) of the open field than the EGFP group, while there was no significant difference between the Yoda1 group and the EGFP group. This indicates that Yoda1 injection alone has no protective effect against anxiety behavior in 3xTG-AD mice in the open field, while Piezo2 can significantly alleviate anxiety in mice (e.g., ...). Figure 1 (As shown in Figure B).
[0036] A black circular pool (23±2℃) with a diameter of 100cm and a height of 60cm was used for the water maze experiment. Non-toxic white food coloring was added to the pool water to create an opaque environment. The pool was divided into four quadrants, with a hidden platform (1cm underwater) of 10cm in diameter fixed in the center of the first quadrant. During the test, each mouse entered the water from a randomly selected quadrant, with each test lasting 60 seconds. If a mouse failed to find the platform within the specified time, it was guided to the platform and remained there for 15 seconds for spatial memory training. The test was conducted for four consecutive days (random testing in all four quadrants each day), and the latency (time to reach the platform) of each group was recorded. The results showed that compared with the EGFP group, the average latency of mice in the Piezo2 and Yoda1 groups was significantly shorter from day 1 to day 4, indicating that both intervention methods can effectively improve the spatial learning ability of AD model mice (e.g., Figure 1 (As shown in Figure C).
[0037] During the space exploration test phase (day 5), the underwater platform was removed and the mice were placed into the water tank from the third quadrant. Quantitative analysis using a video tracking system showed that the latency (time to reach the platform) was significantly shortened in both the Piezo2 and Yoda1 groups (e.g., [missing information]). Figure 1 As shown in Figure D), and all results are statistically significant, indicating that two injections of Ad-Piezo2 can achieve the same spatial memory consolidation and enhancement effect as 3.5 months of continuous daily administration of Yoda1.
[0038] In summary, by Figure 1 As shown in the BD image, injection of Ad-Piezo2 virus into the L4-5 dorsal root ganglion significantly improved the behavior of 3xTg-AD mice, and the effect was better than that of intraperitoneal injection of the Piezo1 agonist Yoda1.
[0039] Example 2: The effects of overexpression of Piezo1 protein in the dorsal root ganglion or overexpression of Piezo2 protein in the brain on the behavior of 3xTG-AD mice were investigated. The methods are as follows:
[0040] Eight-month-old 3xTg-AD mice were selected and injected with Ad-EGFP virus (EGFP control group) or Ad-Piezo1 virus (Piezo1 group) into the L4-6 dorsal root ganglia, or with Ad-Piezo2 virus (Piezo2-B group) into the brain. The injection dosage and number of injections were the same as in Example 1. Behavioral tests were performed when the mice reached 9.5 months of age, as detailed in the specific animal experimental protocol. Figure 2 As shown in Figure A.
[0041] The open field test results showed that there was no significant difference in the time spent in the central region among the three groups of mice (e.g., Figure 2 As shown in Figure B, neither high expression of Piezo1 protein in the dorsal root ganglion nor overexpression of Piezo2 protein in the brain could mimic the effect of overexpression of Piezo2 protein in the dorsal root ganglion on improving open field anxiety behavior in AD mice as shown in Example 1.
[0042] Similarly, in the water maze experiment, there was no significant difference in the latency of the three groups of mice to find the safe platform on the training day and the test day (e.g. Figure 2 (As shown in the CD image). This result indicates that the dorsal root ganglion highly expresses Piezo1 protein (e.g., ...). Figure 2 (as shown in Figure F) or brain overexpression of Piezo2 protein (e.g.) Figure 2 As shown in Figure E, the improvement effect of Piezo2 protein overexpression in the dorsal root ganglion on spatial learning and memory in AD mice in Example 1 could not be reproduced, further suggesting that the neuroprotective effect of Piezo2 protein overexpression in the dorsal root ganglion on AD is tissue-specific.
[0043] In summary, high expression of Piezo1 in the dorsal root ganglion or high expression of Piezo2 in the brain had no significant effect on the behavior of 3xTG-AD mice.
Claims
1. Application of substances that overexpress Piezo2 in any of the following: Preparation of drugs for the treatment of neurodegenerative diseases; To develop drugs that enhance cognition or reduce anxiety; Prepare recombinant cells for the treatment of neurodegenerative diseases.
2. The application according to claim 1, characterized in that, The substance that overexpresses Piezo2 is an expression vector capable of exogenously expressing biologically active Piezo2 protein in living cells.
3. The application according to claim 2, characterized in that, The expression vector is a viral vector or plasmid vector that clones the Piezo2 gene expression cassette, and the nucleotide sequence of the Piezo2 gene is shown in SEQ ID No.
2.
4. The application according to claim 3, characterized in that, The viral vector includes at least one of lentivirus, adenovirus, adeno-associated virus, and retrovirus, and the plasmid vector includes a shuttle plasmid.
5. The application according to claim 2, characterized in that, The living cells are cells from peripheral nerve tissue.
6. The application according to claim 5, characterized in that, The peripheral nerve tissue is the dorsal root ganglion.
7. The application according to claim 1, characterized in that, The neurodegenerative diseases mentioned include Alzheimer's disease.
8. The application according to claim 1, characterized in that, The method for preparing recombinant cells for treating neurodegenerative diseases is as follows: recombinant cells are obtained by transfecting cells in the dorsal root ganglion with a viral vector that clones the Piezo2 gene expression cassette. The expression level of Piezo2 protein in the recombinant cells is significantly higher than that in wild-type cells.
9. The application according to claim 8, characterized in that, The transfection method is as follows: a viral vector containing a cloned Piezo2 gene expression cassette is added to the transfection system to obtain a viral suspension; The virus suspension is then mixed with cells and cultured to complete the transfection.
10. A drug for treating Alzheimer's disease, characterized in that, Including a viral titer of at least 1 × 10⁻⁶ for transfecting cells. 12 A suspension of adenovirus at vg / mL, wherein the adenovirus contains a cloned Piezo2 gene expression framework.