Application of adenylate succinate lyase PurB in regulation and control of biosynthesis of acardipine

Abstract

The invention relates to the field of biotechnology and medical chemistry, in particular to application of adenylate succinate lyase purB in regulation and control of acardipine biosynthesis, and particularly discloses a mechanism of a global regulatory factor VeA in regulation and control of an AICAR biosynthesis pathway in fusarium solani for the first time by improving the yield of AICAR through overexpression of an adenylate succinate lyase purB gene. Wherein adenylate succinate lyase (purB) is used as a rate-limiting enzyme to play a key role in AICAR synthesis, meanwhile, it is found that VeA can influence AICAR biosynthesis of a strain HB1-J1 by regulating and controlling the equilibrium state of an adenylate succinate lyase system, and meanwhile, it is found that two proteins pro06469 and pro10879 similar to a purB structural domain can play an important role in AICAR synthesis.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and medicinal chemistry, specifically to the application of adenosine succinate lyase PurB in regulating the biosynthesis of acalcidol. Background Technology

[0002] Acadesine (AICAR) possesses broad bioactivity and is currently undergoing its third clinical trial, demonstrating its potential as a novel drug. This invention aims to analyze key steps in the AICAR biosynthetic pathway, laying a theoretical foundation for the engineered production of AICAR. Previous research in our group found that overexpression of the gene encoding the global regulator VeA significantly increased AICAR production and enhanced the antitumor activity of *Fusarium solani* strain. Through combined transcriptomic and metabolomic analysis, we determined that the AICAR synthesis pathway mainly consists of 10 steps, with adenylate succinate lyase (PurB) playing a crucial role as the rate-limiting enzyme in AICAR metabolism. Further research revealed that increased expression of the adenylate succinate lyase gene significantly increased AICAR content in endophytic *Fusarium solani*. Interestingly, in FsveAOE14, purB expression was significantly downregulated, contradicting the increased AICAR production with VeA overexpression, suggesting that other genes besides purB may be involved in AICAR synthesis. Therefore, analysis of PurB isoenzymes in *Fusarium solani* endophytes revealed two proteins, pro06469 and pro10879, with domains similar to purB. The genes encoding these two proteins were significantly upregulated in FsveAOE14. Based on this, it is speculated that VeA likely plays a crucial regulatory role in the homeostasis of the adenylate-succinate lyase system through some mechanism, participating in AICAR synthesis in *Fusarium solani* endophytes. In summary, the global regulatory factor VeA plays a key role in *Fusarium solani* endophytes, mediating AICAR synthesis by regulating adenylate-succinate lyase, thereby affecting the antitumor activity of *Fusarium solani* endophytes. This invention aims to elucidate the metabolic regulatory mechanism of AICAR in strain HB1-J1, providing a theoretical basis for the efficient biosynthesis of AICAR. Summary of the Invention

[0003] This invention addresses the shortcomings of existing technologies by proposing the application of adenosine succinate lyase PurB in regulating the biosynthesis of acalcidyl new cells.

[0004] Specifically, this is achieved through the following technical solutions:

[0005] Application of adenosine succinate lyase purB in regulating the biosynthesis of acalcidol.

[0006] Specifically, the above application refers to upregulating the content of acalcidin in Fusarium solani HB1-J1 by overexpressing adenosine succinate lyase purB in Fusarium solani HB1-J1.

[0007] The application includes the following steps: 1) constructing an overexpression vector of adenosine succinate lyase purB as described in claim 1; 2) introducing the purB overexpression vector into Fusarium solani HB1-J1 using Agrobacterium tumefaciens electroporation transformation, thereby increasing the expression level of the purB gene in Fusarium solani.

[0008] Furthermore, the application includes the following steps:

[0009] 1) Construction of an overexpression vector for adenosine succinate lyase purB: Primers were designed based on the sequencing results of the purB gene. Then, using the total DNA of HB1-J1 as a template, the purB gene was amplified by PCR. The PCR product was then analyzed by agarose gel electrophoresis. The purified target gene fragment was obtained by gel extraction. The plasmid containing pK2-hyg was then linearized using SnaBI restriction endonuclease to obtain a linearized vector. Finally, the linearized vector was ligated with the purB gene fragment using ligase to obtain the purB overexpression vector.

[0010] 2) The overexpression vector of purB was introduced into Fusarium tumefaciens HB1-J1 cells using Agrobacterium tumefaciens electroporation to increase the expression level of the purB gene in Fusarium tumefaciens: The overexpression vector of purB was added to Agrobacterium tumefaciens AGL-1 competent cells and mixed thoroughly. The mixture was then placed in an electroporation apparatus with a voltage set of 2.2-2.4 kV / min and a voltage duration of 6 ms for electroporation. After electroporation, the mixture was immediately transferred to a liquid culture medium containing kanamycin and carbenicillin antibiotics and cultured at 28°C and 180 rpm until Agrobacterium tumefaciens recovered. Subsequently, the cultured Agrobacterium tumefaciens AGL-1 cells were co-cultured with Fusarium tumefaciens HB1-J1 cells to screen out Fusarium tumefaciens cells successfully infused with the purB overexpression vector.

[0011] The upstream primer for amplifying the purB gene is ATCCTCGAGTACGTAATGTCCGACGATCACCAG, and the downstream primer is CTTTCTAGATACGTATTAGACATTCAGCTGCGC.

[0012] 1. This invention reveals for the first time the mechanism by which the global regulatory factor VeA regulates the AICAR biosynthetic pathway in Fusarium solanum, in which adenosine succinate lyase (PurB) plays a key role as the rate-limiting enzyme in AICAR synthesis.

[0013] 2. This invention has discovered that VeA may affect the biosynthesis of AICAR in strain HB1-J1 by regulating the balance of the adenylate succinate lyase system. At the same time, it has been found that two proteins, pro06469 and pro10879, which are similar to the PurB domain, may play an important role in AICAR synthesis.

[0014] 3. This invention provides a production method to increase AICAR yield, including overexpression of the global regulatory factor VeA gene or the adenosine succinate lyase (PurB) gene, thereby increasing the AICAR yield in Fusarium solanum.

[0015] Beneficial effects:

[0016] (1) High efficiency and accuracy: By overexpressing the PurB gene, the yield of AICAR is significantly and accurately increased. The method of this invention can be used for the efficient production of AICAR.

[0017] (2) Scalability: The method of the present invention is not only applicable to Fusarium solani HB1-J1, but can also be applied to other microorganisms with similar metabolic pathways, providing reference for the production of other metabolites.

[0018] (3) High application value: As an important bioactive substance, AICAR has broad application prospects in medicine, agriculture and other fields. The method of this invention lays the material foundation and provides technical support for the large-scale production of AICAR. Attached Figure Description

[0019] Figure 1 This document describes the construction of the purB gene overexpression vector. A: A gel image showing PCR validation of E. coli colonies transformed with the purB gene overexpression vector. Lane M is the DNA Marker D2000, and lanes 1-11 are 11 randomly selected single colonies of E. coli transformants. B: Sequence alignment results of purB and the inserted fragment from the purB overexpression vector (some alignment results are not shown). Sequence "○1" is the purB gene sequence of Fusarium solani HB1-J1, and sequence "○2" is the gene sequence obtained from sequencing the inserted fragment in the purB overexpression vector.

[0020] Figure 2 Genetic transformation of endophytic Fusarium solani HB1-J1 strain and screening of purB overexpression transformants; A: PCR verification gel image of *Agrobacterium solani* AGL-1 colonies transformed with purB overexpression vector, lane M is DNA Marker D2000, lanes 1 to 4 show four randomly selected single colonies of *Agrobacterium* transformants; B: Schematic diagram of promoter substitution strategy; C: Screening of purB overexpression transformants.

[0021] Figure 3 For FsveA OE14 Determination of the relative expression level of purB in the middle jiao;

[0022] Figure 4 For WT, FspurB OE2 and FsveA OE14 LC-MS spectra of fermentation products from the strain; where A: AICAR standard; B: WT crude extract; C: Fspur B OE2 Crude extract; D: FsveA OE14 crude extract;

[0023] Figure 5 The effects of veA and purB on AICAR biosynthesis in Fusarium oxysporum; where A: determination of AICAR content: under the same conditions, WT, FspurB OE2 and FsveA OE14 Fermentation was carried out for 7 days, and the AICAR content in the fermentation product was detected by LC-MS, using commercially available AICAR standards as a reference; B: Targeting FsveA OE14 The expression levels of pro06469 and pro10879 were measured.

[0024] Figure 6 The images show the predicted conserved domains of PurB homologous proteins; where A: predicted conserved domains of L-Aspartase-like protein; B: predicted conserved domains of pro0924 (PurB) protein; C: predicted conserved domains of pro10879 protein; and D: predicted conserved domains of pro06469 protein. Detailed Implementation

[0025] The specific embodiments of the present invention will be described in further detail below, but the present invention is not limited to these embodiments. Any improvements or substitutions based on the basic spirit of these embodiments shall still fall within the scope of protection claimed by the claims of the present invention.

[0026] Example 1

[0027] Application of adenosine succinate lyase PurB in regulating acarbide biosynthesis; specifically, by increasing the expression level of adenosine succinate lyase PurB in Fusarium solani HB1-J1, the AICAR production in Fusarium solani HB1-J1 was increased.

[0028] Specifically, this involves a production method for increasing AICAR output, comprising the following steps:

[0029] 1) Construction of an overexpression vector for the adenosine succinate lyase (purB) gene: Primer pairs were designed based on the sequencing results of the purB gene as shown in Table 1. Then, using the total DNA of HB1-J1 as a template, the purB gene was amplified by PCR technology. The PCR product was then analyzed by agarose gel electrophoresis. The purified target gene fragment was obtained by gel extraction and recovery. The plasmid containing pK2-hyg (N-terminal vector) was linearized using SnaBI restriction endonuclease to prepare for the insertion of the purB gene fragment, thus obtaining a linearized vector. Finally, the linearized vector and the purB gene fragment were ligated using ligase to obtain the overexpression vector of the purB gene.

[0030] Table 1 Primers required for constructing the purB overload vector, validating the overload purB strain, and performing qRT-PCR expression analysis.

[0031]

[0032] 2) The overexpression vector of the purB gene was introduced into Fusarium tumefaciens HB1-J1 cells using Agrobacterium tumefaciens electroporation to increase the expression level of the purB gene in Fusarium tumefaciens: The overexpression vector of the purB gene was added to Agrobacterium tumefaciens AGL-1 competent cells and mixed thoroughly. The mixture was then placed in an electroporation apparatus with a voltage set of 2.2-2.4 kV / min and a voltage duration of 6 ms for electroporation. After electroporation, the mixture was immediately transferred to a liquid culture medium containing kanamycin and carbenicillin antibiotics and cultured at 28℃ and 180 rpm for several hours until Agrobacterium tumefaciens recovered. Subsequently, the cultured Agrobacterium tumefaciens AGL-1 cells were co-cultured with Fusarium tumefaciens HB1-J1 cells to screen out Fusarium tumefaciens cells that successfully incorporated the overexpression vector of the purB gene. The increase in purB gene expression was verified by RT-qPCR. Finally, a Fusarium tumefaciens strain with increased purB gene expression was obtained for subsequent experiments or applications.

[0033] 3) The yield of AICAR was detected using liquid chromatography-mass spectrometry (LC-MS), and the effect of overexpression of the global regulatory factor VeA or adenylate succinate lyase (PurB) on AICAR yield was evaluated. Engineered strains overexpressing the global regulatory factor VeA or adenylate succinate lyase (PurB) were constructed. Then, under the same culture conditions, wild-type strains and the constructed endophytic Fusarium solani were cultured for 7 days. After culture, the mycelia were removed using filter cloth, and the bacterial culture was collected and pretreated to obtain the crude ethyl acetate extract of the fermentation product. The crude extract samples were then analyzed by LC-MS. The yield of AICAR was quantitatively detected by comparing the chromatographic peak area or mass spectrometric signal intensity of AICAR in the wild-type strain and the overexpression mutant strain. Finally, based on the detection results, the effect of overexpression of the global regulatory factor VeA or adenylate succinate lyase (PurB) on AICAR yield was analyzed. If the AICAR yield in the overexpression mutant strain was significantly higher than that in the wild-type strain, it indicates that overexpression of this gene has a promoting effect on AICAR yield.

[0034] The detection conditions for the LC were as follows: the chromatographic column was an ACQUITY UPLC HSS T3 (100*2.1mm, 1.8μm) (Massachusetts State, US), and gradient elution was used with methanol (A)-0.1% formic acid aqueous solution (B) as the mobile phase. The elution gradient was set as follows: 0–2 min: 5% A, 2–5 min: 100% A; the flow rate was maintained at 0.2 mL / min throughout the process; the injection volume was 3 μL; and the column temperature was 30℃.

[0035] The detection conditions of the MS were as follows: electrospray ionization source (ESI), positive ion mode scanning, MRM; temperature (TEM): 500℃; nebulizer gas pressure: 50psi; auxiliary gas pressure: 50psi; positive and negative ion voltage (IS): 5500V; declustering voltage: 200V; collision chamber outlet voltage: 10V; outlet voltage: 10V.

[0036] This invention detects and identifies AICAR in crude extracts by comparison with AICAR reference standards. The AICAR reference standard was purchased from Shanghai Zhenzhun Biotechnology Co., Ltd.

[0037] 4) By analyzing the conserved domains of adenosine succinate lyase (purB) homologous proteins, it was found that VeA mediates the biosynthesis of AICAR by regulating the genes encoding purB and its homologous proteins pro06469 and pro10879.

[0038] First, the conserved domains of adenylate succinate lyase (PurB) and its homologs were analyzed using NCBI's CD-Search tool to determine their functional regions. Subsequently, RT-qPCR was used to detect the expression levels of the purB homologs pro06469 and pro10879 in the VeA overexpression mutant, showing significant upregulation, indicating that VeA plays a regulatory role in these genes. To further investigate the effects of VeA and PurB on AICAR biosynthesis, LC-MS analysis was performed on the ethyl acetate fermentation products of WT, FsveAOE14, and FspurBOE2 strains. The results showed that the AICAR content of strains overexpressing VeA and PurB increased by 15% and 20%, respectively, compared to WT, indicating that overexpression of these two genes can enhance AICAR production capacity. Although omics data predicted that PurB might negatively regulate AICAR biosynthesis, the experimental results showed an increase in AICAR content after overexpression of PurB, which is inconsistent with the prediction. Therefore, this invention further determined the expression levels of pro06469 and pro10879 in FsveAOE14, providing experimental evidence for understanding the regulatory mechanisms of VeA and PurB and their homologous proteins in AICAR biosynthesis.

[0039] Example 2

[0040] A method for increasing the production of AICAR from Fusarium oxysporum, a solanaceous causal agent, includes the following steps:

[0041] I. Materials and Methods

[0042] 1. Construction of purB gene overexpression vector

[0043] Extraction of total DNA from Fusarium solani: Total DNA was extracted from Fusarium solani HB1-J1 to ensure the purity and integrity of the DNA.

[0044] Extraction of E. coli plasmids: E. coli containing the pK2-hyg (N-terminal vector) plasmid were cultured on LK medium, and the plasmid was extracted. After verifying the quality of the plasmid by agarose gel electrophoresis, the plasmid was linearized using the SnaBI restriction endonuclease.

[0045] Primer design: Based on the purB gene sequence, specific primers were designed to ensure primer specificity and amplification efficiency.

[0046] Amplification of the purB gene: Using total DNA from HB1-J1 as a template, PCR amplification was performed using designed primers to obtain the purB gene fragment. The amplification product was recovered by agarose gel electrophoresis and DNA purification to obtain the target DNA fragment.

[0047] Construction of the overexpression vector: The purified purB gene fragment was ligated with linearized pK2-hyg (N-terminal vector) using a ligase to construct a complete purB gene overexpression vector.

[0048] Vector validation: The accuracy of the constructed overexpression vector was verified by DNA sequencing and agarose gel electrophoresis.

[0049] 2. Transformation and screening of Fusarium solani

[0050] Activation and culture of Agrobacterium tumefaciens: Agrobacterium tumefaciens AGL-1 containing the purB plasmid vector was streaked on YCK plates and cultured at 28°C for 2 days. Afterwards, a single colony was picked and cultured in YCK liquid medium until the OD660 value reached approximately 0.5.

[0051] Culture and spore preparation of Fusarium solani: After activating Fusarium solani on PDA plates, it was inoculated into corn liquid culture medium and cultured for 5 days. Germinated spores were obtained by filtration and the spore concentration was adjusted to 1×104 spores / mL.

[0052] Co-culture: The activated Agrobacterium and Fusarium spore suspension were mixed in equal volumes and spread on a microporous filter membrane on IM solid medium. The mixture was then incubated at 22°C in the dark for 48 hours.

[0053] Screening and culture: After co-culture, the filter membrane was transferred to a 1 / 2 PDA plate containing cephalosporin and hygromycin, and transformants were screened. The membrane was then cultured for another 4-6 days.

[0054] Transformant validation: A single colony from the plate was picked and inoculated onto a new 1 / 2 PDA plate and cultured for 4 days. Mycelial DNA was extracted using a high-temperature lysis method, and positive transformants were validated using PCR.

[0055] 3. Preparation of crude extract and LC-MS analysis of AICAR content

[0056] This invention provides an experimental method for determining the AICAR content in fungi, comprising three main steps: fungal culture, metabolite extraction, and LC-MS analysis.

[0057] Fungal culture: WT, FsveA OE14 and FspurB OE2 The strain was inoculated into PDA medium and activated at 28°C for 5 days. Holes were punched at the edge of the colonies using a 7mm diameter punch to obtain bacterial blocks.

[0058] Metabolite extraction: The bacterial blocks were inoculated onto Sabouraud dextrose agar and fermented for 7 days at 28°C and 180 rpm. Fungal mycelia were removed through a filter cloth, and the mixture was extracted three times with an equal volume of ethyl acetate. The extract was then concentrated under reduced pressure using a rotary evaporator to obtain the crude extract.

[0059] AICAR content determination: LC-MS was performed using an ACQUITY UPLC HSS T3 column with a methanol-0.1% formic acid aqueous solution as the mobile phase and gradient elution. Mass spectrometry conditions were set to electrospray ionization (ESI) and positive ion mode scanning (MRM). AICAR in the crude extract was detected and identified by comparison with AICAR standards.

[0060] Strict control of temperature, rotation speed, and other conditions is necessary during the experiment to ensure the accuracy of the results. The reference standard AICAR was purchased from Shanghai Zhenzhun Biotechnology Co., Ltd. This experimental method is simple and easy to perform, and can be used to rapidly and accurately determine the AICAR content in fungi, providing important technical support for fungal metabolism research.

[0061] II. Experimental results are shown below Figures 1-6

[0062] Figure 1 This section describes the construction of the purB gene overexpression vector. A: A gel image showing PCR validation of E. coli colonies transformed with the purB gene overexpression vector. Lane M is the DNA Marker D2000, and lanes 1-11 are 11 randomly selected single colonies of E. coli transformants. B: Sequence alignment results of purB and the inserted fragment from the purB overexpression vector (some alignment results are not shown). Sequence "○1" is the purB gene sequence of Fusarium solani HB1-J1, and sequence "○2" is the gene sequence obtained by sequencing the inserted fragment from the purB overexpression vector.

[0063] Figure 2 This study aimed to investigate the genetic transformation of the endophytic *Fusarium solani* HB1-J1 strain and the screening of transformants overexpressing purB. A: PCR validation gel image of *Agrobacterium tumefaciens* AGL-1 colonies transformed with purB overexpression vector; lane M is the DNA Marker D2000; lanes 1-4 show four randomly selected single colonies of *Agrobacterium* transformants. B: Schematic diagram of promoter substitution strategy. C: Screening of purB overexpression transformants. The experiment was repeated three times to obtain more reliable results, and the average value was used. To reflect the dispersion of the experimental data, the standard deviation was calculated and displayed in the figure as error bars. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001.

[0064] Figure 3For FsveA OE14 Determination of the relative expression level of purB in the middle.

[0065] To determine the expression levels of the purB gene in WT, FspurBOE2, and FsveAOE14, qRT-PCR was used, with β-actin as a reference gene for standardization. The bar charts show the mean values ​​obtained after three replicates, and the standard deviation (±SD) reflects the dispersion of the data. In the analysis of the significance of purB expression levels in the supernumerary strains compared to WT, "*" represents a significant result with a p-value less than 0.05, while "**" represents a more significant difference with a p-value less than 0.01. ns indicates no significant difference between the two groups.

[0066] Figure 4 For WT, FspurB OE2 and FsveA OE14 LC-MS spectra of fermentation products from the strain; where A: AICAR standard; B: WT crude extract; C: Fspur B OE2 Crude extract; D: FsveA OE14 crude extract;

[0067] Figure 5 The effects of veA and purB on AICAR biosynthesis in Fusarium oxysporum; where A: determination of AICAR content: under the same conditions, WT, FspurB OE2 and FsveA OE14 Fermentation was carried out for 7 days, and the AICAR content in the fermentation product was determined by LC-MS, using a commercially available AICAR standard as a reference. The mean and standard deviation (±SD) of the three experiments are visually presented in this bar chart. Error bars show the standard deviation (±SD) between each experimental data and the mean, reflecting the stability and reliability of the experimental data. B: For FsveA OE14 The expression levels of pro06469 and pro10879 were determined. In the significance analysis between the expression level of the supersupplied strain and WT, a p-value less than 0.05 was indicated by "*", and a p-value less than 0.01 was indicated by "**", to distinguish different levels of significance. ns indicates no significant difference.

[0068] Figure 6 Figure 1 shows the predicted conserved domains of PurB homologous proteins; where A: predicted conserved domains of L-Aspartase-like protein; B: predicted conserved domains of pro0924 (PurB) protein; C: predicted conserved domains of pro10879 protein; and D: predicted conserved domains of pro06469 protein.

[0069] 1. Successful construction of gene overexpression vector

[0070] Eleven single colonies of *E. coli* grown on LK plates were randomly selected and used as templates for PCR amplification. Figure 1 As shown in Figure A, the PCR amplification products of these 11 colonies all exhibited single and clear bands in the agarose gel electrophoresis experiment, with a fragment size of approximately 2500 bp. This is consistent with the theoretical size of the purB gene fragment. Therefore, it was preliminarily determined that the purB gene had been successfully inserted into the plasmid. Subsequently, the recombinant plasmid was extracted and sequenced by Beijing Qingke Biotechnology Co., Ltd. The sequenced insert fragment sequence was compared with the purB gene sequence. Figure 1 The results showed that the two sequences were highly consistent, with a sequence consistency of over 97%. Therefore, it can be confirmed that the purB overdose vector has been successfully constructed and is suitable for subsequent experimental operations.

[0071] 2. Successfully screened and obtained purB hypertransformants

[0072] After successfully constructing the purB hypervector, the vector was transformed into Agrobacterium tumefaciens AGL-1 using electroporation. A single colony grown on a YCK plate was then randomly selected as the amplification template for PCR validation. Figure 2 -A), all four selected monoclonal colonies amplified single and clear bands, with a size of approximately 2500 bp, consistent with the expected band size. Based on this result, we confirmed that the purB overdose vector had been successfully transformed into Agrobacterium tumefaciens AGL-1 and could be used for subsequent genetic transformation experiments. Next, using the Agrobacterium tumefaciens AGL-1-mediated genetic transfer method, a promoter substitution strategy was employed ( Figure 2 -B) gpdA-purB was inserted into the fungal genome to obtain purB overexpression transformants. Subsequently, the relative gene expression levels of the obtained purB overexpression transformants were determined. qPCR results showed that the purB overexpression transformant FspurB... OE2 FspurB OE5 FspurB OE8 FspurB OE11 FspurB OE12 FspurB OE14 The relative expression levels of purB in the samples were 13.32, 0.92, 10.08, 9.54, 15.98, and 11.69 times that of WT, respectively. Figure 2 -C). Therefore, FspurB, which has a high and stable expression level of the purB gene, was selected. OE2 As a subsequent experimental strain.

[0073] 3. Significant increase in AICAR production

[0074] Having clarified the relationship between the global regulatory factors VeA and purB, the effects of the veA and purB genes on AICAR biosynthesis remain unclear. Therefore, we performed LC-MS analysis on the ethyl acetate fermentation product of the strain to determine WT and FsveA. OE14 and FspurB OE2 AICAR content. Results showed that WT and FsveA... OE14 and FspurB OE2 Peaks similar to those of the AICAR standard were observed in all crude extracts. Figure 4 ), calculations revealed that FsveA OE14 and FspurB OE2 The AICAR content in the samples increased by 15% and 20% respectively compared to WT. Figure 5 -A). However, FsveA OE14 Metabolomics and transcriptomics data analysis indicated that purB may negatively regulate AICAR biosynthesis. However, excessive purB from the strain resulted in increased AICAR levels, which contradicted the predictions made by the aforementioned omics data. Analysis of conserved domains in PurB homologs pro06469 and pro10879 revealed that PurB shares the same adenylate succinate lyase functional region with its homologs pro06469 and pro10879. Figure 6 This indicates that these three proteins may have the same adenylate succinate lyase function. Subsequently, FsveA was measured. OE14 The relative expression levels of pro06469 and pro10879 genes in the sample are shown in the following results. Figure 5 As shown in Figure -B, the expression levels of pro06469 and pro10879 were 2.33-fold and 1.53-fold higher than those of WT, respectively. In summary, overexpression of veA and purB in *Fusarium solani* HB1-J1 enhances the strain's ability to produce AICAR. The global regulatory factor VeA may increase the AICAR content of strain HB1-J1 by regulating purB and its homologs pro06469 and pro10879.

[0075] Therefore, this invention not only successfully constructed a purB gene overexpression vector and obtained strains with high purB expression through genetic transformation, but also revealed the regulatory roles of VeA and purB genes in AICAR biosynthesis, providing an important theoretical basis and experimental evidence for further improving AICAR yield.

Claims

1. Application of adenosine succinate lyase purB in regulating the biosynthesis of acalcidol.

2. The application as described in claim 1, characterized in that, The content of acalcidin in Fusarium solani HB1-J1 was upregulated by overexpressing adenosine succinate lyase purB in Fusarium solani HB1-J1.

3. The application as described in claim 1 or 2, characterized in that, The application includes the following steps: 1) constructing an overexpression vector of adenosine succinate lyase purB as described in claim 1; 2) introducing the purB overexpression vector into Fusarium solani HB1-J1 using Agrobacterium tumefaciens electroporation transformation, thereby increasing the expression level of the purB gene in Fusarium solani.

4. The application as described in claim 3, characterized in that, The application includes the following steps: 1) Construction of an overexpression vector for adenosine succinate lyase purB: Primers were designed based on the sequencing results of the purB gene. Then, using the total DNA of HB1-J1 as a template, the purB gene was amplified by PCR. The PCR product was then analyzed by agarose gel electrophoresis. The purified target gene fragment was obtained by gel extraction. The plasmid containing pK2-hyg was then linearized using SnaBI restriction endonuclease to obtain a linearized vector. Finally, the linearized vector was ligated with the purB gene fragment using ligase to obtain the purB overexpression vector. 2) The overexpression vector of purB was introduced into Fusarium tumefaciens HB1-J1 cells using Agrobacterium tumefaciens electroporation to increase the expression level of the purB gene in Fusarium tumefaciens: The overexpression vector of purB was added to Agrobacterium tumefaciens AGL-1 competent cells and mixed thoroughly. The mixture was then placed in an electroporation apparatus with a voltage set of 2.2-2.4 kV / min and a voltage duration of 6 ms for electroporation. After electroporation, the mixture was immediately transferred to a liquid culture medium containing kanamycin and carbenicillin antibiotics and cultured at 28°C and 180 rpm until Agrobacterium tumefaciens recovered. Subsequently, the cultured Agrobacterium tumefaciens AGL-1 cells were co-cultured with Fusarium tumefaciens HB1-J1 cells to screen out Fusarium tumefaciens cells successfully infused with the purB overexpression vector.

5. The application as described in claim 3 or 4, characterized in that, The upstream primer for amplifying the purB gene is ATCCTCGAGTACGTAATGTCCGACGATCACCAG, and the downstream primer is CTTTCTAGATACGTATTAGACATTCAGCTGCGC.

Images