Anti-CD16a single-domain antibody, anti-tumor bispecific single-domain antibody constructed by anti-CD16a single-domain antibody and application

Abstract

The invention discloses an anti-CD16a single-domain antibody, an anti-tumor bispecific single-domain antibody constructed by the anti-CD16a single-domain antibody and application of the anti-CD16a single-domain antibody The invention provides an anti-CD16a single-domain antibody which comprises a framework region and three complementarity determining regions, and amino acid sequences of the three complementarity determining regions are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 in sequence; according to the invention, an anti-CD16a single-domain antibody and an anti-CEACAM6 single-domain antibody are further fused to obtain an anti-tumor bispecific single-domain antibody; the anti-CD16a single-domain antibody provided by the invention has good specificity and biological activity with CD16a protein, can be well combined with NK cells and activate the activity of the NK cells, and the anti-tumor bispecific single-domain antibody constructed by fusing the anti-CD16a single-domain antibody with an anti-CEACAM6 single-domain antibody has remarkable pharmacological activity of inhibiting tumor growth. The method has an application prospect in preparation of anti-tumor drugs.

Description

Technical Field

[0001] This invention relates to antitumor single-domain antibodies, and more particularly to anti-CD16a single-domain antibodies, as well as antitumor bispecific single-domain antibodies constructed from anti-CD16a single-domain antibodies and CEACAM6 single-domain antibodies, and their application in the preparation of antitumor drugs, belonging to the field of antitumor single-domain antibodies. Background Technology

[0002] Human IgG Fc receptors are classified into three main classes: FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16). The second class comprises three subclasses: IIA, IIB, and IIC, while the third class comprises two subclasses: IIIA and IIIB. The receptor most relevant to activating innate immune cells with cytotoxic functions (such as NK cells) is IIIA, also known as CD16A. CD16A is expressed on the surface of NK cells, monocytes, and macrophages, and also in small amounts on the surface of dendritic cells (DCs), and is an activating receptor.

[0003] CD16 protein is mainly divided into two isoforms—a and b. CD16b, or FcγRIIIB, is primarily expressed on neutrophils and mediates exocytosis of granules. The b isoform is linked to the outer layer of the plasma membrane via a glycosylphosphatidylinositol anchor and cannot induce cell signaling itself. CD16a, or FcγRIIIA, is mainly found on macrophages, monocytes, and NK cells. The a isoform is a transmembrane molecule with a unique cytoplasmic domain. Functionally, CD16a is a major cytotoxic receptor that recognizes and binds to the Fc fragment of tumor-associated antigens (TAAs) binding IgG, generating cytokines or producing antibody-dependent cytotoxic effects. It also mediates the maturation and activation of CD16a-expressing cells. In addition, it can regulate autocrine and paracrine immunity, affecting antigen presentation and inflammatory processes, including cytokine release and chemotactic cell migration.

[0004] CD16a expression significantly influences NK cell cytotoxicity, which is co-regulated by inhibitory and activating receptors. When NK cells interact with potential target cells, they receive activating and inhibitory signals through these receptors. If the balance favors inhibition, the target cell survives; otherwise, it is killed. Notably, some inhibitory signals are very strong, requiring a large number of activating receptors to overcome, while CD16a may provide the strongest signal and antagonize inhibitory signals, making it one of the main clinical focuses in the development of NK cell therapy. Natural killer cells (NK cells) are a unique group of anti-tumor effector cells with MHC-free cytotoxicity, cytokine production, and immune memory, making them key players in both innate and adaptive immune response systems. ADCC via CD16a is one of the main mechanisms by which NK cells exert effector functions. Therefore, a deeper understanding of the biology of CD16a is helpful in finding strategies to enhance ADCC, thereby improving the anti-tumor activity of NK cells.

[0005] CD16a is an important immune receptor that plays a crucial role in the immune system. It is a receptor on the surface of NK cells and macrophages, capable of recognizing and binding to the Fc fragment of tumor-associated antigen-binding IgG, thereby exerting anti-tumor immune effects.

[0006] The mechanism by which CD16a binds to tumor-associated antigens involves multiple aspects. First, tumor cells express specific antigens on their surface, which can be recognized and bound by IgG antibodies. When IgG antibodies bind to antigens on the surface of tumor cells, a complex is formed. Second, the CD16a receptor can recognize and bind to this complex. The CD16a receptor is a transmembrane protein with two Ig-like domains that can bind to the Fc region of IgG antibodies. After binding, the CD16a receptor can activate immune cells through signal transduction pathways, thereby exerting an anti-tumor effect.

[0007] Furthermore, CD16a can mediate the maturation and activation of CD16a-expressing cells, regulate autocrine and paracrine immunity, and influence antigen presentation and inflammatory processes, including cytokine release and chemotactic cell migration. By regulating the expression level and function of CD16a, the immune system can be modulated, providing new strategies for the treatment of immune-related diseases. These mechanisms work together to make CD16a one of the important molecules in anti-tumor immunity.

[0008] Multiple carcinoembryonic antigen (CEA)-related cell adhesion molecule (CEACAM) proteins belong to the immunoglobulin (Ig) supergene family. Their primary structure consists of an extracellular region, a transmembrane region, and an intracellular region (some members lack an intracellular region). Common family members include CEACAM1, 3, 4, 5, 6, 7, 8, 16, 18, 19, and 21. Among them, CEACAM6 is overexpressed in various tumors, including non-small cell lung cancer, pancreatic cancer, breast cancer, colorectal cancer, liver cancer, gastric cancer, and ovarian cancer. CEACAM6 overexpression can lead to mesenchymal-like morphological changes in epithelial tissues, increased tumor invasiveness and resistance to chemotherapy, tumor metastasis, and reduced apoptosis. Reducing CEACAM6 gene expression with siRNA and inhibiting CEACAM6 protein function with monoclonal antibodies can reverse these effects caused by CEACAM6 overexpression. Therefore, CEACAM6 is a promising potential therapeutic target for cancers such as pancreatic cancer, non-small cell lung cancer, and colorectal cancer (refer to CN115850483A).

[0009] Bispecific T-cell engagers (BiTEs) are molecules composed of single-stranded variable domain fragments (scFvs). They target the CD3ε chain of the T-cell receptor (TCR) on T cells and are linked to an scFv targeting tumor-associated antigens (TAAs), enabling them to induce polyclonal T cells to lyse cancer cells in an MHC-independent manner. The clinical benefits of B-cell maturation antigen × CD3 T-cell engager (TCE) molecules for hematologic malignancies have been demonstrated. Several bispecific antibody-based T-cell engager drugs are already on the market, such as Blinatumomab (BLINCYTO, (CD3 / CD19)), Glofitamab (COLUMVI, (CD3 / CD20)), Epcoritamab (EPKINLY, (CD3 / CD20)), Mosunetuzumab (LUNSUMIO, (CD3 / CD20)), and Teclistamab (TECVAYLI, CD3 / BCMA)); several other similar drugs have entered phase III clinical trials. However, TCE candidate drugs are prone to toxic reactions during the treatment of solid tumors, which limits their widespread clinical application. Therefore, there is an urgent need to develop methods that can safely improve their therapeutic effects. Summary of the Invention

[0010] One objective of this invention is to provide an anti-CD16a single-domain antibody;

[0011] The second objective of this invention is to provide an anti-CEACAM6 single-domain antibody;

[0012] The third objective of this invention is to construct an anti-tumor bispecific single-domain antibody by fusing an anti-CD16a single-domain antibody with an anti-CEACAM6 single-domain antibody.

[0013] The third objective of this invention is to use the anti-tumor bispecific single-domain antibody obtained by fusing the aforementioned anti-CD16a single-domain antibody, anti-CEACAM6 single-domain antibody, or anti-CD16a single-domain antibody with anti-CEACAM6 single-domain antibody to prepare anti-tumor drugs.

[0014] The above-mentioned objective of the present invention is achieved through the following technical solution:

[0015] One aspect of the present invention is to provide an anti-CD16a single-domain antibody, the amino acid sequence of which includes a framework region and three complementarity-determining regions CDR1, CDR2 and CDR3, wherein the amino acid sequences of the three complementarity-determining regions CDR1, CDR2 and CDR3 are as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0016] More preferably, the amino acid sequence of the anti-CD16a single-domain antibody described in this invention is selected from any one of the amino acid sequences in (1)-(3):

[0017] (1) The amino acid sequence shown in SEQ ID NO.4; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.4, the protein mutant having the same function as the original protein; or (3) an amino acid sequence that is at least 75% identical to the amino acid sequence shown in SEQ ID NO.4.

[0018] The present invention further provides the encoding gene of the anti-CD16a single-domain antibody; the nucleotide sequence of the encoding gene is selected from any one of (1)-(3):

[0019] (1) The polynucleotide sequence shown in SEQ ID NO. 5; or (2) A polynucleotide sequence whose complementary sequence to the polynucleotide sequence shown in SEQ ID NO. 5 can hybridize under stringent hybridization conditions; or (3) A polynucleotide sequence that has at least 75% identity with the polynucleotide sequence shown in SEQ ID NO. 5; preferably, a polynucleotide sequence that has at least 80% identity with the polynucleotide sequence shown in SEQ ID NO. 5; more preferably, a polynucleotide sequence that has at least 85% identity with the polynucleotide sequence shown in SEQ ID NO. 5; more preferably, a polynucleotide sequence that has at least 95% identity with the polynucleotide sequence shown in SEQ ID NO. 5; most preferably, a polynucleotide sequence that has at least 99% identity with the polynucleotide sequence shown in SEQ ID NO. 5.

[0020] Another aspect of the present invention provides an anti-CEACAM6 single-domain antibody (NABC-38), the amino acid sequence of which includes a framework region and three complementarity-determining regions CDR1, CDR2 and CDR3, wherein the amino acid sequences of the three complementarity-determining regions CDR1, CDR2 and CDR3 are as shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0021] More preferably, the amino acid sequence of the anti-CEACAM6 single-domain antibody (NABC-38) described in this invention is selected from any one of the amino acid sequences in (1)-(3):

[0022] (1) The amino acid sequence shown in SEQ ID NO.9; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.9, the protein mutant having the same function as the original protein; or (3) an amino acid sequence that is at least 75% identical to the amino acid sequence shown in SEQ ID NO.9.

[0023] The present invention further provides the encoding gene of the anti-CEACAM6 single-domain antibody; the nucleotide sequence of the encoding gene is selected from any one of (1)-(3):

[0024] (1) The polynucleotide sequence shown in SEQ ID NO. 10; or (2) A polynucleotide sequence whose complementary sequence to the polynucleotide sequence shown in SEQ ID NO. 10 can hybridize under stringent hybridization conditions; or (3) A polynucleotide sequence that has at least 75% identity with the polynucleotide sequence shown in SEQ ID NO. 10; preferably, a polynucleotide sequence that has at least 80% identity with the polynucleotide sequence shown in SEQ ID NO. 10; further preferably, a polynucleotide sequence that has at least 85% identity with the polynucleotide sequence shown in SEQ ID NO. 10; more preferably, a polynucleotide sequence that has at least 95% identity with the polynucleotide sequence shown in SEQ ID NO. 10; most preferably, a polynucleotide sequence that has at least 99% identity with the polynucleotide sequence shown in SEQ ID NO. 10.

[0025] Another aspect of the present invention is to construct an anti-tumor bispecific single-domain antibody by fusing an anti-CD16a single-domain antibody with an anti-CEACAM6 single-domain antibody. The anti-tumor bispecific single-domain antibody can be constructed by linking an anti-CD16a single-domain antibody and an anti-CEACAM6 single-domain antibody together via a linker, and furthermore, fusing an IgG-Fc at one end of either the anti-CD16a single-domain antibody or the CEACAM6 single-domain antibody. Preferably, the linker is (GGGGS)n, where n is 3 or 5. The IgG-Fc is selected from any one of human IgG1-Fc, human IgG2-Fc, human IgG3-Fc, or human IgG4-Fc, wherein the amino acid sequence of the human IgG1-Fc is shown in SEQ ID NO. 11; the amino acid sequence of the human IgG2-Fc is shown in SEQ ID NO. 12; the amino acid sequence of the human IgG3-Fc is shown in SEQ ID NO. 13; and the amino acid sequence of the human IgG4-Fc is shown in SEQ ID NO. 14.

[0026] In a preferred embodiment, the amino acid sequence of the anti-tumor bispecific single-domain antibody constructed by fusing the anti-CD16a single-domain antibody with the anti-CEACAM6 single-domain antibody is selected from any one of the amino acid sequences described in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, or SEQ ID NO.18.

[0027] The present invention also provides an expression vector containing a gene encoding a single-domain antibody and an expression vector containing a gene encoding a bispecific single-domain antitumor antibody; the expression vector may be a prokaryotic expression vector, a eukaryotic expression vector or other expression vectors;

[0028] The present invention also discloses recombinant host cells containing the expression vector. The host cells are prokaryotic expression cells, eukaryotic expression cells, fungal cells, or yeast cells, with CHO cells being the preferred eukaryotic expression cells.

[0029] The anti-CD16a single-domain antibody provided by this invention has good specificity and biological activity with CD16a protein, and can bind well to NK cells and activate NK cell activity; the anti-tumor bispecific single-domain antibody constructed by fusing the anti-CD16a single-domain antibody with the anti-CEACAM6 single-domain antibody has significant pharmacological activity in inhibiting tumor growth.

[0030] Therefore, the anti-CD16a single-domain antibody provided by this invention and the anti-tumor bispecific single-domain antibody obtained by fusing it with the anti-CEACAM6 single-domain antibody have promising applications in anti-tumor drugs.

[0031] This invention relates to terms and definitions.

[0032] The term "single-domain antibody (sdAb)" as used in this article refers to a fragment containing a single variable domain of an antibody, also known as a nanobody. Like a complete antibody, it can selectively bind to a specific antigen. Compared to the 150–160 kDa mass of a complete antibody, a single-domain antibody is much smaller, approximately only 12–15 kDa. The first single-domain antibody was engineered from a camel heavy-chain antibody and was called the "VHH segment".

[0033] The term "framework region" refers to the backbone region. In immunoglobulins, approximately 110 amino acid sequences near the N-terminus of the H and L chains exhibit significant variation, while the amino acid sequences of the remaining portions are relatively constant. Based on this, the light and heavy chains can be divided into variable (V) and constant (C) regions. The variable region contains the hypervariable region (HVR), also known as the complementarity-determining region (CDR), and the framework region (FR). In the antibodies described in this invention, the "complementarity-determining region" is primarily responsible for antigen recognition.

[0034] The term "identity" used herein is interchangeable with "similarity" and refers to the degree of similarity between sequences as determined by sequence alignment software such as BLAST. Sequence alignment methods and software are well known to those skilled in the art. Modified nucleotide sequences can be obtained by substituting, deleting, and / or adding one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more) amino acids or bases into known sequences. For example, by conventional means (e.g., conservative substitution), modifying one or more amino acid or nucleotide sequences shown in SEQ ID NO: 1-198 of the present invention can yield sequences with greater than 80%, greater than 85%, greater than 90%, greater than 95%, or greater than 99% identity and substantially the same properties, all within the scope of this invention. Preferably, the present invention obtains sequence identity through conservative substitution, but is not limited to conservative substitution.

[0035] The term "complementary" here refers to two nucleotide sequences comprising antiparallel nucleotide sequences that can pair with each other after forming hydrogen bonds between complementary base residues of the antiparallel nucleotide sequences. It is known in the art that the nucleotide sequences of two complementary strands are anticomplementary when viewed from the 5' to 3' direction. It is also known in the art that two sequences that can hybridize under a given set of conditions need not necessarily be 100% perfectly complementary.

[0036] The term "substitution" as used in this invention can refer to conservative substitution, which involves replacing a specific amino acid residue with a residue having similar physicochemical characteristics. Non-limiting examples of conservative substitution include substitutions between amino acid residues containing aliphatic groups (e.g., substitutions between Ile, Val, Leu, or Ala), substitutions between polar residues (e.g., substitutions between Lys and Arg, Glu and Asp, Gln and Asn), etc. Mutants resulting from the deletion, substitution, insertion, and / or addition of amino acids can be created by performing site-directed mutagenesis on the DNA encoding the wild-type protein, for example, using well-known techniques (see, for example, Nucleic Acid Research, Vol. 10, No. 20, pp. 6487-6500, 1982, incorporated herein by reference in its entirety).

[0037] In this specification, "one or more amino acids" refers to the number of amino acids that can be deleted, substituted, inserted, and / or added by site-directed mutagenesis. It is not limited, but preferably 20 or less, 15 or less, 10 or less, or 7 or less, and more preferably 5 or less. Regarding site-directed mutagenesis methods, for example, in addition to desired mutations, i.e., specific inconsistencies, synthetic oligonucleotide primers complementary to the single-stranded phage DNA to be mutated can be used as follows: A strand complementary to the phage is synthesized using the aforementioned synthetic oligonucleotide primers, and the resulting double-stranded DNA is used to transform host cells. The culture of transformed bacteria is plated on agar, and phage plaques are formed by single cells containing the phage. Then, phage plaques hybridized with the probe are collected, cultured, and the DNA is recovered. Furthermore, methods for applying deletions, substitutions, insertions, and / or additions of one or more amino acids to the amino acid sequence of bioactive peptides such as enzymes while maintaining their activity include, in addition to the site-directed mutagenesis described above, methods of treating genes with a mutagen, and methods of selectively disconnecting genes, then deleting, substituting, inserting, or adding selected nucleotides, and then ligating them.

[0038] The term "rigorous hybridization conditions" refers to conditions of low ionic strength and high temperature known in the field. Typically, under rigorous conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Rigorous hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the rigor of hybridization or washing conditions. For detailed guidance on nucleic acid hybridization, please refer to the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acidassays," 1993). More specifically, the stringent conditions are typically chosen to be approximately 5-10°C below the thermal melting point (Tm) of the specific sequence at a specified ionic strength pH. Tm is the temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence in equilibrium (at a specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is in excess, at Tm, 50% of the probe is occupied in equilibrium). Stringent conditions can be the following: where at pH... The salt concentration should be below approximately 1.0 M sodium ion concentration, typically approximately 0.01 to 1.0 M sodium ion concentration (or other salts), and the temperature should be at least approximately 30 °C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least approximately 60 °C for long probes (including, but not limited to, greater than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal can be at least twice the background hybridization, and, where appropriate, 10 times the background hybridization. Exemplary strict hybridization conditions may be as follows: 50% formamide, 5×SSC and 1% SDS, incubated at 42 °C; or 5×SSC, 1% SDS, incubated at 65 °C, washed in 0.2×SSC and washed in 0.1% SDS at 65 °C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0039] The terms “mutation” and “mutant” have their common meanings here, referring to genetic, naturally occurring or introduced changes in a nucleic acid or polypeptide sequence, and their meanings are the same as those commonly known to those skilled in the art.

[0040] The terms "host cell" or "recombinant host cell" refer to a cell containing the polynucleotides of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotides may remain as, for example, non-integrating vectors of plasmids or may be integrated into the host genome.

[0041] The term "expression vector" refers to a vector that adds expression elements (such as promoters, RBSs, terminators, etc.) to the basic framework of a cloning vector, enabling the expression of a target gene. An expression vector consists of four parts: the target gene, the promoter, the terminator, and the marker gene. This invention includes, but is not limited to, prokaryotic cell expression vectors, eukaryotic cell expression vectors, or other cell expression vectors. Attached Figure Description

[0042] Figure 1 For the first round of PCR, ordinary antibody heavy chain and heavy chain antibody V HH Gene amplification electrophoresis images; markers are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. 1 and 2 are products obtained by PCR using different primer combinations. 1 contains a common antibody heavy chain gene amplification fragment greater than 750bp and a heavy chain antibody gene amplification fragment less than 750bp. 2 contains only a heavy chain antibody V fragment of approximately 500bp. HH Gene amplification fragment.

[0043] Figure 2 Image of CD16a phage PCR amplification products; Markers (2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp and 100bp), PCR amplification product approximately 400bp.

[0044] Figure 3 SDS-PAGE electrophoresis image of the collection solution for extracting protein "SN1".

[0045] Figure 4 The SDS-PAGE identification results of SDS-PAGE flow-through buffer, washing buffer, elution buffer 1, and elution buffer 2 purified by magnetic bead method are shown. Lanes 1-14 represent: NABC-38: 1 is washing buffer, 2 is purified protein; 16-D3: 5 is washing buffer, 7 and 8 are purified protein; 16-C8: 9 is washing buffer, 10 is purified protein; 16-E7: 12 is washing buffer, 13 is purified protein; 4 and 11 are blank; M is protein marker.

[0046] Figure 5 This is a curve showing the binding activity of the anti-CD16a nanobody.

[0047] Figure 6 The results show the effects of CD16 monoclonal positive control antibody and CD16 single-domain antibody on NK growth curves.

[0048] Figure 7 The results show the binding of CD16 monoclonal positive control antibody and CD16 single-domain antibody to NK cells.

[0049] Figure 8 Two modalities for constructing bifunctional specific single-domain antibody IgG-Fc fusion proteins.

[0050] Figure 9 The SDS-PAGE results show the protein denaturation after purification of the bifunctional specific single-domain antibody IgG-Fc fusion protein with two structures transiently expressed in CHO cells.

[0051] Figure 10 The curves show the tumor growth inhibition of two types of bispecific antibodies in mice. Detailed Implementation

[0052] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0053] Example 1: Screening, identification, and fusion of anti-CD16a single-domain antibodies with anti-CEACAM6 single-domain antibodies to construct anti-tumor bispecific single-domain antibodies.

[0054] I. Construction of a single-domain antibody library specific to anti-CD16a antigen

[0055] 1. Immunizing alpacas with CD16a antigen

[0056] Select healthy adult alpacas and inject CD16a antigen (2 mg total) subcutaneously at multiple points on the neck and back. Add an equal volume of Freund's adjuvant to the antigen and immunize 6 times with an interval of 14 days. After the fourth immunization, collect serum and determine the antigen titer using ELISA. When the titer reaches 10,000 times or more, collect 70 ml of whole blood, separate PBMC cells, add Trizol, mix thoroughly, and store at -80°C for later use.

[0057] 2. RNA extraction

[0058] Isolation of peripheral blood lymphocytes and extraction and purification of RNA from alpacas: Whole blood was collected from two alpacas, peripheral blood lymphocytes were isolated, and total RNA was extracted from the obtained lymphocytes using an RNA extraction kit (QIAGEN).

[0059] PCR yielded the variable region-V of the Anti-CD16a heavy chain antibody. HH Gene fragment (single-domain antibody gene)

[0060] According to the cDNA synthesis kit (PrimeScript) TM Following the instructions of the 1st Strand cDNA Synthesis Kit (catalog number 6210A, TAKARA), the extracted RNA was reverse transcribed into cDNA. Prepare the following reaction mixture in a centrifuge tube: 1 μl of Random 6mers (50 μM), 1 μl of dNTP Mixture (10 mM each), template RNA: less than 5 μg, and RNase-free ddH2O up to 10 μl. Incubate the mixture at 65°C for 5 min, then rapidly cool on ice. Prepare the following reverse transcription reaction solution in the same centrifuge tube, with a total volume of 20 μl: 10 μl of the denaturing reaction solution, 4 μl of 5×PrimeScript II Buffer, 0.5 μl of RNase Inhibitor (40 U / μl), 1 μl of PrimeScript II RTase (200 U / μl), and RNase-free dH2O up to 20 μl. The reverse transcription reaction was carried out under the following conditions: 30℃ for 10 min, 42℃ for 30-60 min, 95℃ for 5 min, and then cooled on ice.

[0061] Using cDNA as a template, PCR amplification of the heavy chain V was performed using two sets of primers. HH Gene fragments. In the first PCR amplification, fragments larger than 750 bp are considered normal heavy chain gene fragments, while those between 750 and 500 bp are considered single-domain antibody gene fragments. Heavy chain antibody V is recovered from the gel. HH Gene fragment (single-domain antibody gene), using this as a template, V HH V was obtained by PCR amplification using specific primers. HH Target gene (~500bp).

[0062] Table 1 PCR primer sequences

[0063]

[0064] First round of PCR (1): 10 pmol YT1, 10 pmol YT1BN and 10 pmol YT2, 10 pmol YT1BN

[0065] The second round of PCR primers were YTV8 and YTV9, 10 pmol each.

[0066] First round of PCR amplification:

[0067] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of upstream primer, 1.5 μl of downstream primer, 3.5 μl of template, 0.5 μl of blended Taq enzyme, and 33 μl of ddH2O. PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min; 25 cycles, 4℃ for 10 min.

[0068] Second round of PCR amplification:

[0069] 5 μl of 10×PCR buffer, 5 μl of dNTPs, 1.5 μl of upstream primer, 1.5 μl of downstream primer, 3.5 μl of template (first-round recovered product), 0.5 μl of blended Taq enzyme, and 33 μl of ddH2O. PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min; 15 cycles, 4℃ for 10 min.

[0070] 3. Connection Conversion

[0071] The VHH fragment and phage display vector were digested with sfiI (NEB) and ligated with T4 ligase (NEB) at an appropriate ratio, followed by electroporation of TG1 competent cells.

[0072] The VHH antibody gene library was characterized for its size, diversity, and preservation: The library size was calculated by multiplying the titer determined after transformation by the total amount of transformations. Multiple electrotransformations were performed, and the library size was 3.94 × 10⁻⁶. 9 Fifty clones grown on plates after electroporation and titer determination were randomly selected and identified by PCR and sequencing. All 50 colonies were positive by PCR, and the size of the amplified fragment was the same as the size of the inserted VHH. Sequencing results of the 50 clones showed that there were no duplicate VHH sequences. The library capacity and diversity of the antibody gene library met the design requirements.

[0073] Anti-CD16aV HH Preparation of phage libraries (single-domain antibody libraries):

[0074] Add 1 ml of seed bacterial bank to 200 ml of 2YT medium (containing a final concentration of 50 μg / ml Amp + 1% glucose), and incubate at 37°C until OD500. 600After adjusting the culture medium to 0.8-1, add M13KO7 helper phage at a ratio of 1:20 for infection. After culturing for 1 hour, replace with fresh 2YT medium (containing a final concentration of 100 μg / ml Amp + 50 μg / ml Kana) and incubate overnight at 37°C with shaking. Collect the bacterial culture into sterile centrifuge tubes, centrifuge to collect the supernatant, add 1 / 5 volume of 20% PEG-2.5M NaCl, mix well, incubate on ice for 1 hour, centrifuge at 12000 rpm for 30 min, discard the supernatant, dissolve the precipitate in 3 ml of sterile 15% glycerol-PBS solution, and store the phage library at -80°C.

[0075] II. Obtaining Anti-CD16a Single-Domain Antibodies

[0076] 1. Screening for CD16a-specific single-domain antibodies

[0077] Immunotubes were coated with recombinant human CD16a protein, blocked with 4% skim milk PBST, and then the phage library was added for a certain period of time. After washing, non-specifically bound phages were removed, and specifically bound phages were eluted with TEA. Amplification was then performed, followed by 2-3 rounds of screening. Using the coated CD16a protein as the target, a solid-phase screening method was used to screen from the total phage antibody library for 3 rounds. The titer of the phages eluted in each round was detected. As the number of screening rounds increased, the coating concentration decreased progressively, but the titer of the eluted phages increased, indicating that anti-CD16a specific phages were enriched. The screening results are detailed in Table 2.

[0078] Table 2 Screening of Anti-CD16a Specific Single-Domain Antibodies

[0079]

[0080] 2. Construction of Anti-CD16a single-domain antibody expression plasmid

[0081] Using the following sequence as primers and phage screening elution products as templates, the specific Anti-CD16a single-domain antibody gene was amplified by PCR:

[0082] 5-nano-BbsI—GAAGAAGAAGACAACAGGCCSVKGTGMAGCTGGGGAKTCT; 3-nano-BamHI—GAAGATCTCCGGATCCTGAGGAGACGGTGACCTGGGT;

[0083] The PCR product and pSJF2 vector were treated with restriction endonucleases BbsI and BamHI, respectively. The fragments were then ligated with T4 DNA ligase and electroporated into TG1 competent cells to obtain plasmids that can efficiently express single-domain antibodies in E. coli.

[0084] Figure 2 The amplification results are for CD16a phage PCR products.

[0085] 3. Screening of Anti-CD16a single-domain antibody-positive clones

[0086] Ninety-four single colonies were randomly selected from recombinant monoclonal colony agar plates and inoculated into 96-well deep-well plates containing 2YT liquid medium with Amp. After 4 hours of incubation, IPTG was added to the deep-well plates to a final concentration of 1 mM for induction. After overnight incubation, the supernatant expressing the protein was harvested, coated with CD16a antigen, and subjected to ELISA. The CD16a antigen protein concentration was 1 μg / ml, 100 μl / well, and incubated overnight at 4°C. The supernatant after overnight induction was added, and Anti-myc (HRP) was used as the secondary antibody, and incubated at 37°C for 1 h. After washing, TMB was added for color development, and the reaction was terminated by adding 2M H2SO4. The OD value of the sample at 450 nm was measured using a microplate reader. Anti-CD16a positive wells were selected, and DNA sequencing was performed to identify the gene sequences of anti-CD16a single-domain antibody clones, obtaining a series of single-domain antibody gene sequences. By analyzing and typing the sequence-encoded amino acids, CD16a single-domain antibodies of various genotypes (including 16-C3, 16-C8, 16-D3, and 16-E7) were obtained for further expression and screening of single-domain antibodies with high specificity and high activity.

[0087] 4. Expression and purification of Anti-CD16a and CEACAM6 (NABC38) single-domain antibodies

[0088] The bacterial strain containing the target gene was streaked into a culture plate containing ampicillin and incubated overnight at 32°C. Single clones were selected and inoculated into 4 mL of 2YT medium containing ampicillin and incubated overnight. The clones were then transferred to 100 mL of 2YT medium containing ampicillin and cultured on a shaker at 37°C and 220 rpm. When the OD value reached 0.6–1.0, 0.1–0.5 MIPTG was added, and the culture was continued overnight. The cells were centrifuged at 5000 rpm for 20 minutes and harvested. The cells were washed twice with 0.05 M Tris buffer, and soluble nanobodies expressed in the bacterial pericyte were extracted with hypertonic sucrose. The soluble nanobodies were collected from the supernatant by centrifugation. Single-domain antibody proteins with a purity of over 90% were obtained by Ni+ ion affinity chromatography using BeaverBeads™ His-tag Protein Purification (Suzhou Beaver Biomedical Engineering Co., Ltd.). SDS-PAGE electrophoresis results are shown below. Figure 3 and Figure 4 .

[0089] The amino acid sequences of CDR1, CDR2 and CDR3 of the anti-CD16-D3 (16-D3) single-domain antibody are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively. The amino acid sequence of the anti-CD16-D3 single-domain antibody is shown in SEQ ID No.4, and the nucleotide sequence of its encoding gene is shown in SEQ ID No.5.

[0090] The amino acid sequences of CDR1, CDR2 and CDR3 of the anti-CEACAM6(NABC38) single-domain antibody are shown in SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8, respectively. The amino acid sequence of the anti-CEACAM6(NABC38) single-domain antibody is shown in SEQ ID No. 9, and the nucleotide sequence of its encoding gene is shown in SEQ ID No. 10.

[0091] 5. Confirmation of the binding ability of purified anti-CD16a single-domain antibody to CD16a antigen.

[0092] Dilute CD16a-his antigen and CEACAM6 antigen to 1 μg / ml with 0.05M NaHCO3 (pH 9.6) coating buffer, 100 μl / well, and coat overnight at 4℃. Block 96-well plates with 4% PBSM at 37℃ for 1 hour. Add purified Anti-CD16a single-domain antibody at different dilutions and incubate at 37℃ for 1 hour. Wash the plate three times with 0.05% PBST. Add Anti-cmyc-antibody-HRP secondary antibody diluted 1:3000 at 100 μl / well and incubate at 37℃ for 1 hour. Wash the plate three times with 0.05% PBST. Add 100 μl of TMB and incubate at room temperature in the dark for 10 minutes for color development. Stop the reaction by adding 50 μl of 2M H2SO4. Measure the OD value of the samples at 450 nm using a microplate reader. The results are shown in Table 3. Figure 5 .

[0093] Table 3. Results of the binding ability of Anti-CD16a single-domain antibody to CD16a antigen.

[0094]

[0095] According to Table 3 and Figure 5 The test results show that the anti-CD16a nanobody obtained in this invention has good specificity and biological activity with CD16a protein.

[0096] 6. Assay to determine the NK cell activation effect of anti-CD16 single-domain antibody

[0097] PBMCs from umbilical cord blood were aseptically isolated, and 6e7 cells were collected and divided into three groups of 2e7 cells each. These groups were activated with CD16 (T&L Tongli Haiyuan, catalog number: GMP-TL201), 16-D3, and 16-C8, respectively. The cells were then cultured in NK cell culture medium, and flow cytometry analysis was performed at D7 (CD3, CD56+16, HIS) and D13 (CD3, CD56+16) to compare the activation effects of the three antibodies on NK cells.

[0098] Figure 6 The effect of CD16 monoclonal positive control antibody and anti-CD16 single-domain antibody on NK growth curves; Figure 7 The results are from the binding assays of CD16 monoclonal positive control antibody and anti-CD16 single-domain antibody against NK cells.

[0099] III. Construction, Expression, and Purification of Bispecific Antibodies

[0100] Bifunctional specific antibody expression and purification of IgG-Fc fusion protein constructed using CD16-D3 and NABC-38 single-domain antibody.

[0101] First structure: sdAb1or2-linker-sdAb2or1-IgG-Fc

[0102] sdAb1: CD16-D3; sdAb2: NABC-38;

[0103] Linker: (G4S1)3 or 5

[0104] IgG-Fc: IgG1,2,3,4-Fc

[0105] Second structure: sdAb1 or 2-IgG-Fc-linker-sdAb2 or 1

[0106] sdAb1: CD16-D3; sdAb2: NABC-38;

[0107] Linker: (G4S1)3 or 5

[0108] IgG-Fc: IgG1,2,3,4-Fc

[0109] Figure 8 Two modalities for constructing bifunctional specific single-domain antibody IgG-Fc fusion proteins.

[0110] Construction steps: The sdAb1 or 2+(GGGGS)n+sdAb2 or 1+human IgG1 or 4-Fc gene is fully synthesized and double-digested with XhoI-EcoRI; or the sdAb1 or 2+human IgG1 or 4-Fc+(GGGGS)n+sdAb2 or 1 gene is fully synthesized and double-digested with XhoI-EcoRI. The synthesized gene with the restriction sites is then ligated into the p327.7 expression vector (refer to CN110964110A).

[0111] The expression vector constructed above was transfected into CHO / K1 cells for transient expression. Cell preparation is shown in Table 4 below.

[0112] Table 4 Cell Preparation

[0113] step date parameter Density before passage Density and volume after subculturing Cell resuscitation Day 0 <![CDATA[Cultured at 120 rpm, 8% CO2, 37 °C]]> 0 <![CDATA[0.3×10 6 [pcs / ml]]> First passage of cells Day 4 <![CDATA[Cultured at 120 rpm, 8% CO2, 37°C]]> <![CDATA[4.69×10 6 [pcs / ml]]> <![CDATA[0.3×10 6 [pcs / ml]]> Second passage of cells Day 7 <![CDATA[Cultured at 120 rpm, 8% CO2, 37°C]]> <![CDATA[6.68×10 6 [pcs / ml]]> <![CDATA[0.3×10 6 [pcs / ml]]> Cells passaged three times Day 10 <![CDATA[Cultured at 120 rpm, 8% CO2, 37 °C]]> <![CDATA[6.90×10 6 [pcs / ml]]> <![CDATA[0.3×10 6 [pcs / ml]]> Instantaneous Day 13 <![CDATA[Cultured at 270 / 120 rpm, 8% CO2, 37°C]]> <![CDATA[7.49×10 6 [pcs / ml]]> <![CDATA[6.0×10 6 [pcs / ml]]>

[0114] Protein expression was performed by culturing in 500ml shake flasks.

[0115] Protein purification: The cell expression supernatant was purified by affinity chromatography using protein A. The purified protein was then replaced with citrate (0.05% Tween 80, pH 6.2) buffer. The proteins transiently expressed by the first structural expression vector of this bifunctional specific single-domain antibody Fc fusion protein were ①sdAb1-linker-sdAb2-IgG1-Fc, ②sdAb2-linker-sdAb1-IgG1-Fc, and the proteins transiently expressed by the second structural expression vector were ③sdAb1-IgG1-Fc-linker-sdAb1, ④sdAb2-IgG1-Fc-linker-sdAb1.

[0116] Four types of bifunctional specific single-domain antibodies ①, ②, ③ and ④ were constructed according to the construction methods of bifunctional specific single-domain antibodies described in ①, ②, ③ and ④ above, respectively, and their amino acid sequences are shown in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0117] The expressed and purified protein is shown in [link to image]. Figure 9 .according to Figure 9 As can be seen, the SDS-PAGE results of the protein denaturation of the bifunctional specific single-domain antibody IgG-Fc fusion protein transiently expressed in CHO cells showed that its purity was above 95%.

[0118] Experimental Example 1: Assay for the antigen-binding activity of a bifunctional specific single-domain antibody IgG-Fc fusion protein

[0119] The ELISA plate was coated with 1 μg / ml of recombinant human CD16a protein and human CEACAM6 protein antigen. The above-expressed and purified bifunctional specific single-domain antibodies ①②③④ were added, along with goat anti-human IgG-HRP secondary antibody and substrate. The antigen-binding activity was measured and the results are shown in Table 5.

[0120] Table 5. Antigen-binding activity (ELISA) of bispecific nanobodies expressed and purified in eukaryotic cells.

[0121]

[0122] Experiment Example 2: Pharmacodynamic Evaluation of Bifunctional Specific Single-Domain Antibody IgG-Fc Fusion Protein

[0123] The bifunctional specific single-domain antibodies ① and ③ constructed in Example 1 were selected for in vivo pharmacodynamic evaluation in mice:

[0124] Experimental methods: (1) Experimental animals: 50 female Balb / c-nu nude mice were provided by the China National Institutes for Food and Drug Control, with experimental animal qualification certificate number No. 1103171800002775; (2) Establishment of nude mouse human cancer cell xenograft model: After digestion and collection, BXPC3 cells were pipetted into a single-cell suspension and centrifuged at 800 rpm for 5 minutes. The supernatant was discarded, and the cells were resuspended in PBS. The cell concentration was adjusted to 2*10^7 cells / mL for later use. Before inoculation, the skin of the neck and back of Balb / c-nu nude mice was disinfected with 75% alcohol swabs. The cell suspension was drawn with a 1mL syringe and inserted at a location far from the expected tumor growth site. After reaching the expected growth site, the blood was aspirated and 100μL of cells were injected per mouse. (3) Grouping and administration: After inoculation, starting from day 6, the longest diameter (a) and shortest diameter (b) of the tumor were measured with calipers every 2 days. The tumor volume was calculated using the formula V=1 / 2×a×b2. When 40% of the mice had tumors in the 100-200 mm³ range, the RAND function in Excel was used to randomly group mice with tumors in this range into three groups of 10 mice each: Group 1 (bifunctional specific single-domain antibody group ①), Group 2 (bifunctional specific single-domain antibody group ③), and Group 3 (PBS control group). Grouping was designated Day 0, and drug administration began on that day via intraperitoneal injection (IP). Mice were administered twice weekly for six consecutive weeks. Three days after the last administration, the mice were sacrificed, and tumor tissue was collected and weighed. The administration regimen is shown in Table 6.

[0125] Table 6. Trial Groups and Drug Administration

[0126] Group Number of animals (individuals) Injection Sample route of administration Dosage (mg / Kg) Dosage frequency / cycle Group 1 (Antibody ①) 10 ① IP 5 2 times / week x 3 weeks Group 2 (Antibody ③) 10 ③ IP 5 2 times / week x 3 weeks Group 3 (PBS) 10 PBS IP 5 2 times / week x 3 weeks

[0127] The results of the study on the antitumor effect of BXPC3 cells transplanted into Balb / c-nu nude mice are shown in Table 7 and Figure 10 .

[0128] Table 7. Statistical results of mean tumor volume (x±SD)

[0129]

[0130] Note 1. When comparing with group 3 (PBS control group), a represents p < 0.05, b represents p ≥ 0.05; days: number of days of administration; T / C (%): relative tumor proliferation rate; NO: number of animals in the group included in the statistics.

[0131] From Table 7 and Figure 10 The results show that the two bifunctional specific single-domain antibody administration groups provided by this invention significantly inhibited tumor growth compared with the negative PBS control group.

Claims

1. An anti-CD16a single-domain antibody, characterized in that, The amino acid sequence of the anti-CD16a single-domain antibody includes a framework region and three complementarity-determining regions CDR1, CDR2 and CDR3, wherein the amino acid sequences of the three complementarity-determining regions CDR1, CDR2 and CDR3 are as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

2. The anti-CD16a single-domain antibody according to claim 1, characterized in that, The amino acid sequence of the anti-CD16a single-domain antibody is selected from any one of the amino acid sequences in (1)-(3): (1) The amino acid sequence shown in SEQ ID NO.4; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.4, the protein mutant having the same function as the original protein; or (3) an amino acid sequence that is at least 75% identical to the amino acid sequence shown in SEQ ID NO.

4.

3. The encoding gene of the anti-CD16a single-domain antibody according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is selected from any one of (1)-(3): (1) The polynucleotide sequence shown in SEQ ID NO. 5; or (2) A polynucleotide sequence whose complementary sequence to the polynucleotide sequence shown in SEQ ID NO. 5 can hybridize under stringent hybridization conditions; or (3) A polynucleotide sequence that has at least 75% identity with the polynucleotide sequence shown in SEQ ID NO. 5; preferably, a polynucleotide sequence that has at least 80% identity with the polynucleotide sequence shown in SEQ ID NO. 5; more preferably, a polynucleotide sequence that has at least 85% identity with the polynucleotide sequence shown in SEQ ID NO. 5; more preferably, a polynucleotide sequence that has at least 95% identity with the polynucleotide sequence shown in SEQ ID NO. 5; most preferably, a polynucleotide sequence that has at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.

5.

4. An anti-CEACAM6 single-domain antibody, characterized in that, The amino acid sequence of the anti-CEACAM6 single-domain antibody includes a framework region and three complementarity-determining regions CDR1, CDR2 and CDR3, wherein the amino acid sequences of the three complementarity-determining regions CDR1, CDR2 and CDR3 are shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

5. The anti-CEACAM6 single-domain antibody according to claim 4, characterized in that, The amino acid sequence of the anti-CEACAM6 single-domain antibody is selected from any one of the amino acid sequences in (1)-(3): (1) The amino acid sequence shown in SEQ ID NO.9; or (2) a protein mutant obtained by deleting, substituting, inserting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.9, the protein mutant having the same function as the original protein; or (3) an amino acid sequence that is at least 75% identical to the amino acid sequence shown in SEQ ID NO.

9.

6. The encoding gene of the anti-CEACAM6 single-domain antibody according to claim 4, characterized in that, The nucleotide sequence of the encoding gene is selected from any one of (1)-(3): (1) The polynucleotide sequence shown in SEQ ID NO. 10; or (2) A polynucleotide sequence whose complementary sequence to the polynucleotide sequence shown in SEQ ID NO. 10 can hybridize under stringent hybridization conditions; or (3) A polynucleotide sequence that has at least 75% identity with the polynucleotide sequence shown in SEQ ID NO. 10; preferably, a polynucleotide sequence that has at least 80% identity with the polynucleotide sequence shown in SEQ ID NO. 10; further preferably, a polynucleotide sequence that has at least 85% identity with the polynucleotide sequence shown in SEQ ID NO. 10; more preferably, a polynucleotide sequence that has at least 95% identity with the polynucleotide sequence shown in SEQ ID NO. 10; most preferably, a polynucleotide sequence that has at least 99% identity with the polynucleotide sequence shown in SEQ ID NO.

10.

7. The anti-tumor bispecific single-domain antibody obtained by fusing the anti-CD16a single-domain antibody of claim 1 with the anti-CEACAM6 single-domain antibody of claim 4, characterized in that, The aforementioned anti-tumor bispecific single-domain antibody is obtained by fusing an anti-CD16a single-domain antibody and an anti-CEACAM6 single-domain antibody together via a linker. Additionally, an IgG-Fc is fused to one end of either the anti-CD16a single-domain antibody or the CEACAM6 single-domain antibody. Preferably, the linker is (GGGGS)n, where n is 3 or 5. The IgG-Fc is selected from any one of human IgG1-Fc, human IgG2-Fc, human IgG3-Fc, or human IgG4-Fc. The amino acid sequence of the human IgG1-Fc is shown in SEQ ID NO. 11, the amino acid sequence of the human IgG2-Fc is shown in SEQ ID NO. 12, the amino acid sequence of the human IgG3-Fc is shown in SEQ ID NO. 13, and the amino acid sequence of the human IgG4-Fc is shown in SEQ ID NO.

14.

8. The antitumor bispecific single-domain antibody according to claim 7, characterized in that, The amino acid sequence of the antitumor bispecific single-domain antibody is selected from any one of the amino acid sequences described in SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17 or SEQ ID NO.

18.

9. An expression vector or recombinant host cell containing the coding gene of claim 3 or the coding gene of claim 6.

10. Use of the anti-CD16a single-domain antibody of claim 1, the anti-CEACAM6 single-domain antibody of claim 4, and the anti-tumor bispecific single-domain antibody of claim 7 in the preparation of anti-tumor drugs.

Images