Recombinant strain with high yield of sclareol as well as construction method and application of recombinant strain

By introducing specific enzyme genes into the genome of lipophilic yeast, a recombinant strain with high perillol production was constructed, solving the problem of low yield of perillol produced by fermentation and realizing efficient and stable industrial production.

CN120944862AActive Publication Date: 2025-11-14KIINDA BIOTECHNOLOGY (BEIJING) CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511178489.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-21
Publication Date
2025-11-14
Estimated Expiration
2045-08-21

AI Technical Summary

Technical Problem

In existing technologies, the yield of perillaldehyde prepared by fermentation of Yeast lipolytica is low and cannot meet the needs of industrial production. Furthermore, the plant extraction method suffers from high cost, low yield, and insufficient purity.

Method used

A recombinant lipolytic yeast strain producing high levels of perillyl alcohol was constructed. Stable expression was achieved by introducing specific lysine pyrophosphate diol ester synthase (tCcLPPS) and perillyl alcohol synthase (tCcSCS) genes, as well as other related exogenous genes, into the lipolytic yeast genome. Gene integration was performed using CRISPR technology.

Benefits of technology

This technology enables high-yield and high-efficiency production of perillaldehyde, solving the problem of low yield in existing technologies, meeting the stability requirements of industrial production, and reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005561352010000121
    Figure BDA0005561352010000121
  • Figure BDA0005561352010000131
    Figure BDA0005561352010000131
Patent Text Reader

Abstract

The invention provides a recombinant lipolytic yeast strain with high yield of sclareol as well as a preparation method and application of the recombinant lipolytic yeast strain. The recombinant yarrowia lipolytica strain can produce sclareol with high yield and efficiency, and effectively solves the problem of low yield of sclareol prepared by fermentation of existing recombinant yarrowia lipolytica. Meanwhile, when the recombinant lipolytic yeast strain is used for producing sclareol, the stability among batches is relatively good, and the requirements of large-scale industrial production on product stability can be met. Therefore, the recombinant lipolytic yeast strain disclosed by the invention has relatively high production benefits in the production of sclareol, so that the recombinant lipolytic yeast strain has a relatively good industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant strain that produces high levels of perillaldehyde, its construction method, and its application. Background Technology

[0002] Sclareol (English name: Sclareol, molecular formula: C) 20 H 36 O2, chemically named (1R,2R,8aS)-decahydro-1-(3-hydroxy-3-methyl-4-pentenyl)-2,5,5,8a-tetramethyl-2-naphthol, is a hemispherane-type diterpenol compound. It is a white crystalline powder at room temperature with a faint ambergris odor and exhibits good stability in alkaline environments. In nature, sagerol is mainly found in Salvia sclarea (Southern European ginseng).

[0003] As an important plant-derived fragrance and flavoring agent, perillyl alcohol is a key raw material for the synthesis of ambergris substitute, ambroxol. Furthermore, it possesses various biological activities such as anti-inflammatory, antibacterial, anticancer, and choleretic properties, thus finding wide application in the food, cosmetics, and pharmaceutical industries, demonstrating high industrial value and application potential.

[0004] Currently, the industrial extraction of perillaldehyde mainly employs steam distillation and extraction methods from the flowers and leaves of *Salvia miltiorrhiza*, a Lamiaceae herb native to Southern Europe. However, *Salvia miltiorrhiza*, the main plant source of perillaldehyde, contains relatively low levels of the plant itself. This results in a large demand for raw materials when using plant extraction methods, easily leading to a waste of plant resources. Furthermore, *Salvia miltiorrhiza* has a long growth cycle, and its growth is easily affected by external factors such as geographical environment and climate change, resulting in poor stability. Moreover, the complex chemical composition within the plant makes it difficult to obtain pure perillaldehyde products using existing extraction and separation methods, leading to problems such as high cost, low yield, and insufficient purity.

[0005] In contrast, microbial fermentation technology offers advantages such as a short growth cycle, the ability to operate around the clock, and stable yields, better meeting the growing market demand. Yarrowia lipolytica, an oil-producing yeast, is a highly promising production host due to its ability to utilize various inexpensive carbon sources such as glucose, fructose, and glycerol, its ample acetyl-CoA library, and its capacity to secrete exogenous proteins. Furthermore, it is generally regarded as a safe (GRAS) microorganism. However, the current yield of perillaldehyde produced by fermentation using recombinant Yarrowia lipolytica remains low and cannot meet the needs of industrial production. Therefore, developing high-yield perillaldehyde-producing genetically engineered Yarrowia lipolytica strains has become an urgent technical challenge. Summary of the Invention

[0006] Purpose of the invention

[0007] In view of the problems and needs existing in the prior art, the purpose of this invention is to provide a recombinant strain capable of stably producing perillaldehyde with high yield and efficiency, its construction method and application.

[0008] Solution

[0009] To achieve the objectives of this invention, the following technical solutions are provided:

[0010] In a first aspect, the present invention provides an isolated polypeptide tCcLPPS, wherein the polypeptide tCcLPPS has lysine pyrophosphate diol ester synthase activity and has a selective amino acid sequence comprising:

[0011] (1) The amino acid sequence shown in SEQ ID NO:1; or,

[0012] (2) An amino acid sequence that has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:1 and has substantially the same lysine pyrophosphate diol ester synthase activity.

[0013] Secondly, the present invention provides another isolated polypeptide tCcSCS, which has perillaldehyde synthase activity and has a selective amino acid sequence of the following:

[0014] (1) The amino acid sequence shown in SEQ ID NO:2; or,

[0015] (2) An amino acid sequence that has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:2 and has substantially the same sage alcohol synthase activity as it.

[0016] Thirdly, the present invention provides a polynucleotide encoding either the polypeptide tCcLPPS as described in the first aspect above, or the polypeptide tCcSCS as described in the second aspect above.

[0017] The polynucleotide can be DNA or mRNA.

[0018] In a preferred embodiment, the polynucleotide is DNA, which comprises the DNA sequence shown in SEQ ID NO:3; the DNA sequence shown in SEQ ID NO:3 may encode the amino acid sequence shown in SEQ ID NO:1.

[0019] In a preferred embodiment, the polynucleotide is DNA, which comprises the DNA sequence shown in SEQ ID NO:4; the DNA sequence shown in SEQ ID NO:4 may encode the amino acid sequence shown in SEQ ID NO:2.

[0020] In a preferred embodiment, the polynucleotide is mRNA, which comprises the mRNA sequence shown in SEQ ID NO:5; the mRNA sequence shown in SEQ ID NO:5 may encode the amino acid sequence shown in SEQ ID NO:1.

[0021] In a preferred embodiment, the polynucleotide is mRNA, which comprises the mRNA sequence shown in SEQ ID NO:6; the mRNA sequence shown in SEQ ID NO:6 may encode the amino acid sequence shown in SEQ ID NO:2.

[0022] Fourthly, the present invention provides a nucleic acid construct comprising the polynucleotide as described in the third aspect above, and optionally, at least one expression regulatory element operatively linked to the polynucleotide.

[0023] Fifthly, the present invention provides an expression vector comprising the nucleic acid construct as described in the fourth aspect above.

[0024] In a sixth aspect, the present invention provides a transformed host cell, wherein the cell is transformed or transfected with the polynucleotides described in the third aspect above, the nucleic acid constructs described in the fourth aspect above, or the expression vectors described in the fifth aspect above.

[0025] In a seventh aspect, the present invention provides the use of the polypeptide tCcLPPS as described in the first aspect above, the polypeptide tCcSCS as described in the second aspect above, the polynucleotide as described in the third aspect above, the nucleic acid construct as described in the fourth aspect above, the expression vector as described in the fifth aspect above, and / or the transformed host cell as described in the sixth aspect above in preparing recombinant lipolytic yeast strains that produce high levels of perillaldehyde, or in increasing the perillaldehyde production of lipolytic yeast.

[0026] In a feasible implementation, the lipophilic yeast is Yersinia lipophila Po1f, Po1g and / or Po1fΔKu70.

[0027] Eighthly, the present invention provides a recombinant strain that produces high levels of perillaldehyde, wherein the recombinant strain is constructed by introducing multiple exogenous genes into a substrate yeast, wherein the exogenous genes include:

[0028] The gene encoding the polypeptide tCcLPPS as described in the first aspect above, the gene encoding the polypeptide tCcSCS as described in the second aspect above, the gene encoding the mevalonate kinase ERG12, the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13, the gene encoding the mevalonate phosphate kinase ERG8, the gene encoding the mevalonate pyrophosphate decarboxylase ERG19, and the gene encoding the HMG coenzyme A reductase HMG1.

[0029] Preferably, the chassis strain is selected from: Yersinia lipophila Po1f, Po1g and / or Po1fΔKu70;

[0030] Preferably, the gene encoding the polypeptide tCcLPPS described in the first aspect above has a nucleotide sequence as shown in SEQ ID NO:3;

[0031] Preferably, the gene encoding the polypeptide tCcSCS as described in the second aspect above has a nucleotide sequence as shown in SEQ ID NO:4;

[0032] Preferably, the gene encoding the mevalonate kinase ERG12 has the nucleotide sequence shown in SEQ ID NO:7;

[0033] Preferably, the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 has the nucleotide sequence shown in SEQ ID NO:8;

[0034] Preferably, the gene encoding the mevalonate kinase ERG8 has the nucleotide sequence shown in SEQ ID NO:9;

[0035] Preferably, the gene encoding the mevalonate pyrophosphate decarboxylase ERG19 has the nucleotide sequence shown in SEQ ID NO:10;

[0036] Preferably, the gene encoding HMG coenzyme A reductase HMG1 has the nucleotide sequence shown in SEQ ID NO:11;

[0037] Preferably, the coding gene is integrated into the genome via CRISPR technology.

[0038] More preferably, the coding gene for polypeptide tCcLPPS as described in the first aspect above and the coding gene for polypeptide tCcSCS as described in the second aspect above are fused and expressed. Preferably, the fused expression gene is multiple copies. More preferably, the multiple copies of the fused expression gene are expressed under different promoters and integrated into the strain genome at different sites. In a feasible preferred embodiment, the fused expression gene of the coding gene for the isolated polypeptide as described in the first aspect above and the coding gene for the isolated polypeptide as described in the second aspect above is integrated into the strain genome through two sites.

[0039] More preferably, the gene encoding the mevalonate kinase ERG12 is fused to the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13;

[0040] More preferably, the gene encoding the mevalonate phosphate kinase ERG8 is fused with the gene encoding the mevalonate pyrophosphate decarboxylase ERG19.

[0041] In a ninth aspect, the present invention provides a method for preparing the recombinant strain as described in the eighth aspect above, the method comprising the following steps:

[0042] (1) Constructing the fusion expression plasmid pCRISPRyl-XPR2:tCcLS

[0043] Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the XPR2 integration site, the fusion expression cassette of the gene encoding the peptide tCcLPPS as described in the first aspect above and the gene encoding the peptide tCcSCS as described in the second aspect above, the downstream homologous arm of the XPR2 integration site, and the sgRNA sequence targeting the XPR2 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant I; transformant I is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-XPR2:tCcLS is obtained;

[0044] (2) Construction of the fusion expression plasmid pCRISPRyl-SCP2:tCcLS

[0045] Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the SCP2 integration site, the fusion expression cassette of the gene encoding the polypeptide tCcLPPS described in the first aspect above and the gene encoding the polypeptide tCcSCS described in the second aspect above, which has a promoter (preferably different from the promoter in (1) above), the downstream homologous arm of the SCP2 integration site, and the sgRNA sequence targeting the SCP2 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant II; transformant II is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-SCP2:tCcLS is obtained;

[0046] (3) Construct the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13

[0047] Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the GSY integration site, the fusion expression cassette containing the gene encoding the mevalonate kinase ERG12 and the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 with a promoter, the downstream homologous arm of the GSY integration site, and the sgRNA sequence targeting the GSY integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant III; transformant III is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13 is obtained;

[0048] (4) Construct the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19

[0049] Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the D17 integration site, the fusion expression cassette containing the gene encoding the mevalonate kinase ERG8 and the gene encoding the mevalonate pyrophosphate decarboxylase ERG19 with a promoter, the downstream homologous arm of the D17 integration site, and the sgRNA sequence targeting the D17 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant IV; transformant IV is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19 is obtained;

[0050] (5) Construct expression plasmid pCRISPRyl-A08:HMG1

[0051] Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the A08 integration site, the gene expression cassette of the HMG coenzyme A reductase HMG1 with a promoter, the downstream homologous arm of the A08 integration site, and the sgRNA sequence targeting the A08 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant V; transformant V is transformed into competent cells, and after screening and verification, the recombinant expression plasmid pCRISPRyl-A08:HMG1 is obtained;

[0052] (6) Prepare competent cells from the chassis strain; transform the competent cells with the fusion expression plasmid pCRISPRyl-XPR2:tCcLS constructed in step (1), and obtain recombinant strain Y01 after screening and verification, wherein the fusion expression gene of the polypeptide isolated as described in claim 1 and the polypeptide isolated as described in claim 2 is inserted into the designated site XPR2.

[0053] (7) Prepare competent cells from recombinant strain Y01; transform the competent cells of recombinant strain Y01 with the fusion expression plasmid pCRISPRyl-SCP2:tCcLS constructed in step (2), and obtain recombinant strain Y02 after screening and verification, wherein the fusion expression gene of the polypeptide isolated as described in claim 1 and the polypeptide isolated as described in claim 2 is inserted into the designated site SCP2.

[0054] (8) Prepare competent cells from recombinant strain Y02; transform competent cells of recombinant strain Y02 with the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13 constructed in step (3), and obtain recombinant strain Y03 after screening and verification, wherein the fusion expression gene of mevalonate kinase ERG12 and 3-hydroxy-3-methylglutaryl coenzyme A synthase ERG13 is inserted into the designated site GSY;

[0055] (9) Prepare competent cells from recombinant strain Y03; transform competent cells of recombinant strain Y03 with the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19 constructed in step (4), and obtain recombinant strain Y04 after screening and verification, wherein the fusion expression gene of the mevalonate phosphate kinase ERG8 and the mevalonate pyrophosphate decarboxylase ERG19 is inserted at the designated site D17;

[0056] (10) Prepare competent cells from recombinant strain Y04; transform the competent cells of recombinant strain Y04 with the expression plasmid pCRISPRyl-A08:HMG1 constructed in step (5), and obtain recombinant strain Y05 after screening and verification, wherein the expression gene of HMG coenzyme A reductase HMG1 is inserted at the specified site A08; the recombinant strain Y05 is the recombinant strain described in the title.

[0057] In the above preparation method:

[0058] Preferably, in the fusion expression plasmid pCRISPRyl-XPR2:tCcLS, the gene sequence encoding the polypeptide tCcLPPS as described in claim 1 is shown in SEQ ID NO:3, the gene sequence encoding the polypeptide tCcSCS as described in claim 2 is shown in SEQ ID NO:4, and the sgRNA sequence targeting the XPR2 integration site is shown in SEQ ID NO:12.

[0059] Preferably, in the fusion expression plasmid pCRISPRyl-SCP2:tCcLS, the gene sequence encoding the polypeptide tCcLPPS as described in claim 1 is shown in SEQ ID NO:3, the gene sequence encoding the polypeptide tCcSCS as described in claim 2 is shown in SEQ ID NO:4, and the sgRNA sequence targeting the SCP2 integration site is shown in SEQ ID NO:13.

[0060] Preferably, in the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13, the gene sequence encoding the mevalonate kinase ERG12 is shown in SEQ ID NO:7, the gene sequence encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 is shown in SEQ ID NO:8, and the sgRNA sequence targeting the GSY integration site is shown in SEQ ID NO:14.

[0061] Preferably, in the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19, the gene sequence encoding the mevalonate phosphate kinase ERG8 is shown in SEQ ID NO:9, the gene sequence encoding the mevalonate pyrophosphate decarboxylase ERG19 is shown in SEQ ID NO:10, and the sgRNA sequence targeting the D17 integration site is shown in SEQ ID NO:15.

[0062] Preferably, in the expression plasmid pCRISPRyl-A08:HMG1, the gene sequence encoding HMG coenzyme A reductase HMG1 is shown in SEQ ID NO:11, and the sgRNA sequence targeting the A08 integration site is shown in SEQ ID NO:16.

[0063] Preferably, the promoters used in the above-mentioned fusion expression plasmids or expression plasmids are the same or different. Preferably, the promoters used are selected from pU12, pU13 and / or pC48.

[0064] In a tenth aspect, the present invention provides the use of the recombinant strain as described in the eighth aspect above, or the recombinant strain obtained according to the preparation method described in the ninth aspect above, in the production of perillaldehyde.

[0065] Eleventhly, the present invention provides a method for producing perillaldehyde, the method comprising:

[0066] The recombinant strain described in the eighth aspect above or the recombinant strain obtained according to the preparation method described in the ninth aspect above is used as the fermentation strain to prepare seed liquid and fermentation culture, and to obtain the sage-perillyl alcohol from the fermentation culture and / or cell.

[0067] In a feasible implementation, the method for preparing the seed solution includes:

[0068] The recombinant strain according to any one of claims 9-11 or the recombinant strain obtained by the preparation method according to claim 12 or 13 is activated, a single colony is picked and inoculated into a seed culture medium, and cultured at 28-32℃ and 100-250rpm for 6-48 hours.

[0069] In a feasible implementation, the fermentation culture method includes:

[0070] The seed culture is inoculated into a fermentation medium to obtain an initial fermentation culture with an initial OD600 of 0.6-1.2, preferably 1.0. The obtained initial fermentation culture is fermented at 28-32℃ and 100-250rpm for 6-48 hours to obtain the fermentation culture and / or cell.

[0071] In a feasible implementation, a method for obtaining the sagerol from fermentation cultures and / or cell cultures includes:

[0072] It is obtained by extraction from the fermentation culture and / or cells using one of the following extractants: ethyl acetate, methanol, ethanol, n-hexane, dodecane, butyl acetate, vegetable oil, isopropyl myristate, oleic acid, and ethyl oleate.

[0073] Beneficial effects

[0074] This application successfully constructed a recombinant lipolytic yeast strain stably expressing the aforementioned enzymes by designing specific lysine pyrophosphate diol synthase polypeptides tCcLPPS and tCcSCS, and introducing them, along with a series of other exogenous enzyme genes, into the genome of *Yarrowia lipolytica*. This recombinant lipolytic yeast strain can produce tCcLPS with high yield and efficiency, effectively solving the problem of low yield in existing recombinant *Yarrowia lipolytica* fermentation for tCcLPS production. Furthermore, the batch-to-batch stability of tCcLPS production using this recombinant lipolytic yeast strain meets the product stability requirements for large-scale industrial production.

[0075] In view of the above, the recombinant lipophilic yeast strain of this application can reduce industrial production costs and improve production efficiency in the production of perillaldehyde, and has high industrial application value. Detailed Implementation

[0076] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0077] Furthermore, to better illustrate the present invention, numerous specific details are provided in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In some embodiments, materials, elements, methods, and means well known to those skilled in the art are not described in detail in order to highlight the spirit of the invention.

[0078] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0079] The main culture media used in the following examples and their preparation methods are as follows:

[0080] Yeast selection medium YNB-URA: 10 g / L glucose, 6.7 g / L LeastNitrogen Base (YNB), 0.5 g / L uracil (URA), and 20 g / L agar powder.

[0081] YPD liquid medium: 20 g / L glucose, 20 g / L peptone and 10 g / L yeast extract.

[0082] YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 20 g / L agar powder.

[0083] YPD fermentation medium: 60 g / L glucose, 40 g / L peptone and 20 g / L yeast extract.

[0084] Unless otherwise specified, plasmids were constructed using Golden Gate or Gibson assembly methods. Yeast transformation was performed using the Zymo Research Frozen EZ Transformation II kit.

[0085] Example 1: Construction of recombinant expression plasmid

[0086] In this embodiment, recombinant expression plasmids for integration into the yeast genome were constructed as follows: pCRISPRyl-XPR2:tCcLS, pCRISPRyl-SCP2:tCcLS, pCRISPRyl-GSY:ERG12-ERG13, pCRISPRyl-D17:ERG8-ERG19, and pCRISPRyl-A08:HMG1. The specific construction process is as follows:

[0087] (1) The pCRISPRyl backbone (purchased from Addgene, catalog number 70007; containing Cas9 editing protein expression elements, specifically including: pCAS promoter 1-1036 bases, and Cas9 gene 1048-5151 bases from Streptococcus pyogenes), the upstream homologous arm (1500bp) of the XPR2 integration site, the pU12-tCcLPPS-tCcSCS expression cassette (where pU12 is the promoter, the tCcLPPS gene sequence is shown in SEQ ID NO:3, and the tCcSCS gene sequence is shown in SEQ ID NO:4), the downstream homologous arm (1500bp) of the XPR2 integration site, and the sgRNA sequence targeting the XPR2 site (GATGTAGTCGTTGAGAGCCC, as shown in SEQ ID NO:4) were obtained by PCR. NO:12); then, using the C117 one-step cloning enzyme of Novizan, the above sequence fragments were ligated into multiple fragments to obtain transformant I; then, transformant I was transformed into Escherichia coli DH5α competent cells, and the recombinant expression plasmid pCRISPRyl-XPR2:tCcLS was obtained by screening with ampicillin-resistant plates and verifying by colony PCR and sequencing.

[0088] (2) The pCRISPRyl backbone (as described in part (1) above), the upstream homologous arm (1500bp) of the SCP2 integration site, the pU13-tCcLPPS-tCcSCS expression cassette (where pU13 is the promoter, the tCcLPPS gene sequence is shown in SEQ ID NO:3, and the tCcSCS gene sequence is shown in SEQ ID NO:4), the downstream homologous arm (1500bp) of the SCP2 integration site, and the sgRNA sequence targeting the SCP2 site (CCAAGGGTGATGCTGACATC, as shown in SEQ ID NO:13) were obtained by PCR. Then, the above sequence fragments were ligated into multiple fragments using the C117 one-step cloning enzyme of Novizan to obtain transformant II. After that, transformant II was transformed into Escherichia coli DH5α competent cells, and the recombinant expression plasmid pCRISPRyl-SCP2:tCcLS was obtained by screening with ampicillin-resistant plates and verifying by colony PCR and sequencing.

[0089] (3) The pCRISPRyl backbone (as described in part (1) above), the upstream homologous arm (1500bp) of the GSY integration site, the pC48-ERG12-ERG13 expression cassette (where pC48 is the promoter, the ERG12 gene sequence is shown in SEQ ID NO:7, and the ERG13 gene sequence is shown in SEQ ID NO:8), the downstream homologous arm (1500bp) of the GSY integration site, and the sgRNA sequence targeting the GSY site (ATGAGTGATGCAATGCTGCA, as shown in SEQ ID NO:14) were obtained by PCR. Then, the above sequence fragments were ligated into multiple fragments using the C117 one-step cloning enzyme of Novizan to obtain transformant III. After that, transformant III was transformed into Escherichia coli DH5α competent cells, and the recombinant expression plasmid pCRISPRyl-GSY:ERG12-ERG13 was obtained by screening with ampicillin-resistant plates and verifying by colony PCR and sequencing.

[0090] (4) The pCRISPRyl backbone (as described in part (1) above), the upstream homologous arm (1500bp) of the D17 integration site, the pU13-ERG8-ERG19 expression cassette (where pU13 is the promoter, the ERG8 gene sequence is shown in SEQ ID NO:9, and the ERG19 gene sequence is shown in SEQ ID NO:10), the downstream homologous arm (1500bp) of the D17 integration site, and the sgRNA sequence targeting the D17 site (AAGATCGAATATCGTTCGTG, as shown in SEQ ID NO:15) were obtained by PCR. Then, the above sequence fragments were ligated into multiple fragments using the C117 one-step cloning enzyme of Novizan to obtain transformant IV. After that, transformant IV was transformed into Escherichia coli DH5α competent cells, and the recombinant expression plasmid pCRISPRyl-D17:ERG8-ERG19 was obtained by screening with ampicillin-resistant plates and verifying by colony PCR and sequencing.

[0091] (5) The pCRISPRyl backbone (as described in part (1) above), the upstream homologous arm (1500bp) of the A08 integration site, the pC48-HMG1 expression cassette (where pC48 is the promoter and the HMG1 gene sequence is shown in SEQ ID NO:11), the downstream homologous arm (1500bp) of the A08 integration site, and the sgRNA sequence targeting the A08 site (AAGAAGATTAAGATTGCCAC, as shown in SEQ ID NO:16) were obtained by PCR. Then, the above sequence fragments were ligated into multiple fragments using the C117 one-step cloning enzyme of Novizan to obtain transformant V. After that, transformant V was transformed into Escherichia coli DH5α competent cells, and the recombinant expression plasmid pCRISPRyl-A08:HMG1 was obtained by screening with ampicillin-resistant plates and verifying by colony PCR and sequencing.

[0092] Example 2: Construction of recombinant lipophilic yeast strain

[0093] In this embodiment, a series of recombinant lipolytic yeast strains were constructed through the following steps:

[0094] (1) Yeast lipophila Po1f (ATCC number MYA-2613) was cultured in YPD liquid medium for 24 h to prepare competent cells.

[0095] (2) Using the Zymogen Frozen EZ YeastTransformation Kit II from Zymo Research Corporation, the recombinant expression plasmid pCRISPRyl-XPR2:tCcLS prepared in Example 1 was transformed into competent cells of Yersinia lipophila Po1f obtained in step (1), and plated for screening; YNB-URA yeast screening medium was used for screening, and the recombinant strain with the tCcLPPS-tCcSCS gene sequence inserted at the integration site XPR2 was successfully verified by colony PCR and sequencing to obtain the recombinant Yersinia lipophila strain Y01;

[0096] (3) The recombinant Yersinia yeast strain Y01 was prepared into competent cells; using the Zymogen Frozen EZ Yeast Transformation Kit II of Zymo Research Corporation, the recombinant expression plasmid pCRISPRyl-SCP2:tCcLS prepared in Example 1 was transformed into the competent cells of the above-obtained recombinant Yersinia yeast strain Y01, and plated for screening; YNB-URA yeast screening medium was used for screening, and the recombinant strains that successfully inserted the tCcLPPS-tCcSCS gene sequence at the integration site SCP2 were verified by colony PCR and sequencing to obtain the recombinant Yersinia yeast strain Y02.

[0097] (4) The recombinant Yersinia yeast strain Y02 was prepared into competent cells; using the Zymogen Frozen EZ Yeast Transformation Kit II of Zymo Research Corporation, the recombinant expression plasmid pCRISPRyl-GSY:ERG12-ERG13 prepared in Example 1 was transformed into the competent cells of the above-obtained recombinant Yersinia yeast strain Y02, and plated for screening; YNB-URA yeast screening medium was used for screening, and the recombinant strains that successfully inserted the ERG12-ERG13 gene sequence at the integration site GSY were verified by colony PCR and sequencing to obtain the recombinant Yersinia yeast strain Y03;

[0098] (5) The recombinant Yersinia yeast strain Y03 was prepared into competent cells; using the Zymogen Frozen EZ Yeast Transformation Kit II of Zymo Research Corporation, the recombinant expression plasmid pCRISPRyl-D17:ERG8-ERG19 prepared in Example 1 was transformed into the competent cells of the above-obtained recombinant Yersinia yeast strain Y03, and plated for screening; YNB-URA yeast screening medium was used for screening, and the recombinant strain with the ERG8-ERG19 gene sequence inserted at the integration site D17 was successfully verified by colony PCR and sequencing to obtain the recombinant Yersinia yeast strain Y04;

[0099] (6) The recombinant Yersinia yeast strain Y04 was prepared into competent cells; using the Zymogen Frozen EZ Yeast Transformation Kit II of Zymo Research Corporation, the recombinant expression plasmid pCRISPRyl-A08:HMG1 prepared in Example 1 was transformed into the competent cells of the above-obtained recombinant Yersinia yeast strain Y04, and plated for screening; YNB-URA yeast screening medium was used for screening, and the recombinant strains that successfully inserted the HMG1 gene sequence at the integration site A08 were verified by colony PCR and sequencing to obtain the recombinant Yersinia yeast strain Y05.

[0100] Example 3: Experiment on the synthesis of perillol by recombinant lipolytic yeast Y01-05 in shake flasks

[0101] In this embodiment, the ability of each recombinant yeast strain to synthesize perillyl alcohol was evaluated by fermenting the recombinant Yersinia strain Y01-Y05 constructed in Example 2 in shake flasks and detecting the yield and productivity of perillyl alcohol in the fermentation products.

[0102] Specifically, after activating each recombinant yeast strain to be tested, their plates were streaked onto YPD solid medium and then cultured at 30℃ for 36 h to obtain single colonies. Several single colonies were picked and inoculated into 5 mL of YPD fermentation medium and cultured for 30 h to obtain a seed culture (OD600 = 6). The seed culture was then inoculated into 50 mL of YPD fermentation medium at an initial inoculation amount of OD600 = 0.5 and fermented at 30℃ and 220 rpm for 12 h. Then, 10% of the fermentation liquid volume of n-dodecane was added, and the culture was continued with shaking for 3 days to obtain the fermentation product.

[0103] Processing of fermentation products: After fermentation, the fermentation broth was transferred to a 50 mL centrifuge tube, centrifuged at 7500 rpm for 8 min, and the uppermost organic phase was collected for later use.

[0104] The fermentation products of each recombinant yeast strain (i.e., the upper organic phase collected above) were diluted 10 times with n-dodecane (as the extractant) for extraction. The resulting dilution was filtered through an oil-based nylon filter membrane with a pore size of 0.22 μm. The filtrate was analyzed by gas chromatography-mass spectrometry (GC-MS) to determine the content of perillyl alcohol.

[0105] The GC detection conditions were as follows: injection port temperature 250℃, injection volume 1μL, splitless; column: Shimadzu DP-5ms (30m×250μm×0.25μm); chromatographic conditions: initial temperature 60℃, increased to 160℃ at a rate of 10℃ / min, held for 1 min, then increased to 280℃ at a rate of 40℃ / min, held for 4 min. The entire gas chromatographic program lasted 18 min. Qualitative and quantitative analysis was performed using a standard of perillaldehyde.

[0106] The GC test results are shown in Table 1.

[0107] Table 1. Perillyl alcohol yield of various recombinant yeast strains after 48 h of shake-flask fermentation

[0108] strains Perillyl alcohol yield (mg / L) over 48 hours Po1f 0 Y01 16.3 Y02 32.6 Y03 100.3 Y04 392.6 Y05 1057.3

[0109] As can be seen from Table 1:

[0110] Perillyl alcohol was detected in the shake-flask fermentation products of all recombinant yeast strains, indicating that they could all produce perillyl alcohol during shake-flask fermentation; in contrast, the perillyl alcohol production of the chassis strain Po1f, which served as the substrate for all recombinant yeast strains, was 0 after 48 h of shake-flask fermentation (i.e., below the detection limit).

[0111] Furthermore, among the various recombinant yeast strains, recombinant yeast strain Y05 had the highest yield of sclareol, reaching 1057.3 mg / L (i.e., 1057.3 mg of sclareol per liter of fermentation broth); further calculations showed that the yield of sclareol was 22.0 mg / L / h, which is higher than the highest yield reported so far for shake-flask fermentation (see Chen J. et al. Combinatorial metabolic engineering of Yarrowia lipolytica for high-level production of the plant-derived diterpenoid sclareol. Microbial Cell Factories, 2025, 24(1), with a yield of approximately 18.65 mg / L / h).

[0112] The results in Table 1 show that, in shake-flask fermentation, strain Y05 significantly improved the production capacity of perillaldehyde compared to the chassis yeast Polf, with both yield and productivity greatly increased. This indicates that the multiple-copy expression of the tCcLS fusion protein, along with the overexpression of ERG19, ERG13, ERG12, HMG1, and ERG8 genes in the MVA pathway, can significantly enhance the perillaldehyde production capacity of the lipophilic yeast Polf.

[0113] Example 4: Experiment on the synthesis of perillaldehyde from recombinant lipolytic yeast Y01-05 in a small-scale 7L fermenter

[0114] In this embodiment, the ability of each recombinant yeast strain to synthesize sagerol was evaluated by fermenting the recombinant Yersinia strain Y01-Y05 constructed in Example 2 in a small-scale 7L fermenter and detecting the yield and productivity of sagerol in the fermentation product.

[0115] The activation of the strain and product detection were the same as in Example 3. For the fermenter, the initial fermentation OD was between 1 and 2. Glucose concentration was measured in real time during fermentation; when the concentration was below 10 g / L, it was maintained at a level not lower than 10 g / L using a fed-batch method. After continuous culture for 240 h, samples were taken to measure the perillaldehyde yield at 240 h of fermentation. The results are shown in Table 2.

[0116] Table 2. Perillyl alcohol yield of various recombinant yeast strains in a 7L fermenter

[0117]

[0118] As shown in Table 2, perillyl alcohol was detected in the fermentation products of all recombinant yeast strains in the small-scale and 240-h fermentation, indicating that they could all produce perillyl alcohol in the small-scale fermentation. In contrast, the perillyl alcohol production of the Po1f strain, which served as the chassis strain for all recombinant yeast strains, was 0 after 48 h of shake-flask fermentation (i.e., below the detection limit).

[0119] Furthermore, among the various recombinant yeast strains, recombinant yeast strain Y05 had the highest yield of sclareol, reaching 19524 mg / L (i.e., 19524 mg of sclareol was produced per liter of fermentation broth); further calculations showed that the yield of sclareol was 81.35 mg / L / h, which is higher than the highest yield reported in small-scale fermentation (see Sun M. et al. Constructing a green oleaginous yeast cell factory for sustainable production of the plant-derived diterpenoid sclareol[J]. Green Chemistry, 2024, 26(9): 5202-5210).

[0120] The results in Table 2 show that, in the small-scale fermentation, strain Y05 significantly improved the production capacity of perillaldehyde compared to the chassis yeast Polf, with both yield and productivity greatly increased. This indicates that the multiple copy expression of the tCcLS fusion protein, along with the overexpression of ERG19, ERG13, ERG12, HMG1, and ERG8 genes in the MVA pathway, can significantly improve the production capacity of perillaldehyde by the lipophilic yeast Polf.

[0121] Example 5: An experiment was conducted to synthesize perillaldehyde in five consecutive batches of recombinant lipolytic yeast Y05 in a 5-ton pilot-scale fermenter, to test the stability of its ability to synthesize perillaldehyde in pilot-scale fermentation.

[0122] In this embodiment, the recombinant Yersinia yeast strain Y05 constructed in Example 2 was fermented in a 5-ton pilot-scale fermenter for five consecutive batches. The yield and productivity of perillaldehyde in each fermentation product were detected to evaluate the stability of the ability of the recombinant Yersinia yeast strain Y05 to synthesize perillaldehyde in pilot-scale fermentation.

[0123] The activation of the strain and product detection were the same as in Example 3. For the fermenter, the initial fermentation OD was between 1 and 2. Glucose concentration was measured in real time during fermentation; when the concentration was below 10 g / L, it was maintained at a level not lower than 10 g / L using a fed-batch method. After continuous cultivation for 240 h, samples were taken to measure the perillaldehyde yield over 240 h. The results are shown in Table 3.

[0124] Table 3. Yield of perillaldehyde from strain Y05 in 5 batches of 5-ton fermenter

[0125]

[0126] As shown in Table 3, the yield and productivity of recombinant Yersinia yeast strain Y05 showed little fluctuation in the production of perillaldehyde during five consecutive batches fermented for 240 hours in a 5-ton pilot-scale fermenter. The coefficient of variation (CV) of perillaldehyde production among the batches was calculated to be 3.78% (the formula is CV = standard deviation (σ) / arithmetic mean). This indicates that the recombinant yeast strain has a stable and excellent perillaldehyde production capacity at the pilot-scale level and has the potential to expand production scale.

[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. An isolated polypeptide tCcLPPS, characterized in that, The polypeptide tCcLPPS has lysine pyrophosphate diol ester synthase activity and has a selective amino acid sequence: (1) The amino acid sequence shown in SEQ ID NO:1; or, (2) An amino acid sequence that has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:1 and has substantially the same lysine pyrophosphate diol ester synthase activity.

2. An isolated polypeptide tCcSCS, characterized in that, The polypeptide tCcSCS possesses perilla ethanol synthase activity and has a selected amino acid sequence: (1) The amino acid sequence shown in SEQ ID NO:2; or, (2) An amino acid sequence that has at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:2 and has substantially the same sage alcohol synthase activity as it.

3. A polynucleotide encoding the polypeptide tCcLPPS as described in claim 1, or encoding the polypeptide tCcSCS as described in claim 2; Optionally, the polynucleotide is DNA or mRNA; Preferably, the polynucleotide comprises a DNA sequence as shown in SEQ ID NO:3 or 4; Preferably, the polynucleotide comprises an mRNA sequence as shown in SEQ ID NO:5 or 6.

4. A nucleic acid construct comprising the polynucleotide as described in claim 3, and optionally, at least one expression regulatory element operatively linked to the polynucleotide.

5. An expression vector comprising the nucleic acid construct as described in claim 4.

6. A transformed host cell, wherein the cell is transformed or transfected with the polynucleotide of claim 3, the nucleic acid construct of claim 4, or the expression vector of claim 5.

7. The application of the polypeptide tCcLPPS as described in claim 1, the polypeptide tCcSCS as described in claim 2, the polynucleotide as described in claim 3, the nucleic acid construct as described in claim 4, the expression vector as described in claim 5, and / or the transformed host cell as described in claim 6 in the preparation of a recombinant lipophilic yeast strain with high perillaldehyde production, or in increasing the perillaldehyde production of lipophilic yeast; preferably, the lipophilic yeast is Yersinia lipophilia Po1f, Po1g, and / or Po1fΔKu70.

8. A recombinant strain that produces high levels of perillaldehyde, characterized in that, The recombinant strain was introduced into a substrate of lipophilic yeast. It is constructed from multiple exogenous genes, wherein the exogenous genes include: The gene encoding the polypeptide tCcLPPS as described in claim 1, the gene encoding the polypeptide tCcSCS as described in claim 2, the gene encoding the mevalonate kinase ERG12, the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13, the gene encoding the mevalonate phosphate kinase ERG8, the gene encoding the mevalonate pyrophosphate decarboxylase ERG19, and the gene encoding the HMG coenzyme A reductase HMG1. Preferably, the strain in the chassis is selected from: Yersinia lipophila Po1f, Po1g and / or Po1fΔKu70; Preferably, the gene encoding the polypeptide tCcLPPS as described in claim 1 has the nucleotide sequence shown in SEQ ID NO:3; Preferably, the gene encoding the polypeptide tCcSCS as described in claim 2 has the nucleotide sequence shown in SEQ ID NO:4; Preferably, the gene encoding the mevalonate kinase ERG12 has the nucleotide sequence shown in SEQ ID NO:7; Preferably, the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 has the nucleotide sequence shown in SEQ ID NO:8; Preferably, the gene encoding the mevalonate kinase ERG8 has the nucleotide sequence shown in SEQ ID NO:9; Preferably, the gene encoding the mevalonate pyrophosphate decarboxylase ERG19 has the nucleotide sequence shown in SEQ ID NO:10; Preferably, the gene encoding the HMG coenzyme A reductase HMG1 has the nucleotide sequence shown in SEQ ID NO:11; Preferably, the encoding gene is integrated into the genome using CRISPR technology; Preferably, the gene encoding the polypeptide tCcLPPS as described in claim 1 and the gene encoding the polypeptide tCcSCS as described in claim 2 are fused and expressed. More preferably, the fused expression gene is multiple copies, and the multiple copies of the fused expression gene are expressed under different promoters and integrated into the strain genome at different sites. Preferably, the gene encoding the mevalonate kinase ERG12 is fused to the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13; Preferably, the gene encoding mevalonate phosphate kinase ERG8 and the gene encoding mevalonate pyrophosphate decarboxylase ERG19 are expressed in a fusion manner.

9. The method for preparing the recombinant strain according to claim 8, characterized in that, The preparation method includes the following steps: (1) Constructing the fusion expression plasmid pCRISPRyl-XPR2:tCcLS Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the XPR2 integration site, the fusion expression cassette of the gene encoding the peptide tCcLPPS as described in claim 1 and the gene encoding the peptide tCcSCS as described in claim 2 with a promoter, the downstream homologous arm of the XPR2 integration site, and the sgRNA sequence targeting the XPR2 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant I; transformant I is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-XPR2:tCcLS is obtained; (2) Construction of the fusion expression plasmid pCRISPRyl-SCP2:tCcLS Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the SCP2 integration site, the fusion expression cassette of the gene encoding the polypeptide tCcLPPS as described in claim 1 and the gene encoding the polypeptide tCcSCS as described in claim 2 with a promoter, the downstream homologous arm of the SCP2 integration site, and the sgRNA sequence targeting the SCP2 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant II; transformant II is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-SCP2:tCcLS is obtained; (3) Construct the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13 Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the GSY integration site, the fusion expression cassette containing the gene encoding the mevalonate kinase ERG12 and the gene encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 with a promoter, the downstream homologous arm of the GSY integration site, and the sgRNA sequence targeting the GSY integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant III; transformant III is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13 is obtained; (4) Construct the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19 Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the D17 integration site, the fusion expression cassette containing the gene encoding the mevalonate kinase ERG8 and the gene encoding the mevalonate pyrophosphate decarboxylase ERG19 with a promoter, the downstream homologous arm of the D17 integration site, and the sgRNA sequence targeting the D17 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant IV; transformant IV is transformed into competent cells, and after screening and verification, the recombinant fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19 is obtained; (5) Construct expression plasmid pCRISPRyl-A08:HMG1 Obtain the pCRISPRyl backbone sequence containing Cas9 editing protein elements, the upstream homologous arm of the A08 integration site, the gene expression cassette of the HMG coenzyme A reductase HMG1 with a promoter, the downstream homologous arm of the A08 integration site, and the sgRNA sequence targeting the A08 integration site; ligate the above sequence fragments using a one-step cloning method to obtain transformant V; transformant V is transformed into competent cells, and after screening and verification, the recombinant expression plasmid pCRISPRyl-A08:HMG1 is obtained; (6) Prepare competent cells from the chassis strain; transform the competent cells with the fusion expression plasmid pCRISPRyl-XPR2:tCcLS constructed in step (1), and obtain recombinant strain Y01 after screening and verification, wherein the fusion expression gene of the polypeptide tCcLPPS as described in claim 1 and the polypeptide tCcSCS as described in claim 2 is inserted at the specified site XPR2. (7) Prepare competent cells from recombinant strain Y01; transform the competent cells of recombinant strain Y01 with the fusion expression plasmid pCRISPRyl-SCP2:tCcLS constructed in step (2), and obtain recombinant strain Y02 after screening and verification, wherein the fusion expression gene of the polypeptide tCcLPPS as described in claim 1 and the polypeptide tCcSCS as described in claim 2 is inserted at the designated site SCP2. (8) Prepare competent cells from recombinant strain Y02; transform competent cells of recombinant strain Y02 with the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13 constructed in step (3), and obtain recombinant strain Y03 after screening and verification, wherein the fusion expression gene of mevalonate kinase ERG12 and 3-hydroxy-3-methylglutaryl coenzyme A synthase ERG13 is inserted into the designated site GSY; (9) Prepare competent cells from recombinant strain Y03; transform competent cells of recombinant strain Y03 with the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19 constructed in step (4), and obtain recombinant strain Y04 after screening and verification, wherein the fusion expression gene of the mevalonate phosphate kinase ERG8 and the mevalonate pyrophosphate decarboxylase ERG19 is inserted at the designated site D17; (10) Prepare competent cells from recombinant strain Y04; transform the competent cells of recombinant strain Y04 with the expression plasmid pCRISPRyl-A08:HMG1 constructed in step (5), and obtain recombinant strain Y05 after screening and verification, wherein the expression gene of HMG coenzyme A reductase HMG1 is inserted at the specified site A08; the recombinant strain Y05 is the recombinant strain described in the title. Preferably, in the fusion expression plasmid pCRISPRyl-XPR2:tCcLS, the gene sequence encoding the polypeptide tCcLPPS as described in claim 1 is shown in SEQ ID NO:3, the gene sequence encoding the polypeptide tCcSCS as described in claim 2 is shown in SEQ ID NO:4, and the sgRNA sequence targeting the XPR2 integration site is shown in SEQ ID NO:

12. Preferably, in the fusion expression plasmid pCRISPRyl-SCP2:tCcLS, the gene sequence encoding the polypeptide tCcLPPS as described in claim 1 is shown in SEQ ID NO:3, the gene sequence encoding the polypeptide tCcSCS as described in claim 2 is shown in SEQ ID NO:4, and the sgRNA sequence targeting the SCP2 integration site is shown in SEQ ID NO:

13. Preferably, in the fusion expression plasmid pCRISPRyl-GSY:ERG12-ERG13, the gene sequence encoding the mevalonate kinase ERG12 is shown in SEQ ID NO:7, the gene sequence encoding the 3-hydroxy-3-methylglutaryl-CoA synthase ERG13 is shown in SEQ ID NO:8, and the sgRNA sequence targeting the GSY integration site is shown in SEQ ID NO:14; Preferably, in the fusion expression plasmid pCRISPRyl-D17:ERG8-ERG19, the gene sequence encoding the mevalonate phosphate kinase ERG8 is shown in SEQ ID NO:9, the gene sequence encoding the mevalonate pyrophosphate decarboxylase ERG19 is shown in SEQ ID NO:10, and the sgRNA sequence targeting the D17 integration site is shown in SEQ ID NO:15; Preferably, in the expression plasmid pCRISPRyl-A08:HMG1, the gene sequence encoding HMG coenzyme A reductase HMG1 is shown in SEQ ID NO:11, and the sgRNA sequence targeting the A08 integration site is shown in SEQ ID NO:

16. Preferably, the promoters used in the above-mentioned fusion expression plasmids or expression plasmids are the same or different. Preferably, the promoters used are selected from pU12, pU13 and / or pC48.

10. The application of the recombinant strain according to claim 8 or the recombinant strain obtained by the preparation method according to claim 9 in the production of perillaldehyde.

11. A method for producing perillyl alcohol, characterized in that, The method includes: The recombinant strain according to claim 8 or the recombinant strain obtained by the preparation method according to claim 9 is used as the fermentation strain to prepare seed liquid and fermentation culture, and to obtain the sage-perilla alcohol from the fermentation culture and / or cell. Preferably, the method for preparing the seed liquid includes: The recombinant strain according to claim 8 or the recombinant strain obtained by the preparation method according to claim 9 is activated, a single colony is picked and inoculated into a seed culture medium, and cultured at 28-32℃ and 100-250rpm for 6-48 hours. Preferably, the fermentation culture method includes: The seed culture is inoculated into a fermentation medium to obtain an initial fermentation culture with an initial OD600 of 0.6-1.2, preferably 1.

0. The obtained initial fermentation culture is fermented at 28-32℃ and 100-250rpm for 6-48 hours to obtain the fermentation culture and / or cell. Preferably, the method for obtaining the styracil alcohol from fermentation cultures and / or cell cultures includes: It is obtained by extraction from the fermentation culture and / or cells using one of the following extractants: ethyl acetate, methanol, ethanol, n-hexane, dodecane, butyl acetate, vegetable oil, isopropyl myristate, oleic acid, and ethyl oleate.

Citation Information

Patent Citations

  • Construction method for high-yield sclareol strain

    CN103387944A

  • Recombinant yarrowia lipolytica with high yield of sclareol as well as construction method and application of recombinant yarrowia lipolytica

    CN114989997A

  • Yarrowia lipolytica engineering strain with high yield of sclareol as well as construction method and application of yarrowia lipolytica engineering strain

    CN117264792A

  • Recombinant yarrowia lipolytica with high yield of sclareol as well as preparation method and application of recombinant yarrowia lipolytica

    CN120330072A