Application of circRNA marker in preparation of reagent for diagnosing rheumatoid arthritis and kit

Abstract

The invention discloses an application of a circRNA (Ribonucleic Acid) marker in preparation of a reagent for diagnosing rheumatoid arthritis, the circRNA marker is hsacircRNA001715, and the expression of the hsacircRNA001715 in peripheral blood mononuclear cells of a cold-dampness arthralgia type rheumatoid arthritis patient (active stage and inactive stage) is obviously up-regulated compared with that of a healthy control person; in addition, the hsacircRNA001715 can be used for up-regulating the expression of a peripheral blood mononuclear cell NLRP3 of a patient with the cold-dampness arthralgia type RA in the active period through an hsacircRNA001715 / miR-1249-5p axis and promoting an inflammatory reaction; the invention further discloses a kit for rheumatoid arthritis diagnosis, the kit can be rapidly used for early diagnosis of rheumatoid arthritis by detecting the expression level of hsacircRNA001715, operation is easy and convenient, accuracy is high, and a new strategy can be provided for clinical diagnosis of rheumatoid arthritis.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of a circRNA marker in the preparation of reagents for diagnosing rheumatoid arthritis and a kit thereof. Background Technology

[0002] Rheumatoid arthritis (RA) is a severe chronic autoimmune disease characterized by joint inflammation and structural damage, sometimes accompanied by systemic manifestations, significantly impairing patients' health and quality of life. RA is often difficult to diagnose early, leading to delayed treatment and poor disease control, thus increasing the risk of joint destruction, cardiovascular complications, and other systemic comorbidities, ultimately potentially causing severe disability or even death. Therefore, early diagnosis and treatment are crucial for slowing disease progression and preventing irreversible joint damage and disability. Currently, in clinical practice, the diagnosis of RA primarily relies on the 2010 American College of Rheumatology / European League Against Rheumatism (2010 ACR / EULAR classification), which uses serological markers such as rheumatoid factor and anti-cyclic citrullinated peptide antibodies as core components of its scoring system. However, the limited sensitivity and specificity of these markers often lead to misdiagnosis and poor prognosis. In recent years, circular RNAs (circRNAs) have received increasing attention due to their role in inflammation and immune regulation. circRNAs play a crucial role in gene expression and cellular function and have been recognized as promising biomarkers for the diagnosis and treatment of rheumatoid arthritis (RA).

[0003] Circular RNAs (circRNAs) are a novel class of non-coding RNAs formed by the covalent bonding of the 3′ and 5′ ends of precursor RNA, resulting in a closed circular structure. They are characterized by high stability, strong tissue specificity, and widespread expression, playing a crucial regulatory role in gene expression and are considered among the most valuable biomarkers for disease diagnosis. Based on their origin, circRNAs are mainly classified into exon circular RNAs, intron circular RNAs, and exon-intron circular RNAs. Exon circRNAs are primarily located in the cytoplasm and typically regulate gene expression through a competitive endogenous RNA mechanism. Intron circular RNAs are mainly distributed in the nucleus, interacting with nuclear components such as regulatory factors, transcription factors, or RNA-binding proteins, and participating in the nuclear regulatory network. Exon-intron circular RNAs can exist in both the cytoplasm and the nucleus, and their function is usually related to their location. Studies have shown that circRNAs play a wide range of biological functions in various physiological and pathological processes. The main functions include: ① acting as a miRNA sponge, adsorbing and regulating miRNA activity, reducing the binding of miRNAs to other target genes, thereby increasing the expression levels of these target genes; ② binding to RNA-binding proteins to form complexes, regulating the transcription of downstream genes; ③ binding to ribosomes, inducing open-circular expression of circRNAs, which serve as templates for polypeptide translation; and ④ regulating the transcription of parental genes in the cell nucleus. In recent years, an increasing number of RA genetics-related studies (including gene arrays and next-generation sequencing studies) have revealed gene expression characteristics and networks in synovial tissue and purified immune cells related to the pathogenesis of RA. In studies of post-transcriptional regulatory mechanisms, circRNAs associated with disease activity, the production of inflammatory mediators, and osteoblast formation have been discovered. These circRNAs can not only serve as regulatory sites in the pathogenesis of RA but may also become potential biomarkers and therapeutic targets, playing an important role in the diagnosis and treatment of RA. However, in the field of rheumatoid arthritis, there are currently no circRNA biomarkers for early diagnosis.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] To address the above problems, the present invention aims to provide an application of circRNA markers in the preparation of reagents for diagnosing rheumatoid arthritis and a kit thereof.

[0006] This invention is implemented as follows: According to a first aspect of the present invention, there is provided the use of a circRNA marker in the preparation of a reagent for diagnosing rheumatoid arthritis, said circRNA marker being hsa_circRNA_001715, the nucleotide sequence of which is: GAGGAGCTGCAGCATCGACAGGTCTCCGGGCGCTGGCTCACTGGGCTCCCCGGCCTCCCAGCGCAAGGACCTGGGTCGCTCTGAGTCCCTCCGCGTAGTCTGCCGGCCACACCGCATCTTCCGGCCGTCGGACCTCATCCACGGGGAGGTGCTGGGCAAGGGCTGCTTCGGCCAGGCTATCAAGGTGACACACCGTGAGACAG GTGAGGTGATGGTGATGAAGGAGCTGATCCGGTTCGACGAGGAGACCCAGAGGACGTTCCTCAAGGAGGTGAAGGTCATGCGATGCCTGGAACACCCCAACGTGCTCAAGTTCATCGGGGTGCTCTACAAGGACAAGAGGCTCAACTTCATCACTGAGTACATCAAGGGCGGCACGCTCCGGGGCATCATCAAGAGCATG (SEQ ID NO.1).

[0007] In some embodiments, the reagent is used to detect the expression level of hsa_circRNA_001715.

[0008] In some embodiments, the reagent is used to detect the expression level of hsa_circRNA_001715 in peripheral blood mononuclear cells.

[0009] In some embodiments, the reagent is a reagent used in a real-time PCR detection method.

[0010] In some embodiments, the reagent comprises primer pairs with the following nucleotide sequences: The upstream primer for hsa_circRNA_001715 has the sequence: 5'-GGTCATGCGATGCCTGGAAC-3' (SEQ ID NO.2); The downstream primer for hsa_circRNA_001715 has the sequence: 5'-CGATGCTGCAGCTCCTCCAT-3' (SEQ ID NO.3).

[0011] According to a second aspect of the present invention, a diagnostic kit for rheumatoid arthritis is provided, the kit comprising the reagents described above.

[0012] In some embodiments, the reagent is used to detect the expression level of hsa_circRNA_001715 in peripheral blood mononuclear cells.

[0013] In some embodiments, the reagent is a reagent used in a real-time PCR detection method.

[0014] In some embodiments, the reagent comprises primer pairs with the following nucleotide sequences: The upstream primer for hsa_circRNA_001715 has the sequence: 5'-GGTCATGCGATGCCTGGAAC-3' (SEQ ID NO.2); The downstream primer for hsa_circRNA_001715 has the sequence: 5'-CGATGCTGCAGCTCCTCCAT-3' (SEQ ID NO.3).

[0015] This invention utilizes high-throughput sequencing technology and differential analysis to screen for a circRNA, hsa_circRNA_001715, that is significantly highly expressed in peripheral blood mononuclear cells (PBMCs) of patients with early-stage rheumatoid arthritis (RA). Compared with healthy individuals, hsa_circRNA_001715 is significantly highly expressed in PBMCs of RA patients. Quantitative real-time PCR experiments further confirmed that the expression level of hsa_circRNA_001715 in PBMCs of RA patients (both active and inactive phases) was significantly higher than that in healthy controls. Furthermore, hsa_circRNA_001715 upregulates NLRP3 expression in PBMCs of RA patients in the active phase through the hsa_circRNA_001715 / miR-1249-5p axis and promotes acute inflammatory responses, showing a significant positive correlation with inflammatory markers CRP (C-reactive protein) and ESR (erythrocyte sedimentation rate). This invention, by detecting the expression level of hsa_circRNA_001715, can be rapidly used for the early diagnosis of rheumatoid arthritis. It is simple to operate and highly accurate. It not only provides a new strategy for the clinical diagnosis and prognostic monitoring of rheumatoid arthritis, but also provides new targets for potential therapeutic targets of rheumatoid arthritis, which is conducive to the development of new drugs.

[0016] The beneficial effects of this invention are: 1. The use of hsa_circRNA_001715 as a biomarker in the diagnosis of early rheumatoid arthritis was proposed.

[0017] 2. hsa_circRNA_001715 is a novel biomarker. Unlike traditional biomarkers, it is not only stable, minimally invasive, and easy to detect, but also provides precise quantification, which will greatly improve the sensitivity and specificity of disease diagnosis. The expression level of hsa_circRNA_001715 differs between peripheral blood mononuclear cells of rheumatoid arthritis patients and healthy controls; therefore, hsa_circRNA_001715 shows promise as a diagnostic biomarker for rheumatoid arthritis. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a volcano diagram showing the differential expression of circRNA between the rheumatoid arthritis patient group and the healthy control group in Example 1 of the present invention; Figure 2 This is a cluster analysis diagram of differential circRNA expression between the rheumatoid arthritis patient group and the healthy control group in Example 1 of the present invention; Figure 3 This is a graph showing the expression differences of hsa_circRNA_001715 in peripheral blood mononuclear cells (PBMCs) of rheumatoid arthritis active group (T group), rheumatoid arthritis inactive group (I group), and healthy control group (C group) during the clinical validation stage of circRNA sequencing results in Example 2 of this invention. Figure 4 This is the ROC curve of hsa_circRNA_001715 for diagnosing rheumatoid arthritis during the clinical validation stage of circRNA sequencing results in Example 2 of this invention; Figure 5 This is a graph showing the difference in expression of hsa_circRNA_001715 / miR-1249-5p / NLRP3 axis in peripheral blood mononuclear cells (PBMCs) of the rheumatoid arthritis active phase group (T group), rheumatoid arthritis inactive phase group (I group), and healthy control group (C group) in Example 2 of the present invention. Figure 6 This is a graph showing the differences in the expression of circulating inflammatory markers CRP and ESR among the rheumatoid arthritis active phase group (Group T), rheumatoid arthritis inactive phase group (Group I), and healthy control group (Group C) in Example 2 of the present invention. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0021] The present invention will be further described in detail below with reference to the embodiments.

[0022] Example 1: Analysis of circRNA expression in peripheral blood mononuclear cells from patients with early-stage rheumatoid arthritis and healthy controls I. Objects and Methods 1. Object From May to September 2020, four newly diagnosed rheumatoid arthritis (RA) patients (Group T) and four healthy individuals who underwent physical examinations at the same hospital during the same period were included in this study. All RA patients met the revised ACR classification criteria for RA and were excluded from groups with severe infections, pregnancy, malignant tumors, diabetes, and other autoimmune diseases. There were no statistically significant differences between the two groups in terms of gender and age (P>0.05). This study was approved by the Ethics Committee of the Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine (Approval No.: JZFYKYLL2019001).

[0023] 2. Methods (1) Specimen collection, PBMCs isolation and total RNA extraction: Fasting venous blood (2.0–4.0 ml) was collected from subjects in the early morning and placed in blood collection tubes containing EDTA (ethylenediaminetetraacetic acid) anticoagulant, and delivered to the laboratory within 5 hours. Personal lymphocyte separation media (PBMCs) were isolated using human lymphocyte separation medium (Solarbio, Beijing, China). TRIzol® reagent (Invitrogen, Thermo Fisher Scientific, USA) was then added to the PBMCs, and the samples were stored at -80°C. Total RNA extraction was performed according to the kit instructions. RNA quality and integrity were assessed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA) combined with 1% agarose gel electrophoresis.

[0024] (2) circRNA microarray hybridization: RNase R (Epicentre, USA) was added to qualified total RNA to enrich circular RNA. The enriched circRNA was amplified using the Arraystar Super RNA Labeling Kit (Arraystar, USA) and transcribed into fluorescently labeled cRNA (complementary RNA, cRNA). The labeled cRNA was purified using the RNeasy kit (Qiagen, USA), and its concentration and specific activity were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). The labeled cRNA was hybridized to an Arraystar Human circRNA V2 (8K×15K) chip (Arraystar, USA) and incubated at 65°C for 17 h. After hybridization, the chip was washed and the signal was read using a G2505C gene chip scanner (Agilent, USA). The circRNA chip detection procedure was performed according to the standard operating procedures of KangChen Bio-tech (Shanghai, China).

[0025] II. Results A total of 11,088 circRNAs were detected in the circRNA microarray, of which 399 showed significant differential expression (foldchange > 1.5, p < 0.05), including 149 upregulated circRNAs and 250 downregulated circRNAs. Figure 1 ). Figure 2 This is a cluster analysis diagram of differentially expressed circRNAs. In this invention, the top 10 significantly upregulated circRNAs (hsa_circRNA_009012, hsa_circRNA_008267, hsa_circRNA_074595, hsa_circRNA_103516, hsa_circRNA_074598, hsa_circRNA_100912, hsa_circRNA_050898, hsa_circRNA_105041, hsa_circRNA_001715, hsa_circRNA_100969) were selected for validation.

[0026] Example 2: Real-time quantitative PCR detection of circRNA expression in peripheral blood mononuclear cells of patients with early rheumatoid arthritis.

[0027] I. Objects and Methods 1. Object This study included 72 patients from the Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine between January and December 2024 (approved by the Ethics Committee of the Affiliated Hospital of Jiangxi University of Traditional Chinese Medicine, ethics approval number: JZFYLL202402230017). Among them, 46 patients from the inpatient and outpatient departments of the Department of Rheumatology and Immunology were diagnosed with cold-dampness obstruction syndrome according to TCM syndrome differentiation (divided into active phase T group and inactive phase I group) and 26 healthy individuals who underwent physical examination (group C).

[0028] 2. Methods (1) Extraction of peripheral blood mononuclear cells (PBMCs): 1) Sample preparation: Retrieve relevant information from the clinical system and obtain the corresponding specimens. After numbering the specimens, thoroughly invert and shake them to ensure they are mixed evenly; 2) Addition of separation solution: Use a pipette to accurately aspirate 3 ml of human lymphocyte separation solution and slowly inject it into a 15 ml enzyme-free and sterile centrifuge tube; 3) Whole blood dilution: Measure 2 ml of D-hanks buffer and add it to the whole blood sample. Then, gently pipette the mixture repeatedly to ensure thorough mixing. 4) Sample stacking: Carefully add the above mixture to the centrifuge tube containing the lymphocyte separation medium, and let the pipette tip slide down the tube wall slowly and evenly, so that the mixture flows down slowly along the trajectory, ensuring that the blood forms a clear upper layer above the human lymphocyte separation medium. It is strictly forbidden for the two to mix (the volume ratio of whole blood, D-hank buffer, and human lymphocyte separation medium is 1:1:1). 5) First centrifugation: Place the centrifuge tubes symmetrically in the centrifuge to ensure they are balanced and of equal weight. Set the centrifuge parameters to 1000g centrifugal force and centrifugation time to 25 minutes. 6) Collection of white membrane layer: Add 5 ml of D-hanks buffer to a new 15 ml centrifuge tube. Remove the test tube after the first centrifugation, carefully aspirate the white membrane layer (i.e., PBMCs, peripheral blood mononuclear cells) at the interface between plasma and D-hanks buffer, transfer it to the centrifuge tube containing D-hanks buffer, and mix gently. 7) Second centrifugation: Place the centrifuge tube containing the PBMCs mixture into the centrifuge, set the centrifugal force to 600g, and centrifuge for 7 minutes to allow the PBMCs to settle to the bottom of the tube; 8) Red blood cell processing: After centrifugation, remove the supernatant, keeping only the cells at the bottom of the tube. Carefully observe; if red blood cells are found at the bottom of the tube, add an appropriate amount of red blood cell lysis buffer. Gently pipette or use a shaker to thoroughly mix the cells with the lysis buffer. Let stand at room temperature for 6 minutes to promote red blood cell lysis. 9) Debris Removal Centrifugation: After red blood cell lysis, perform centrifugation again. Set the centrifuge parameters to 300g centrifugal force and centrifuge for 5-7 minutes (approximately 1500 rpm) to allow the lysed red blood cell fragments to float in the upper layer of solution; 10) Sample Preservation: After centrifugation, discard the supernatant in the tube, carefully aspirate and remove any remaining liquid using a pipette tip, retaining only the cells at the bottom of the tube. Add 1 mL of TRIzol Reagent to the cells at the bottom of the tube, mix thoroughly by pipetting, and ensure that there are no white clumps of PBMCs visible to the naked eye before transferring the liquid to a 1.5 mL PE tube for preservation.

[0029] (2) Extraction of total RNA: 1) Two-phase separation: The tissue homogenate was equilibrated at room temperature (15-30℃) for 5 minutes to promote the dissociation of nucleoprotein complexes. Organic solvent was added at a volume ratio of lysis buffer to chloroform of 1:0.2. After sealing the centrifuge tube, the mixture was manually shaken for 15 seconds and allowed to stand for 2-3 minutes to form a stable emulsion system. The mixture was centrifuged at 12000g for 15 minutes at 4℃. The solution system differentiated into a three-layer structure: the bottom layer was a red phenol-chloroform phase, the middle layer was a transition layer, and the top layer was a colorless aqueous phase. All RNA remained in the aqueous phase, which had a volume of approximately 60% of the volume of TRIzol Reagent added during homogenization.

[0030] 2) RNA Precipitation: Carefully transfer the separated aqueous phase to a new centrifuge tube. To precipitate the RNA in the aqueous phase, mix it with isopropanol. The amount of isopropanol added follows this rule: for every 1 ml of TRIzol Reagent used during homogenization, add 0.5 ml of isopropanol. After thorough mixing, incubate at 15-30°C for 10 minutes, followed by centrifugation at 4°C and 12000g for 10 minutes. RNA that was invisible to the naked eye before centrifugation will form a gel-like precipitate on the bottom and sides of the tube after centrifugation.

[0031] 3) RNA washing: Carefully remove the supernatant. For every 1 ml of TRIzol Reagent homogenized sample, add at least 1 ml of 75% ethanol to wash away the RNA precipitate. After gentle shaking, centrifuge at 7500 g for 5 minutes at 4°C.

[0032] 4) Redissolve the RNA precipitate; discard the ethanol solution and allow the RNA precipitate to air dry for 5 to 10 minutes. Do not use vacuum centrifugation. The degree of drying must be carefully controlled; the RNA precipitate should not be completely dried, otherwise its solubility will be severely affected. Partially dissolved RNA samples will have an A260 / 280 ratio below 1.6. When dissolving the RNA, first add RNase-free water and repeatedly pipette several times, then incubate at 55°C to 60°C for 10 minutes. The final RNA solution should be stored at -70°C.

[0033] 5) Small-scale RNA extraction: Add 800 µl of TRIzol Reagent to the sample. After sample lysis, perform two-phase separation by adding chloroform as per step 2. Before adding isopropanol to precipitate RNA, add 5-10 µg of RNase-free glycogen as an aqueous phase carrier. To reduce solution viscosity, pass the sample twice through a 26-gauge needle to shear genomic DNA before adding chloroform. After two-phase separation, the glycogen remains in the aqueous phase and co-precipitates with RNA. As long as the glycogen concentration does not exceed 4 mg / ml, it will not affect cDNA synthesis, nor will it affect the PCR process.

[0034] (3) Real-time quantitative PCR (qRT-PCR) detection: 1) cDNA synthesis: Using sample RNA as the starting material to purify genomic DNA contamination, a reaction system was constructed on ice according to the following proportions: Table 1. Remediation of Genomic DNA Contamination reagents Usage template RNA 1 μg All-in-One First-Strand Synthesis MasterMix 4 μl dsDNase 1 μl Nuclease-Free Water To 20 μl Gently pipette to thoroughly mix the solution, then briefly centrifuge. Incubate the sample at 37°C for 2 minutes to remove contamination from genomic DNA. Incubate the sample at 55°C for 15 minutes. Once the reaction is complete, incubate the reaction system at 85°C for 5 minutes to terminate the reaction. Immediately place the obtained cDNA on ice for subsequent experiments, or quickly store it at -20°C. Construct the reaction system on ice according to the following proportions: Table 2 Preparation of first-strand cDNA reagents Usage (Experimental Group) The product of the previous reaction 10 μl All-in-One First-Strand Synthesis MasterMix 4 μl Nuclease-Free Water 6μl Use a pipette to gently pipette and aspirate to ensure the solution is thoroughly mixed, then briefly centrifuge. Place the sample in a 55°C environment and incubate for 15 minutes. Once the reaction is complete, incubate the reaction system in an 85°C environment for 5 minutes to terminate the reaction process. Place the obtained cDNA solution on ice or store it in an ultra-low temperature freezer for later use in experiments.

[0035] 2) RT-qPCR primer design The hsa_circRNA_001715 primers were designed by Gisele Biotech and synthesized by Shanghai Sangon Biotech. The primer sequences are as follows: The upstream primer for hsa_circRNA_001715, as shown in SEQ ID NO.2, is: 5'- GGTCATGCGATGCCTGGAAC -3'; The downstream primer for hsa_circRNA_001715, as shown in SEQ ID NO.3, is: 5'- CGATGCTGCAGCTCCTCCAT -3'.

[0036] 3) Pre-experiment preparation: Before the experiment begins, turn on the ultraviolet sterilization function of the laminar flow hood and irradiate for 30 minutes for sterilization. During this time, prepare the ice required for the experiment. Take the real-time quantitative PCR (RT-qPCR) and reagents needed for cDNA synthesis out of the low-temperature storage environment, let them thaw, and place them on ice for operation. 4) Prepare the Realtime PCR reaction system according to the requirements in the table below. After adding all reagents, gently tap the bottom of the reaction tube to ensure even mixing. Then place the reaction tube in a centrifuge, set the speed to 5000 rpm, and centrifuge for 15 seconds. Table 3 Realtime PCR reaction system BioSYBR qPCR Mix 10ul Forward Primer (10 µM) 0.4ul Reverse Primer (10 µM) 0.4ul ROX Dye 0.2ul ddH2O 7ul 5) When adding the samples, pipette 2.0 μL of cDNA and 18 μL of the mixture listed in the table above, and add them to the reaction mixture of the PCR plate. Then, thoroughly mix the reaction mixture using an appropriate method, and finally seal the PCR plate with a Sealing Film membrane. 6) PCR Reaction Stage: Set the Realtime PCR reaction program accordingly, and then perform the amplification operation according to the following procedure: For reaction conditions, first set the temperature to 95℃ and maintain it for 30 seconds to complete the pre-denaturation process; then maintain the temperature at 95℃ for 5 seconds for denaturation; then adjust the temperature to 60℃ and maintain it for 30 seconds for annealing and extension. This process needs to be repeated 41 times. For the melting curve section, first set the temperature to 95℃ for 15 seconds; then adjust it to 60℃ and maintain it for 60 seconds; then set it back to 95℃ and maintain it for 15 seconds; finally, set the temperature to 50℃ and maintain it for 30 seconds.

[0037] II. Results In this study, by integrating fold change and statistical significance (P-value) analysis, hsa_circRNA_001715 was screened as a diagnostic biomarker for early rheumatoid arthritis using PCR and ROC analysis. Compared with the healthy control group (Group C), the expression level of hsa_circRNA_001715 was increased in patients with active RA (Group T) and inactive RA (Group I). Figure 3 This ruled out the possibility of false positives for hsa_circRNA_001715 in circRNA microarray sequencing results. Meanwhile, ROC analysis showed that hsa_circ_001715 has high clinical diagnostic potential. Figure 4 ).

[0038] Furthermore, this study used bioinformatics to predict the hsa_circRNA_001715 / miR-1249-5p / NLRP3 axis and investigated the expression of these three components in peripheral blood mononuclear cells (PBMCs) of patients with active RA (T group) and inactive RA (I group) and healthy controls. The study also combined the inflammatory markers CRP (C-reactive protein) and ESR (erythrocyte sedimentation rate) to clarify the potential regulatory mechanism of the hsa_circRNA_001715 / miR-1249-5p / NLRP3 axis on the inflammatory response of rheumatoid arthritis. The results showed that the expression of hsa_circRNA_001715 in PBMCs of RA patients was significantly upregulated compared to healthy controls, while the expression level of miR-1249-5p was significantly decreased and showed a significant negative correlation with hsa_circRNA_001715. NLRP3 expression was generally increased in RA patients and positively correlated with hsa_circRNA_001715. Figure 5 However, its statistical significance showed a disease stage dependence. In patients with active disease, the expression difference was statistically significant (P < 0.05), while in patients with inactive disease, the expression difference was not statistically significant (P > 0.05). In clinical analysis, the expression level of NLRP3 in patients with active disease was significantly positively correlated with the inflammatory markers CRP and ESR. Figure 6 This suggests that it participates in the regulation of acute inflammatory responses.

[0039] In summary, this study is the first to screen and validate hsa_circRNA_001715 as a potential circRNA molecular biomarker for the early diagnosis of rheumatoid arthritis (RA), demonstrating good sensitivity and specificity. Bioinformatics prediction and experimental validation of the functional axis hsa_circRNA_001715 / miR-1249-5p / NLRP3 revealed its potential mechanism of action in the regulation of the inflammatory response in RA. Particularly during the active phase of the disease, its positive correlation with inflammation-related molecules CRP and ESR further supports its application value in disease monitoring. This circRNA biomarker can not only assist in the early screening and subtyping diagnosis of RA, but also provide a new molecular target for targeted regulation of the inflammatory response in RA. This circRNA biomarker and its related detection methods can be used for the early auxiliary diagnosis of clinical RA, assessment of disease activity status, and guidance for precision medicine, showing broad clinical application prospects and industrialization potential.

[0040] The above descriptions are merely some embodiments of the present invention. For those skilled in the art, various modifications and improvements can be made without departing from the inventive concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. The application of a circRNA biomarker in the preparation of a reagent for diagnosing rheumatoid arthritis, characterized in that, The circRNA marker is hsa_circRNA_001715, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The reagent was used to detect the expression level of hsa_circRNA_001715.

3. The application according to claim 2, characterized in that, The reagent was used to detect the expression level of hsa_circRNA_001715 in peripheral blood mononuclear cells.

4. The application according to claim 3, characterized in that, The reagents mentioned are reagents used in the real-time PCR detection method.

5. The application according to claim 3, characterized in that, The reagents include primer pairs with the following nucleotide sequences: The upstream primer for hsa_circRNA_001715 has the sequence shown in SEQ ID NO.2; The downstream primer for hsa_circRNA_001715 has the sequence shown in SEQ ID NO.

3.

6. A diagnostic kit for rheumatoid arthritis, characterized in that, The kit includes the reagents described in claim 2.

7. The reagent kit according to claim 6, characterized in that, The reagent was used to detect the expression level of hsa_circRNA_001715 in peripheral blood mononuclear cells.

8. The reagent kit according to claim 7, characterized in that, The reagents mentioned are reagents used in the real-time PCR detection method.

9. The reagent kit according to claim 7, characterized in that, The reagents include primer pairs with the following nucleotide sequences: The upstream primer for hsa_circRNA_001715 has the sequence shown in SEQ ID NO.2; The downstream primer for hsa_circRNA_001715 has the sequence shown in SEQ ID NO.3.

Images