Application of NK4 as target spot in preparation of product for diagnosing or preventing and treating B-cell lymphoma

Abstract

The invention discloses application of NK4 as a target spot in preparation of a product for diagnosing or preventing and treating B-cell lymphoma, and belongs to the technical field of biological medicine. By inhibiting the expression or function of NK4, a Rap1 signal channel is blocked, so that the proliferation of tumor cells is inhibited, and the apoptosis of the tumor cells is induced. The invention provides that NK4 can induce B cell lymphoma, and block NK4 can treat diffuse large B cell lymphoma (DLBCL) by reducing proliferation of the B cell lymphoma and increasing apoptosis of the B cell lymphoma; and NK4 is also a mark of the DLBCL. NK4 and a downstream Rap1 signal channel thereof can be used as diagnosis, treatment and drug development targets of B cell lymphoma.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of NK4 as a target in the preparation of products for the diagnosis or prevention of B-cell lymphoma. Background Technology

[0002] B-cell lymphoma is a heterogeneous group of malignant tumors originating from B lymphocytes, including subtypes such as diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), mantle cell lymphoma (MCL), and chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL). Its treatment system is showing a trend towards multimodal, personalized, and targeted approaches.

[0003] Current Status and Challenges of B-cell lymphoma Treatment Research: While significant progress has been made in the treatment of B-cell lymphoma, several challenges remain. Early-stage and aggressive B-cell lymphomas show remarkable efficacy and high cure rates, but advanced or refractory lymphomas still present treatment challenges. Novel therapies (such as CAR-T cell therapy) have brought hope to some refractory patients, but these also come with high treatment costs and potential side effects.

[0004] The difference between B cells and B-cell lymphoma is that B cells are normal immune cells that differentiate from hematopoietic stem cells in the bone marrow; while B-cell lymphoma is a tumor cell that is malignantly transformed from these B cells. It originates from B cells at different stages of differentiation (pre-embryonic, embryonic, memory B cells, etc.), proliferates uncontrollably, and destroys the immune system and organ structure.

[0005] B-cell lymphoma is a tumor and not an autoimmune disease. The reason is that xerostomia is an autoimmune disease caused by the overexpression of NK4, but it does not necessarily lead to B-cell lymphoma. There are no reports on whether NK4 can be used as a target for the treatment of B-cell lymphoma.

[0006] Natural Killer Cell Transcript 4 (NK4) is a splice variant of interleukin-32 (IL-32). IL-32 is a non-canonical secreted pro-inflammatory cytokine expressed in various immune cells, particularly natural killer (NK) cells, T cells, monocytes, and macrophages. NK4 is one of the short splice variants of the IL-32 gene formed through alternative splicing. Its structure and function differ from the canonical IL-32 α, β, and γ isoforms, and it possesses unique immunomodulatory activities.

[0007] Although NK4 is one of the IL-32 splice variants, studies have shown that it has independent and significant functions in immune regulation and tumor progression. NK4 can induce the expression of inflammatory factors such as TNF-α, IL-6, IL-8, and MIP-2; activate inflammatory signaling pathways such as NF-κB and p38 MAPK; and promote chemotaxis and activation of immune cells in the inflammatory microenvironment. In addition, NK4 can upregulate PD-L1 expression, regulating the immune escape ability of tumor cells; interact with monocytes and dendritic cells to regulate antigen presentation; and affect the degree of immunosuppression by regulating the microenvironment of Tregs or MDSCs.

[0008] NK4 is abnormally overexpressed in certain tumor tissues and is associated with enhanced tumor proliferation and metastasis; it also promotes cancer cell migration and invasion, as well as the activation of tumor-related signaling pathways (such as Rap1, MAPK, and STAT3). Rap1 is a small GTPase that plays a crucial role in cell adhesion, migration, and growth signal regulation, and has been shown to have tumorigenic potential in various tumors. Currently, no literature systematically elucidates how NK4 affects the progression of B-cell lymphoma by regulating the Rap1 signaling pathway. Summary of the Invention

[0009] The technical problem to be solved by this invention is how to propose the application of NK4 as a target in the preparation of products for the diagnosis or prevention of B-cell lymphoma.

[0010] The present invention solves the above-mentioned technical problems through the following technical means:

[0011] The first aspect of this invention proposes the use of NK4 as a target in the preparation of products for the diagnosis or prevention of B-cell lymphoma, wherein NK4 comprises the NK4 gene and the NK4 protein, and the CDS sequence of the NK4 gene is shown in SEQ ID NO.1. The NK4 protein is the protein encoded by the NK4 gene.

[0012] Preferably, the Rap1 signaling pathway is blocked by inhibiting the expression or function of NK4, thereby inhibiting tumor cell proliferation and inducing apoptosis. The Rap1 includes Rap1A and / or Rap1B.

[0013] Preferably, the B-cell lymphoma includes diffuse large B-cell lymphoma (DLBCL) and B-cell lymphoma associated with Sjögren's syndrome.

[0014] Preferably, for diagnosis, the product includes a reagent kit; for prevention and treatment, the product includes one or more of food, medicine, and health products.

[0015] A second aspect of the invention proposes the use of a substance for inhibiting the expression or function of NK4 in any of the following:

[0016] (1) Prepare products for the treatment of B-cell lymphoma;

[0017] (2) Prepare products for inhibiting the proliferation of B-cell lymphoma cells;

[0018] (3) Prepare products for promoting apoptosis of B-cell lymphoma cells.

[0019] Preferably, the substance used to inhibit the expression or function of NK4 includes one or more of small interfering RNA (shRNA, siRNA), antisense oligonucleotides, CRISPR-Cas system, and NK4-specific antibodies.

[0020] Preferably, the small interfering RNA (shRNA, siRNA) includes shRNA or siRNA that interferes with the expression or function of NK4. The NK4-specific antibody includes monoclonal antibodies, humanized antibodies, or bispecific antibodies.

[0021] Preferably, it also includes a Rap1 inhibitor, wherein the Rap1 inhibitor is selected from: shRNA, siRNA or antisense oligonucleotide, anti-Rap1 antibody or functional blocker.

[0022] A third aspect of the present invention provides a kit for diagnosing B-cell lymphoma, comprising one or more of the following: a specific antibody for recognizing NK4 protein, a nucleic acid detection component (qPCR primers, probes, or sequencing reagents) for detecting NK4 gene expression levels, and a component for detecting changes in Rap1 activity.

[0023] Preferably, the antibody is a monoclonal antibody or a humanized antibody.

[0024] Preferably, the severity of B-cell lymphoma is assessed by detecting the NK4 level in the subject's body fluid sample; if the NK4 level in the subject's body fluid sample is higher than that in the control, the subject may have B-cell lymphoma or be at risk of having B-cell lymphoma.

[0025] A fourth aspect of the present invention provides a drug for the prevention and treatment of B-cell lymphoma, the main components of which include one or more substances for inhibiting the expression or function of NK4 and Rap1 inhibitors.

[0026] Preferably, the method for detecting Rap1 activity includes: enriching GTP-bound Rap1 from cell lysates using a specific antibody against activated Rap1, and performing quantitative analysis by immunoblotting or pull-down assay.

[0027] Preferably, the Rap1 inhibitor includes shRNA, siRNA, or a small molecule inhibitor.

[0028] Preferably, the drug further includes a pharmaceutically acceptable carrier.

[0029] "Pharmaceutical acceptable" means non-toxic materials that do not reduce the activity of the active ingredient. Such pharmaceutically acceptable excipients and carriers are well known in the art (see Remington's Pharmaceutical Sciences, 18th edition, edited by A. Gennaro, Mack Publishing Company (1990) and hand book of Pharmaceutical Excipients, 3rd edition, edited by A. Kibbe, Pharmaceutical Press (2000)).

[0030] Preferably, the carrier includes, but is not limited to, diluents, adhesives, surfactants, humectants, adsorbents, lubricants, fillers, and disintegrants.

[0031] Preferably, the drug is formulated into a pharmaceutically acceptable dosage form.

[0032] Preferably, the dosage form includes, but is not limited to, tablets, capsules, granules, pills, syrups, powders, granules, suppositories, drops, emulsions, injections, solutions, or suspensions.

[0033] A fifth aspect of the present invention provides a method for in vitro screening of candidate drugs for the treatment of B-cell lymphoma, comprising the following steps:

[0034] Provide B cells or B-cell lymphoma cells expressing NK4 and / or Rap1;

[0035] Contact the candidate drug with the cells;

[0036] Changes in Rap1 activity, cell proliferation, or apoptosis levels were detected; if Rap1 activity decreased or cell apoptosis increased, the candidate drug was deemed effective against B-cell lymphoma.

[0037] The present invention also proposes a recombinant expression vector containing a human NK4 coding sequence (SEQ ID NO.1), which can be used to express NK4 in human or animal B cells via viral or non-viral methods.

[0038] A sixth aspect of the present invention provides a method for establishing an in vitro B-cell lymphoma model, comprising the following steps:

[0039] Provide NK4 transgenic mice;

[0040] Isolate B220 from its spleen or lymphatic organs. + CD5 + cell;

[0041] By specifically overexpressing NK4, tumor single-cell clones can be formed, which can serve as a B-cell model of lymphoma.

[0042] The seventh aspect of the present invention provides a method for transplanting NK4-induced B-cell lymphoma cells into SCID mice via subcutaneous or intraperitoneal injection of B220. + CD5 + Cellular induction of a secondary lymphoma model.

[0043] The beneficial effects of this invention are as follows:

[0044] 1. This invention provides a novel mechanism for the development of B-cell lymphoma. The inventors have discovered for the first time that high expression of NK4 in transgenic mice can induce an autoimmune phenotype and spontaneously form B-cell lymphomas in about 20% of aged mice. This process is mediated by the activation of the small GTPase Rap1, thereby affecting cell cycle and apoptosis signaling pathways.

[0045] 2. This invention proposes that NK4 can induce B-cell lymphoma through long-term overexpression in endothelial cells, and that blocking NK4-overexpressing B-cell lymphoma can treat diffuse large B-cell lymphoma (DLBCL) by reducing its proliferation and increasing its apoptosis. This invention is the first to demonstrate that NK4 is highly expressed in B-cell lymphoma and can activate the Rap1 pathway, enhancing the proliferation and invasion of tumor cells, suggesting its potential as a molecular target for intervention.

[0046] 3. In a transgenic mouse model, high expression of NK4 in endothelial cells was observed to induce abnormal proliferation and tumor formation in B220+CD5+ phenotype cells; the lymphoma was histologically consistent with the characteristics of diffuse large B-cell lymphoma (DLBCL).

[0047] 4. NK4 is also highly expressed in human B-cell lymphoma cell lines. Silencing NK4 or its downstream molecule Rap1 can significantly induce tumor cell apoptosis. Transplanting NK4-overexpressing B cells carrying the B-cell lymphoma phenotype into SCID mice can lead to secondary tumor formation, demonstrating its stable heritability. NK4 promotes Rap1 activation by acting as a guanylate exchange factor (GEF) for Rap1, driving B-cell lymphoma progression. Therefore, NK4 and its downstream Rap1 signaling pathway can serve as targets for the diagnosis, treatment, and drug development of B-cell lymphoma. Attached Figure Description

[0048] Figure 1This is an analysis diagram of spontaneous B-cell lymphoma formation in NK4 transgenic mice in Example 1 of the present invention. A is a statistical schematic diagram of mouse lymphoma, B is an anatomical analysis of mice showing lymphoma invasion masses on the surface of the liver of symptomatic mice, C is an immunohistochemical diagram, D is an immunohistochemical result diagram, and E is a diagram confirming that the infiltrating cells are B-cell lymphomas. The left image of E shows tumor cell clones, and the right image of E shows flow cytometry identification of these cell clones.

[0049] Figure 2 In Example 2 of this invention, spleen cells from age / sex-matched WT, lymphoma-free NK4 transgenic mice, and lymphoma-carrying NK4 transgenic mice were compared by flow cytometry. A is a flow cytometry result analysis diagram, B is a statistical diagram of cell proliferation detected by flow cytometry, and C is a diagram of the molecular mechanism detected by Western blot analysis for each group.

[0050] Figure 3 This is a verification diagram of the tumorigenicity of B lymphoma induced by NK4 overexpression in endothelial cells in Example 3 of the present invention. A is a pathological section of the transplanted mouse after cell transplantation, B is the result diagram after B cells from normal mice and lymphoma mice were transplanted into SCID mice, respectively, and C is a flow cytometry analysis diagram.

[0051] Figure 4 This is an analysis diagram in Example 4 of the present invention to verify that NK4 shRNA promotes apoptosis in B lymphoma. In this diagram, A shows the significant increase in NK4 expression in B lymphoma cell lines Ly3 and Ly10, B shows the inhibition of lymphoma functional marker expression by NK4 shRNA, and CE shows the promotion of apoptosis in B lymphoma by NK4 knockdown.

[0052] Figure 5 This is a diagram illustrating how NK4 affects apoptosis in B-cell lymphoma cells via RAP1 in Example 5 of this invention. In diagram A, knocking out Rap1 with shRNA inhibits proliferation signals in human lymphoma cells (DLBCL) Ly3 and Ly10, increasing the apoptosis rate. In diagram B, NK4 inhibits Ly10 cell apoptosis by activating Rap1. Inhibiting Rap1 reverses the apoptosis inhibition caused by NK4 overexpression. In diagram C, NK4 accelerates the DLBCL cell cycle by activating Rap1 (increasing the G1→S phase transition rate by 2.1 times).

[0053] Figure 6 This is an analysis diagram of Rap1 shRNA promoting apoptosis in B lymphoma in Example 5 of the present invention. In this diagram, A shows the reduction of the expression level of functional markers of B lymphoma by Rap1 shRNA, and B shows that the knockdown of Rap1 can promote apoptosis in B lymphoma.

[0054] (In the figure, *P<0.05, **P<0.01, ***P<0.001) Detailed Implementation

[0055] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.

[0056] Unless otherwise specified, the test materials and reagents used in the following examples are commercially available or prepared by known methods.

[0057] Unless otherwise specified, all techniques or conditions described in the embodiments can be performed in accordance with the techniques or conditions described in the literature in this field or in the product manual. Unless otherwise specified, the quantitative experiments in the following embodiments are all repeated three times or more, and the results are averaged.

[0058] This study strictly adhered to animal experimentation ethics requirements: 1) All NK4 transgenic mice with B6 background and wild-type controls were housed in the NCI Frederick SPF animal facility; 2) The feeding protocol was reviewed and approved by the IACUC; 3) Sex- and age-matched mice were used in all experiments.

[0059] Primary cells and cell lines: Human peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors (aged 19-65) at the National Institutes of Health (NIH) Blood Bank. All donors provided informed consent, and the study was approved by the NIH Ethics Committee (IRB No.: NH201812016). PBMCs were isolated using discontinuous Lymphoprep density gradient centrifugation, followed by further purification of human B cells using CD19 monoclonal antibody-conjugated magnetic beads (Miltenyi Biotec, Auburn, CA). Flow cytometry analysis showed B cell purity >97%, meeting the requirements for subsequent experiments. Diffuse large B-cell lymphoma (DLBCL) cell lines (Lymphoma 3 and Lymphoma 10) were provided by Dr. Louis M. Staudt (NCI). All cell lines were validated by short tandem repeat (STR) analysis and regularly tested for mycoplasma contamination.

[0060] Western blot analysis: B cells isolated from human PBMCs or lymphoma cells were transduced with Vector, NK4, or Rap1 shRNA, and total protein was extracted by lysis. NK4 protein expression was detected using a goat anti-NK4 polyclonal antibody (YbdyBiotech, Korea), and Rap1 protein (including Rap1A and Rap1B isoforms) was analyzed by Western blot using a rabbit-derived anti-Rap1A+Rap1b antibody (Abcam, Cambridge, MA). Furthermore, the expression levels of key regulatory proteins (BCL2, Cyclin D, c-Myc, and BCL6) were detected using their respective antibodies (Abcam / Invitrogen, NY).

[0061] Rap1 activity assay: An activity Rap1 assay system based on the GST-RalGDS-RBD pull-down method was used. The simplified procedure is as follows: Magnetic bead pretreatment: Goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA) were washed with lysis buffer and then blocked with 5% skim milk for 15 minutes; Antibody binding: Anti-active Rap1 monoclonal antibody (New East Biosciences, PA) was added and incubated for 30 minutes; Sample incubation: 100 μL of antibody-magnetic bead complex was mixed with 900 μL of lymphoma cell lysis buffer and incubated at 4°C with rotation for 30 minutes; Washing and elution: The magnetic beads were washed twice with lysis buffer (containing GTP / GDP), resuspended in 1×Laemmli buffer containing TCEP, and boiled at 95°C for 5 minutes to dissociate the bound protein; Control settings: Positive control (GTPγS-treated lysis buffer) and negative control (GDP-treated lysis buffer) were performed simultaneously to ensure experimental specificity.

[0062] Histopathological analysis: Mouse liver, lymph nodes, and thymus tissue were fixed in 10% neutral buffered formalin for 24 hours, embedded in paraffin, and sectioned (4 μm). Hematoxylin and eosin (H&E) staining was performed to assess tissue morphology. Immunohistochemical analysis: Samples were fixed in 4% paraformaldehyde, followed by antigen retrieval and blocking. Staining was performed with anti-mouse B220, BCL6, IRF4, and Ki67 antibodies (clone numbers and dilution ratios are provided in the supplementary methods). DAB staining was followed by double-blind evaluation by two pathologists.

[0063] Flow cytometry: Cells were labeled with antibodies against mouse CD19-Pacific Blue, B220-APC, CD5-FITC (BioLegend, San Diego, CA) and IgM-APC-Cy7 (Miltenyi Biotec) and detected by BD LSRII flow cytometer. Data were analyzed using FlowJo v10 software (TreeStar). The gating strategy was referenced to the FMO (fluorescence reduced by one) control.

[0064] Xenograft model: B220+ B cells (purity >95%) were sorted from 18-month-old wild-type (WT) or NK4 transgenic mice using magnetic beads. In the adaptive transfer experiment, 6-8 week old SCID mice (n=8 per group) were subcutaneously injected with 1×10^7 B cells. Tumor formation and survival were monitored weekly. Euthanasia was performed when endpoint events such as weight loss >20%, mobility impairment, or ulceration occurred.

[0065] Statistical analysis: Clinical data: Analysis of variance (ANOVA) was used to compare the differences between patients with Sjögren's syndrome (SS) and healthy controls. Cox proportional hazards model was used to assess the correlation between serum NK4 levels and disease course. Experimental data: Paired Student's t-tests were used for in vivo experiments and in vitro studies in mice. Multiple comparisons were corrected for Bonferroni. Significance threshold: P < 0.05 was considered statistically significant. Data are expressed as mean ± SEM. GraphPad Prism 9.0 was used for plotting.

[0066] Example 1: Spontaneous development of B-cell lymphoma in NK4 transgenic mice

[0067] An NK4 transgenic mouse model was constructed in FVB mice using the CMV promoter to drive NK4 cDNA.

[0068] This invention constructs a transgenic mouse model in which endothelial cells overexpress NK4 (hereinafter referred to as "NK4-Tg mouse"). The specific steps are as follows:

[0069] I. Construction of NK4 transgenic vector

[0070] First, the cDNA sequence of its specific splice variant NK4 was isolated from the IL-32 gene. The NK4 sequence was obtained by synthesis or RT-PCR amplification and cloned into a mammalian high-efficiency expression vector. Preferably, the pCAGGS plasmid vector, containing the PECAM-1 promoter, was used to enhance NK4 overexpression in endothelial cells. A FLAG tag was attached to the end of the NK4 coding sequence for detection. The expression cassette, comprising the promoter, NK4 coding sequence, polyA signal, and necessary restriction enzyme sites, was linearized, purified, and concentrated for microinjection.

[0071] II. Pronuclear microinjection and mouse breeding

[0072] The linearized expression vector was injected into the pronucleus of fertilized eggs from FVB mice at a concentration of 1–5 ng / μl. After in vitro culture to the two-cell stage, the cells were transplanted into pseudopregnant mice. After the pups were born, tail tissue was collected to extract genomic DNA, and PCR screening for positive mice was performed using NK4-specific primers. Positive individuals were further propagated to establish a stable NK4-Tg homozygous population. We have successfully obtained a transgenic mouse model with NK4 overexpression in endothelial cells (Kobayashi et al. 2010).

[0073] Kobayashi H, Huang J, Ye F, Shyr Y, Blackwell TS, Lin PC. Interleukin-32beta propagates vascular inflammation and exacerbates sepsis in a mousemodel. PLoS One. 2010Mar5;5(3):e9458.

[0074] Transgenic mice were fed to 16–22 months of age, and their clinical phenotypes were observed and histological analysis was performed. Approximately 20% (20 / 100) exhibited typical lymphoma-related clinical symptoms (such as...). Figure 1 (As shown in A).

[0075] Anatomical analysis revealed that symptomatic mice had lymphoma-invading masses on the surface of their livers (e.g., Figure 1 (As shown in B).

[0076] Then, immunohistochemical evaluation was performed.

[0077] Immunohistochemistry

[0078] Label the sections with the indicators to be tested, place them in a slide oven at 56℃ for 30 min. Then, dewax the sections by immersing them in xylene I (20 min) → xylene II (20 min). After dewaxing, place the sections sequentially in a gradient of anhydrous ethanol, starting with 100% anhydrous ethanol and decreasing the concentration stepwise: 100% I (10 min) → 100% II (10 min) → 95% (10 min) → 90% (10 min) → 80% (10 min) → 70% (10 min). After rinsing with running water, place them in PBS I (5 min) → PBS II (5 min).

[0079] Set the water bath temperature to 100℃ and place the pre-prepared Tris-EDTA antigen retrieval solution (pH=9.0) into the water bath. Completely immerse the slides to be treated in the EDTA solution, ensuring each slide is fully in contact with the retrieval solution. After 20 minutes, remove the slides from the water bath and allow them to cool naturally to room temperature. Wash three times with PBS for 3 minutes each time. After washing, outline the tissue with an immunohistochemical pen to avoid reagent waste and deviation of experimental results. Add 3% hydrogen peroxide solution and incubate at room temperature for 10 minutes. After incubation, wash three times with PBS for 3 minutes each time, and shake off excess liquid from the slides. Block with 5% bovine serum albumin and incubate at room temperature for 1 hour without washing.

[0080] Primary antibody was used for staining with B220 antibody. After adding the antibody to the slides, the slides were placed in a humidified chamber and incubated overnight at 4°C. The next day, the humidified chamber was removed from the 4°C chamber, and after returning to room temperature, the primary antibody was recovered. The slides were washed three times in PBS for 3 minutes each. Secondary antibody was added, and the slides were incubated at room temperature for 1 hour. The slides were washed three times in PBS for 3 minutes each, the PBS was discarded, DAB chromogenic buffer was added, and the slides were incubated at room temperature for 5–8 minutes (observed under a microscope). The slides were then rinsed with distilled water to stop the DAB chromogenic reaction. Subsequently, hematoxylin staining was performed for 2 minutes, followed by separation with hydrochloric acid differentiation buffer for 3 seconds, rinsing with running water, dehydration, clearing, and mounting.

[0081] Immunohistochemical staining confirmed widespread infiltration of B220+ lymphocytes in the liver, thymus, and lymph nodes. Notably, the lymphoma exhibited a multi-organ distribution (thymus / lymph nodes / liver) (e.g., Figure 1 (As shown in C).

[0082] Immunohistochemical analysis revealed that these lymphomas exhibited typical characteristics of diffuse large B-cell lymphoma (DLBCL): high expression of BCL6, BCL2, and the proliferation marker Ki67 (***P<0.001 vs. WT), suggesting their high malignant potential (e.g., Figure 1(As shown in D). Furthermore, to verify the stability of tumor cells, we isolated B220+ cells from lymphoma mice (18-22 months old) and cultured them in IMDM medium containing 20% ​​FBS and 0.01% 2-mercaptoethanol. After 15 days, suspension cell colony formation was observed, and flow cytometry showed that 65-70% of the cells exhibited the B220+CD5+ phenotype (e.g., ...). Figure 1 (As shown in E).

[0083] Example 2: Phenotypic and molecular characteristics of B-cell lymphoma in NK4 transgenic mice

[0084] Spleen cells from age / sex-matched WT mice, lymphoma-free NK4 transgenic mice, and lymphoma-positive NK4 transgenic mice were compared by flow cytometry. Cells were labeled with anti-mouse CD19-Pacific Blue, B220-APC, and CD5-FITC (BioLegend, San Diego, CA) antibodies, then washed twice with an appropriate volume of PBS; diluted secondary antibody was added, and the cells were incubated at room temperature for 30 min; followed by two washes with PBS. Data were analyzed using a BD LSRII flow cytometer and FlowJo v10 software (TreeStar).

[0085] The results showed that the proportion of B220+IgM+CD5+ cells was significantly increased in the lymphoma group (>50% vs. WT<10%, P<0.001), indicating that it originated from mature B cells (e.g., Figure 2 (As shown in A).

[0086] To assess in vivo proliferative activity, the marker rate of B cells in lymph nodes was analyzed after intraperitoneal injection of BrdU in mice.

[0087] The results showed that B cell proliferation was significantly increased in lymphoma-free NK4 transgenic mice (P<0.01 vs. WT), while it was further increased in the lymphoma group (**P<0.001), confirming that NK4 overexpression directly promotes excessive B cell proliferation (e.g., ...). Figure 2 (As shown in B).

[0088] The specific methods we used to study the molecular mechanisms using Western blotting are as follows:

[0089] Protein extraction from 1 sample

[0090] (1) Tissue weighing and homogenization: 100 mg of tissue was placed in each EP tube, and 1 mL of protein lysis buffer (RIPA: PMSF was prepared at a ratio of 100:1) was added to homogenize the tissue;

[0091] (2) Pyrolysis: Pyrolysis at 4℃ for 30 min;

[0092] (3) Centrifugation: Transfer the EP tube into a 4℃ centrifuge and centrifuge at 12000g for 10 minutes. Use a pipette to carefully aspirate a layer of liquid, and try not to aspirate the next layer of precipitate.

[0093] 2. SDS-PAGE electrophoresis

[0094] (1) Sample preparation: Adjust the sample loading amount for each well according to the sample concentration to ensure that the sample loading amount for each well is consistent. Add 1 / 3 volume of 4× protein sample buffer to the test tube containing the protein sample and mix well. Then place it in a metal bath at 100℃ for 10 min. After removing it, cool it to room temperature for further experiments or store it at -20℃.

[0095] (2) Gel preparation: According to the instructions, mix a certain volume of separating gel preparation reagent according to the required separating gel concentration, and quickly pour the gel. Add ddH2O to the top layer and press the gel surface flat. Remove ddH2O after 30 minutes. Quickly fill the remaining space with the prepared stacking gel after mixing a certain volume of stacking gel preparation reagent, and insert the comb.

[0096] (3) Electrophoresis: Place the electrophoresis stand in the electrophoresis tank, add an appropriate amount of electrophoresis buffer, gently pull out the gel comb, remove the gel strands from the sample wells with a syringe, and add the samples to the sample wells in the experimental order. Connect the power supply. The DC voltage for concentrated gel electrophoresis is 80V, and the time is 30min. The DC voltage for separating gel electrophoresis is 120V, and the time is 60min to 90min. Adjust the separating gel electrophoresis time according to the experimental requirements. The entire electrophoresis process should be performed on ice.

[0097] 3. Transfer membrane

[0098] (1) After activating the PVDF membrane with methanol for 2 minutes, quickly place it into a container containing the electro-conversion solution;

[0099] (2) Completely immerse the transfer sponge and filter paper in the electroporation solution and place them in the correct order. At the same time, be sure to remove air bubbles from each layer during the process.

[0100] (3) 400mA constant current for 30min.

[0101] 4. Enclosed

[0102] Pre-dissolve skim milk powder in TBST solution and mix thoroughly to complete the preparation. After transfer, block with the prepared blocking buffer (5% skim milk powder) at room temperature for 2 hours. Completely immerse the PVDF membrane in the blocking buffer, ensuring the blocking buffer completely covers the membrane surface. Blocking at room temperature for 2 hours is usually sufficient to allow the blocking buffer to fully incubate. 5. Antibody Incubation

[0103] (1) After sealing, remove the sealing solution and wash with TBST 3 times, 10 min each time;

[0104] (2) Add primary antibody and incubate overnight at 4°C. The volume of antibody must completely cover the PVDF membrane.

[0105] (3) On the second day, the antibody incubation box was taken out from 4°C and allowed to warm up at room temperature for 30 minutes. Then, an appropriate volume of TBST was added to the antibody incubation box and washed 3 times for 10 minutes each time.

[0106] (4) Add diluted secondary antibody and incubate at room temperature for 60 min;

[0107] (5) Wash with TBST 3 times, 10 min each time.

[0108] 6. Chemiluminescence detection

[0109] (1) Prepare ECL mixture using a high-sensitivity ECL chemiluminescence kit;

[0110] (2) Drop ECL mixture onto one side of the membrane protein surface;

[0111] (3) Expose the sample in the dark, then develop and fix it, and finally save the results and use ImageJ software for data analysis.

[0112] Molecular mechanism studies have shown that NK4 drives excessive B cell proliferation by upregulating the cell cycle regulator Cyclin D and the anti-apoptotic protein BCL2 (e.g., ...). Figure 2 (As shown in C). It is noteworthy that the lymphoma-specific marker BCL6 was highly expressed only in the lymphoma group (negative in both WT and disease-free NK4 transgenic mice), suggesting that high expression of NK4 may induce genetic mutations in B cells, ultimately leading to malignant transformation.

[0113] Example 3: Validation of the tumorigenicity of NK4 transgenic B lymphoma cells

[0114] To determine the tumorigenic capacity of transplanted tumor cells, B220+ lymphoma-derived cells (5 × 10^6 / mouse) were injected into SCID mice (n = 10). Forty days later, all recipient mice showed multi-organ (lymph node / liver) tumor infiltration (e.g., Figure 3 (As shown in Figure A). When B cells from normal mice and lymphoma mice were transplanted into SCID mice, the B cell transplantation from the lymphoma mice induced lymphoma development in all SCID mice, while WT B cells did not induce B-cell lymphoma in SCID mice (as shown in Figure A). Figure 3 (As shown in Figure B). Flow cytometry analysis showed that the metastatic tumor cells maintained the B220+CD5+IgM+ phenotype, consistent with the parental lymphoma, and possessed continuous proliferative capacity (e.g., ...). Figure 3(As shown in C). In the control experiment, only a small number of lymph node B cells (approximately 10%) were observed in the WT B cell transplantation group, confirming that NK4-driven lymphoma has a stable and heritable malignant phenotype.

[0115] Example 4: NK4 shRNA promotes apoptosis in B-cell lymphoma.

[0116] To investigate the role of NK4 in human B-cell lymphoma, we first detected NK4 expression in the DLBCL cell line using Western blotting. Compared with healthy B cells, NK4 expression was significantly increased in B-cell lymphoma cell lines, Ly3, and Ly10, and NK4 overexpression in lymphoma appeared to be associated with proliferation signaling pathways, suggesting that NK4 overexpression in B-cell lymphoma reflects disease activity (e.g., proliferation signaling pathways). Figure 4 (As shown in A).

[0117] Since lymphomas overexpress NK4, we then investigated whether NK4 can act as a growth factor in lymphoma. When NK4 expression in B lymphomas was blocked with NK4 shRNA, some proliferation signaling pathways were blocked, and the expression of lymphoma functional markers was reduced (e.g., Figure 4 (As shown in Figure B). Furthermore, there was a significant difference in cell numbers between the empty vector treatment group and the NK4 knockdown group, suggesting that NK4 may influence the status of B-lymphoma. Our results indicate that, compared with the empty vector group, NK4 knockdown in B-lymphoma promotes apoptosis in B-lymphoma (as shown in Figure B). Figure 4 (as shown in CE).

[0118] Example 5: Rap1 shRNA promotes apoptosis in B-cell lymphoma.

[0119] We used shRNA to knock out Rap1, as follows:

[0120] (1) Cell seeding (taking a 6-well plate transfection as an example)

[0121] Before transfection, observe the cell density and growth status under a microscope. Digest with trypsin, centrifuge, and then inoculate into 6-well plates at a cell density of 150,000 ± 5,000 cells (ensuring that the cell density reaches 50%–70% at the time of transfection). Incubate at 37°C and 5% CO2 for 24 hours. The optimal transfection state is achieved when the cell density reaches 60%–80%.

[0122] (2) Preparation of transfection complex

[0123] After centrifugation, remove the Oligo RNA and add 125 μL of DEPCH2O to resuspend it. Gently mix to ensure that the 1 OD sh-RNA is fully dissolved into a 20 μm sample. Prepare two 1.5 mL sterile centrifuge tubes, one for each mixture. In the first tube, add 200 μL of OPTI-MEM and 6 μL of transfection reagent, gently mix with a pipette, and incubate at room temperature for 5 min. In the second tube, add 200 μL of OPTI-MEM and 7.5 μL of Oligo RNA, gently mix with a pipette, and incubate at room temperature for 5 min. These two steps are to allow the transfection reagent and RNA to bind fully and form a stable complex. Finally, add the GP-transfect-Mate medium mixture to the RNAoligo / DNA medium mixture, mix thoroughly, and incubate at room temperature for 15–20 min to further stabilize the complex. After incubation, immediately perform transfection by adding the complex into the cells.

[0124] (3) Transfection

[0125] During the cell incubation process, 1.6 mL of OPTI-MEM medium at room temperature was added to each well of a 6-well plate. Then, 400 μL of the incubated transfection complex was added to each well, bringing the final volume to 2 mL. After adding the complex, the plate was gently agitated to ensure even distribution. The plates were then incubated for 4–6 hours, after which the medium was replaced with complete medium. Protein knockdown levels were assessed using Western blotting after 48–96 hours.

[0126] Rap1, a small GTPase of the Ras family, plays a crucial role in lymphoma migration. We found that knocking out Rap1 with shRNA blocked lymphoma proliferation signaling and increased apoptosis rate (e.g., Figure 5 (As shown in A)

[0127] Cell apoptosis was detected by flow cytometry.

[0128] (1) Take cells in the logarithmic growth phase, digest the cells with trypsin without EDTA, and prepare a single-cell suspension. Carefully aspirate the supernatant, add 1 mL of pre-cooled PBS at 4℃, resuspend the cells, centrifuge again to precipitate the cells, and aspirate the supernatant.

[0129] (2) Dilute the binding buffer with deionized water at a ratio of 1:3, then resuspend the cells in 1× binding buffer to adjust the concentration to 1×10⁻⁶. 6 ~5×10 6 / mL.

[0130] (3) Take 100 μL of cell suspension and put it into a 5 mL flow cytometer tube, then add 5 μL of Annexin V / PE reagent and mix thoroughly. Then, incubate the mixture at room temperature in the dark for 5 min.

[0131] (4) Add 10 μL of 7AAD (20 μg / mL), then immediately add 400 μL of PBS and perform flow cytometry detection.

[0132] Further flow cytometry analysis of the cell cycle revealed that NK4 inhibits Ly10 cell apoptosis by activating Rap1, and inhibition of Rap1 reverses the apoptosis inhibition induced by NK4 overexpression (e.g., Figure 5 As shown in Figure B), and accelerated cell cycle progression (G1→S phase transition rate increased by 2.1-fold, ***P<0.001, as shown in Figure B). Figure 5 (As shown in C).

[0133] When Rap1 expression in B-cell lymphoma is blocked using Rap1 shRNA, some proliferation signaling pathways are disrupted, and the expression levels of functional markers of B-cell lymphoma are reduced (e.g., Figure 6 (As shown in Figure A). Furthermore, there was a significant difference in cell numbers between the empty vector treatment group and the NK4 knockdown group, indicating that Rap1 knockdown can induce apoptosis in B-lymphomas. Our results suggest that, compared to the empty vector group, Rap1 knockdown in B-lymphomas promotes apoptosis (as shown in Figure A). Figure 6 (As shown in B).

[0134] IL-32β(NK4) CDS sequence (SEQ ID NO.1):

[0135] AGAGACTCCCACCCCAGCTCAGAGGGAGCAGGGGCCCAGCCAGGGACGGAC

[0136] CCTCATTCCTCCCAGGGAC

[0137] CCCAGACCTCTGTCTCTCTCGGGTAAGTCTCCATCTCTGTCTGTCTCTGTCTCT

[0138] GTCTCTGTCTCTGTCT

[0139] GTTTTTCACGCACTCAGCAAGGCCTCCTGCCCTGAGAGAGGCTCCGCCCACT

[0140] ACCCCCCACTTTCCCCAT

[0141] AAAACCAGCTGAGTATTTGTGCCAGGAAGACTGCGTGCAGAAGGTGACTGTC

[0142] TCAGTGGAGCTGGGTCAT

[0143] CTCAGGTGGGGAGTTGGGGTCCCCGAAGGTGAGGACCCTCTGGGGAGGAGG

[0144] GTGCTTCTCTGAGACACTT

[0145] TCTTTTCCTCACACCTGTTCCTCGCCAGCAGGCCTTGGCTCCTTGAACTTTTG

[0146] GCCGCCATGTGCTTCCC

[0147] GAAGGTGAGTGAGAGGCTGCGTGTGCTTTTGTGGGCATGTCTGAAAACAGAC

[0148] CGTAAGGGTGCGGGTGCC

[0149] CTCAGTATTTCCCGAGGTGCCTGTGTGTCAGGGCTCAGTCAGGGGCACCCAG

[0150] CGGCAGGAGGATAGTGAT

[0151] GGGGTGAGAGTGTCAGTGGAGGCGCTGGAGGTCATATGTGTCGGGGGCGCT

[0152] GGAGAACGGCAGGGGTGTG

[0153] GATGAGAGGGAGCACCTGTCCCAGGAGCCCTTCACAGCCCGGAAAGCCCGG

[0154] GGCAGGGGTGGGGCAGGGC

[0155] TCTGCTGGAAACGACTCGGAGAATGCTTCTCTCAGAGGCCGGCTCAGCTGGG

[0156] TGGGCCCAAGAGCAAGGC

[0157] CTGTGTGGGTCCTGGTGTCTCTTCCTCCTTTCCTGGGTTCCCTCCGACCTCCCA

[0158] TCCTCTACCACTGCCC

[0159] CACCGCAAATGCTAGGCCCACCACACCCTCCAGGGAGCTCTTCGGCCTGTGA

[0160] CAATAGGGGTTTCCATGA

[0161] TGTGGCCTGGCTCAGGTTCAGGACAGTGACCCGGAGGACACATGGCTCCCGC

[0162] ATGTCGGCACGGTGCTGC

[0163] TTTCACCCTGGTTCCTGGGAAATCAGGCTAGCGGGATGGGACCATCGCTGCC

[0164] TGAAAGTGTGCAGACAGC

[0165] TGCCCTGCCCAGAATATGTCCCCAGGCCCTGCGCACTCTGTGGGTGACTGTC

[0166] ACCACTCTATAGTGGGGG

[0167] AAACCAGGCATGTCACCCCCGAGACTAGGCCCTTGACGTGGGGGCTCAGCG

[0168] GGGATTCTGTGGGGTGCCT

[0169] CTGGCCTCTGTGGATGCAGCCACGTGTCTGCAGGCAGGAATGGCCCGGGACC

[0170] TGTGGGTCTGCATGTTGG

[0171] CAGTCGGGAAGAGTGGCAGGTTGTAGGGTGGACCTACCTGGCACCCCAAAT

[0172] ATTAATCAGCTCATCAGAG

[0173] AGGAATGGCTGCTGTTACCTTCTCAATTGTCATGTCCCTAAACATTTTTTCCT

[0174] TGGCCAACTCTCACCTG

[0175] GGACCATAGTGGTTGTGGGAAACCCAGCTGAGCCAGCCTGCTCCAGGACAGT

[0176] GTCCATCCTCCCGTGTGT

[0177] GTACATGGGGGGGTGTGTGTGTGCAGGGAGGACACCCCGGCCCACGCAGGC

[0178] CCTGCTCTTGTGAGGAGGG

[0179] GTCACCTAGGCCCACGCAGGCCCTGCTCTTGTGAGGAGGGGTCACCTAGGCC

[0180] CACGCAGGCCCTGCTCTT

[0181] GTGAGGAGGGGTCACCTAGGCCCACGCAGGCCCTGCTCTTGTGAGGAGGGG

[0182] TCACCTAGGCCCACGCAGG

[0183] CCCTGCTCTTGTGAGGAGGGGTCACCTAGGCCCATGCTGGCCCTGCTCTTGG

[0184] GCCTGCCCAGCTGAGCCG

[0185] GCTCCTGAGAGAAGCGCTTTCTGAGTCGTTTCGAGGACAGCCCTGGCCGGTC

[0186] TTTCCAGGCTGTGAGGGG

[0187] CTCCTGGGACTGCTGTCTCCTCTTATCCTGTACCTCTGCCATGTGTCTCTGTGT

[0188] GTGTGTGTGTGTGTGT

[0189] GTGTGTGTGTGTGTGTGTATAAATTATCCTGGAGGAAAGGTTAAGGTGACAC

[0190] ATGGAGACTGAGTGTCAC

[0191] CGTTATTTCCGCAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAAT

[0192] GGTAATGCTCCTCCCTAC

[0193] TTCTGCTCAGGGGTTGGGGGCCTGGGTCTCAGCGTGTGACACTGAGGACACT

[0194] GTGGGACACCTGGGACCC

[0195] TGGAGGGACAAGGATCCGGCCCTTTGGTGCCAACTCTGCCTCTCTTCACAGC

[0196] ACCAGGCCATAGAAAGAT

[0197] TTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGGGTGGAT

[0198] TTCCCCTCAGGCACCAGGT

[0199] CACATGTCCCCGCCCCCAGGCACTCCACCCTGTGTGGGGCTCAGGGTGAGAA

[0200] GGATGAAGAGGGACCCAC

[0201] AGGCTCCCTCACCCCTTACCGTGGGCAAATGCTTGCACCTGGGTGGCAGTGA

[0202] GTGGGCGGGTGGGGGATC

[0203] TGGACGCCCGGGGAGACTGAGGGAGGCATCCAAGCCCCAGGGCTCCTTGAG

[0204] GAAACAACAGGGGTGCCAG

[0205] ACGTGGCCCGGGCCCCTGGCTGGGCCCAGTTCGGGGTGTGTGGGAGCTGAGG

[0206] ACTCACTGGGCTTGAGGA

[0207] CTGACTGATGTGGGGTGCAGAGGAGGCTTGGGCCTGGAACCGAGTGCTTTGT

[0208] TCCTAACAGGTGATGTCG

[0209] AGCCTGGCAGAGCTGGAGGTGAGCCGTGGCCTCCCCCTCCACCAAGCTTAGT

[0210] CCCTGGGTCTTAGGCTCC

[0211] ACAGGACACTGGGTCTGGGCCCCGGGTCCCCTTGGGAATCACCTGGACCAGT

[0212] GGGGGCCACAGTGGGAAG

[0213] GGGGCAGGCAGGAGCAGCATGAACCCCCTGTGCCCTCCTCTCCCCAGGACGA

[0214] CTTCAAAGAGGGCTACCT

[0215] GGAGACAGTGGCGGCTTATTATGAGGAGCAGCACCCAGTGAGTATGACACA

[0216] CCCATCTGGGCACCTTGCC

[0217] TTCCTTCACCTCTGCCCTGTCTTTTCTTTCTTTCTTTCTTTTTGTTTATTTGAGA

[0218] CAGAGTCTCGCTCTG

[0219] TCGCCCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCCAAA

[0220] TCTCGGGTTTAAGTGATT

[0221] CTCCTGCCTCAGCCTGACAAGTAGTTGGGACTACAGGCACCCGCCACCACTC

[0222] CAGGCTGATTTTTTTTGT

[0223] GTGTGTTTTTAGTAGAGACCAGGTTTCACCATGTTTGCCAGGCTGGTCTTGAA

[0224] CTCCTAACCTTGTGTTC

[0225] CGTCTGCCTTGGCCTCCCAAAGTGCTGAGATTACAGGCATGAGCCACCGGGC

[0226] CCAGCCAACCCCTGCCCT

[0227] GTCTTGATGTGGTGTGGGCAGGGTGTGCCCAGCCCCTGAGCTTGGGGTGGAG

[0228] GGCTGGGAGTGACAGCCT

[0229] AGCTGGGACCTGCCCATGGCCTCACTCCTCACACAGTGGCACAGCCCTCAAG

[0230] GCACGATGAGGGCCCTGA

[0231] CCTGGTGACCAAGCAGACACACCCATCCTGTCACTGCCATGGAGGTGAATGC

[0232] AGAGGAGGGGGACTCTGG

[0233] GAAAAGTCCCTCTTGCCCACGGGGCTGTGGTTGGGAAACCAACACCTGTGGG

[0234] CCTCCGTCTCCCAGGGTC

[0235] AGGAAAAGGCTGAGAGGCCTGGGTGTGGCCAGGGCCTGGGGCTGACACCCC

[0236] CACCTACAGACCCTGAATG

[0237] GTGCTCCCATTCCACAGGAGCTCACTCCTCTACTTGAAAAAAAAAGAGATGG

[0238] ATTACGGTGCCGAGGCAA

[0239] CAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCTGGGGAG

[0240] AGCTTTTGTGACAAGGTC

[0241] ATGAGATGGTCCAGGCCATGCTGCAGCGGCTGCAGACCTGGTGGCACGGG

[0242] GTTCTGGCCTGGGTGAAGG

[0243] AGAAGGTGGTGGCCCTGGTCCATGCAGTGCAGGCCCTCTGGAAACAGTTCCA

[0244] GAGTTTCTGCTGCTCTCTCT

[0245] GTCAGAGCTCTTCATGTCCTCTTTCCAGTCCTACGGAGCCCCACGGGGGGAC

[0246] AAGGAGGAGCTGACACCC

[0247] CAGAAGTGCTCTGAACCCCAATCCTCAAAATGAAGATACTGACACCACCTTT

[0248] GCCCTCCCCGTCACCGCG

[0249] CACCCACCCTGACCCCTCCCTCAGCTGTCCTGTGCCCCGCCCTCTCCCCGCACA

[0250] CTCAGTCCCCTGCCTG

[0251] GCGTTCCTGCCGCAGCTCTGACCTGGTGCTGTCGCCCTGGCATCTTAATAAAACCTGCTTATACTTCC

[0252] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of NK4 as a target in the preparation of products for the diagnosis or prevention of B-cell lymphoma, characterized in that, The NK4 includes the NK4 gene and the NK4 protein, and the CDS sequence of the NK4 gene is shown in SEQ ID NO.

1.

2. The use of substances that inhibit the expression or function of NK4 in any of the following: (1) Prepare products for the treatment of B-cell lymphoma; (2) Prepare products for inhibiting the proliferation of B-cell lymphoma cells; (3) Prepare products for promoting apoptosis of B-cell lymphoma cells.

3. The application according to claim 2, characterized in that, The substances used to inhibit the expression or function of NK4 include one or more of small interfering RNA (shRNA, siRNA), antisense oligonucleotides, CRISPR-Cas systems, and NK4-specific antibodies.

4. A kit for diagnosing B-cell lymphoma, characterized in that, It includes one or more of the following: a specific antibody for recognizing the NK4 protein, a nucleic acid detection component for detecting the expression level of the NK4 gene, and a component for detecting changes in Rap1 activity.

5. The reagent kit according to claim 4, characterized in that, The severity of B-cell lymphoma is assessed by detecting the NK4 level in the body fluid sample of the subject; if the NK4 level in the subject's body fluid sample is higher than that in the control, the subject may have B-cell lymphoma or be at risk of having B-cell lymphoma.

6. A drug for the prevention and treatment of B-cell lymphoma, characterized in that, Its main components include substances that inhibit the expression or function of NK4, and one or more Rap1 inhibitors.

7. The drug according to claim 6, characterized in that, The drug also includes a pharmaceutically acceptable carrier.

8. A method for in vitro screening of candidate drugs for the treatment of B-cell lymphoma, characterized in that, Includes the following steps: Provide B cells or B-cell lymphoma cells expressing NK4 and / or Rap1; Contact the candidate drug with the cells; Changes in Rap1 activity, cell proliferation, or apoptosis levels were detected; if Rap1 activity decreased or cell apoptosis increased, the candidate drug was deemed effective against B-cell lymphoma.

9. A method for establishing an in vitro B-cell lymphoma model, characterized in that, Includes the following steps: Provide NK4 transgenic mice; Isolate B220 from its spleen or lymphatic organs. + CD5 + cell; This process induces specific overexpression of NK4, forming tumor single-cell clones, which serve as a B-cell model of lymphoma.

10. A method for transplanting NK4-induced B-cell lymphoma cells into SCID mice, characterized in that, B220 can be administered subcutaneously or intraperitoneally. + CD5 + Cellular induction of a secondary lymphoma model.

Images