Specific primer pair and qPCR (quantitative polymerase chain reaction) quantitative detection method for acetic bacteria in table vinegar

By designing specific primer pairs and a complex enzymatic hydrolysis system, the problems of long detection cycles and low sensitivity of acetic acid bacteria in vinegar have been solved, achieving highly specific and sensitive quantitative detection, which is suitable for the fermentation control of vinegar.

CN120945083APending Publication Date: 2025-11-14ZHONGBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511183685.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-22
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing methods for detecting acetic acid bacteria in vinegar are time-consuming, have low sensitivity, and use universal primers that are prone to false positives. Furthermore, cell walls are difficult to break, and high acidity inhibits PCR amplification, which fails to meet the requirements for rapid and highly sensitive detection.

Method used

By designing specific primer pairs (groEL gene target sequence) combined with a complex enzymatic digestion system (cellulase, lysozyme, proteinase K) and acid inhibition neutralization technology (PBS buffer), highly specific quantitative detection of acetic acid bacteria can be achieved.

Benefits of technology

It achieves highly specific quantitative detection of acetic acid bacteria, with DNA extraction rate increased to 85%, sensitivity significantly improved, and specificity reaching 95%, making it suitable for the fermentation control of vinegar.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945083A_ABST
    Figure CN120945083A_ABST
Patent Text Reader

Abstract

The invention discloses a specific primer pair and a qPCR quantitative detection method for acetic acid bacteria in table vinegar, and particularly relates to the technical field of quantitative detection of acetic acid bacteria in table vinegar. The specific primer pair is designed by using a groEL gene as a target sequence and comprises a forward primer F and a reverse primer R, the sequence of the forward primer F is shown as SEQ ID No: 1, and the sequence of the reverse primer R is shown as SEQ ID No: 2. According to the qPCR quantitative detection method, accurate and rapid quantitative measurement of the concentration of acetic bacteria is realized through specific primer amplification, so that technicians can conveniently control the fermentation efficiency and the fermentation flavor of table vinegar.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of quantitative detection technology of acetic acid bacteria in vinegar, and in particular to a specific primer pair and a qPCR quantitative detection method for acetic acid bacteria in vinegar. Background Technology

[0002] Acetic acid bacteria are the core functional microbial community in fermented foods such as vinegar and enzyme beverages, and their viable cell count directly affects the product's flavor quality and fermentation efficiency. Traditional detection relies on plate culture methods, which have drawbacks such as long processing times (5-7 days) and low sensitivity (detection limit > 10). 4 The limitations of (CFU / mL) make it impossible to meet the real-time quality control requirements of the modern food industry.

[0003] Therefore, technicians have applied PCR technology to microbial detection to achieve the requirements of speed and high sensitivity. However, currently available universal primers are highly conserved among closely related bacteria, easily causing cross-reactions with lactic acid bacteria and Staphylococcus aureus, leading to false positives, such as the common 16S rRNA. Meanwhile, because the cell wall of acetic acid bacteria contains a thick layer of peptidoglycan and cellulose membrane, conventional lysozyme treatment cannot effectively release DNA, resulting in a detection rate of less than 50%. Furthermore, the high acidity and polyphenolic substances in vinegar samples strongly inhibit PCR amplification, requiring complex pretreatment, which reduces detection sensitivity.

[0004] Therefore, technicians urgently need to design a specific primer and an efficient quantitative detection method for acetic acid bacteria to detect the number of bacteria in order to control product flavor and fermentation efficiency. Summary of the Invention

[0005] This invention provides a specific primer pair and a qPCR quantitative detection method for acetic acid bacteria in vinegar. This qPCR quantitative detection method achieves accurate and rapid quantitative measurement of acetic acid bacteria concentration through specific primer amplification, so as to facilitate technicians to control the fermentation efficiency and fermentation flavor of vinegar.

[0006] The objective of this invention is achieved through the following technical solution: A specific primer pair for detecting acetic acid bacteria in vinegar, the specific primer pair being designed using the groEL gene as the target sequence, includes a forward primer F and a reverse primer R, the sequence of the forward primer F being shown in SEQ ID No: 1, and the sequence of the reverse primer R being shown in SEQ ID No: 2.

[0007] Among them, SEQ ID No: 1 CGCCGATGAAGTTGTAAAACC; SEQ ID No: 2TCGTTTCCGCTTGGTGAT.

[0008] This invention provides applications of the above-mentioned specific primer pairs, the applications of which include the following (1) or (2): (1) Used for the specific detection of Acetobacter spp. and Gluconobacter spp. in the matrix; (2) Prepare a kit for detecting Acetobacter spp. and Gluconobacter spp.

[0009] Preferably, in (1), the Acetobacter genus includes Pasteurella, Acetobacter stenosis and Acetobacter fructus.

[0010] Preferably, in (1), the genus *Acetobacter* includes *Hansorius kosher*.

[0011] This invention also provides a qPCR quantitative detection method for acetic acid bacteria in vinegar, which includes the following steps: S01. Sample Pretreatment: Take a quantitative sample solution, centrifuge, and obtain precipitated bacterial cells and supernatant; wash the precipitated bacterial cells with PBS buffer at pH 7 to obtain crude extract. The purpose of this step is to precipitate bacterial cells and remove acetic acid inhibitors.

[0012] S02. Breaking the cell wall of acetic acid bacteria: Resuspend the crude extract in TE buffer, then add cellulase, lysozyme, and proteinase K in sequence. After inactivation, obtain a suspension and cool it on ice. The purpose of this step is to destroy the peptidoglycan layer of acetic acid bacteria.

[0013] S03. DNA Extraction and Purification: Add cell disruption buffer and binding buffer to the suspension, incubate at 70°C, and vortex to mix; add ethanol, mix, transfer to an adsorption column and centrifuge; add buffer GD, wash buffer and buffer EB to the adsorption column in sequence to obtain DNA extract. S04, qPCR detection: Take 2× premixed real-time PCR reagent, forward primer F and reverse primer R as described in claim 1, DNA extraction solution, and ddH2O, vortex to homogenize, and obtain the premixed solution; after analysis and calculation of the premixed solution, the bacterial concentration of the original sample solution is obtained.

[0014] Preferably, in step S02, the TE buffer is a mixture of 10 mM Tris-HCl and 1 mM EDTA.

[0015] Preferably, in step S02, the concentration of cellulase is 1 U / μL, the concentration of lysozyme is 20 mg / mL, and the concentration of proteinase K is 0.1 mg / mL.

[0016] Preferably, in step S03, the cell disruption solution is prepared by mixing the following reagents: Tris-HCl, EDTA, lysozyme, proteinase K, and Tween 20.

[0017] Preferably, in step S02 and step S04, the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 60℃ annealing for 30 s; 60℃ extension for 30 s; a total of 40 cycles; melting curve at 60℃-95℃, 0.5℃ / s, continuously collected for a total of 1 cycle.

[0018] Compared with the prior art, the advantages or beneficial effects of the technical solution of this application include: 1. High-specificity quantitative detection: By screening conserved segments of Acetobacter spp. (such as SEQ ID NO:1 / 2), it can accurately identify Acetobacter spp. and Gluconobacter spp., with no cross-reaction with lactic acid bacteria, yeast and other miscellaneous bacteria (specificity > 95%).

[0019] 2. Compound enzymatic hydrolysis system: In the corresponding detection method, a stepwise treatment of lysozyme + proteinase K + cellulase is adopted, which solves the problem of difficult cell wall disruption of acetic acid bacteria and can increase the DNA extraction rate to >85%.

[0020] 3. Acid inhibition neutralization technique: Adding PBS buffer to the DNA binding buffer for washing directly neutralizes the acidity of acetic acid and adsorbs polyphenols, without the need for sample dilution, which can significantly improve sensitivity. Attached Figure Description

[0021] Figure 1 Statistical chart of melting curve analysis results; Figure 2 A statistical chart of DNA yield; Figure 3 This is a statistical chart of qPCR test results. Detailed Implementation

[0022] The following detailed description of the embodiments of this application, in conjunction with the accompanying drawings, will provide a thorough understanding of how this application uses technical means to solve technical problems and achieve corresponding technical effects, enabling its implementation. The embodiments of this application and the various features within them can be combined with each other without conflict, and all resulting technical solutions are within the protection scope of this application.

[0023] It should be clearly stated that the embodiments described below are merely some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without inventive effort are within the scope of protection of this application.

[0024] Example 1: This example provides a detailed description of the qPCR quantitative detection method for acetic acid bacteria in vinegar. A qPCR quantitative detection method for acetic acid bacteria in vinegar, comprising the following steps: S01. Sample pretreatment: Take 10 ml of quantitative sample solution, centrifuge at 8000 g for 10 min to obtain precipitated bacterial cells and supernatant; wash the precipitated bacterial cells with PBS buffer at pH 7 to obtain crude extract; S02. Disruption of acetic acid bacteria cell walls: Resuspend the crude extract in 200 ml of TE buffer, then add 1 U / μL cellulase sequentially, incubate at 40°C for 30 min, add 20 mg / ml lysozyme, incubate at 37°C for 60 min, add 0.1 mg / ml proteinase K, incubate at 55°C for 30 min, and inactivate at 95°C for 10 min. The resulting suspension is then cooled on ice. The TE buffer is a mixture of 10 mM Tris-HCl and 1 mM EDTA.

[0025] S03. DNA Extraction and Purification: Add 200 μL of cell disruption buffer and 200 μL of binding buffer to the suspension, incubate at 70 °C for 10 min, and vortex to mix. Add 400 μL of ethanol, mix well, transfer to an adsorption column, and centrifuge at 1200 g for 30 s. Add 500 μL of buffer GD, 600 μL of wash buffer, and 50 μL of buffer EB (to elute DNA) to the adsorption column in sequence to obtain DNA extract. DNA concentration > 10 ng / μL.

[0026] S04, qPCR detection: Take 10 μL of 2× premixed real-time PCR reagent, 10 μL each of forward primer F and reverse primer R, 2 μL of DNA extraction solution, and 7 μL of ddH2O. Vortex to obtain the premixed solution. After analysis and calculation of the premixed solution, the bacterial concentration of the original sample solution is obtained.

[0027] Conversion of stock solution bacterial concentration: stock solution bacterial concentration =

[0028] C DNA DNA copy number (copies / μL) calculated by qPCR; V elution: DNA elution volume (μL, typically 50μL); V template: The volume of DNA template added for qPCR (μL, usually 2μL); D: Sample dilution factor (e.g., if the sample is diluted 10 times before centrifugation, then D=10).

[0029] Example 2: Primer Specificity Verification Objective: To verify the specificity of primers for Acetic Acid Bacteria and exclude interference from closely related bacteria.

[0030] Methods: Strain selection: Target bacteria: Acetobacter pasteurellii CICC 20001, Acetobacter xylosiderin ATCC 53524 Interfering bacteria: *Glucosobacterium oxygenase*, *Lactobacillus plantarum* CGMCC 1.557 DNA extraction: DNA was extracted from each strain using the FastDNA Spin Ki kit (concentration ≥20 ng / μL).

[0031] qPCR detection: Reaction system: 20 μL (containing SYBR Green Master Mix and 0.5 μM primers each) Program: 95℃ for 3 min; 40 × (95℃ for 15 s, 60℃ for 30 s); melting curve analysis, results as follows. Figure 1 As shown.

[0032] Conclusion: The primers specifically amplified the target acetic acid bacteria, with no cross-reactivity.

[0033] Example 3: Optimization of the cell wall disruption process of the compound enzyme Objective: To address the problem of low DNA extraction rate caused by the thick cell walls of acetic acid bacteria.

[0034] Sample: Acetobacter xyloside cells (10) 8 CFU / mL Comparison of cell wall breaking methods: Option A: 20 mg / mL lysozyme (37℃ for 60 min) Option B: 20 ​​mg / mL lysozyme + 0.1 mg / mL proteinase K (37℃ 60 min - 55℃ 30 min) Solution C: Solution B + 1 U / μL cellulase (pretreatment at 40℃ for 30 min), DNA yield detection as follows Figure 2 As shown.

[0035] Conclusion: The compound enzyme method (lysozyme + proteinase K + cellulase) significantly improved DNA yield by >80% and reduced Ct value (increased sensitivity).

[0036] Example 4: Interference detection of vinegar samples Objective: To verify a solution for PCR inhibitors in high-acidity vinegar samples.

[0037] Sample processing: Commercially available rice vinegar (pH 2.9) has been treated with acetic acid bacteria (final concentration 10³ CFU / mL). Divide into two groups: Control group: Washed once with PBS + standard lysis buffer Experimental group: Washed twice with PBS + modified lysis buffer (containing 0.1 M sodium citrate + 0.5% BSA) qPCR detection: Same system as in Example 1, with standard gradients of 10²–10.8 copies / μL. Results are as follows: Figure 3 As shown.

[0038] Note: Recovery rate = (measured concentration / added concentration) × 100%; Conclusion: The modified buffer effectively neutralizes acid inhibition, with a recovery rate > 95%.

Claims

1. A specific primer pair for detecting acetic acid bacteria in vinegar, characterized in that, The primers designed to use the groEL gene as the target sequence include a forward primer F and a reverse primer R. The sequence of the forward primer F is shown in SEQ ID No: 1, and the sequence of the reverse primer R is shown in SEQ ID No:

2.

2. The application of specific primer pairs, characterized in that, Including the following (1) or (2): (1) Used for the specific detection of Acetobacter spp. and Gluconobacter spp. in the matrix; (2) Prepare a kit for detecting Acetobacter spp. and Gluconobacter spp.

3. The application according to claim 2, characterized in that, In (1), the genus Acetobacter includes Pasteurella acetosporum, Acetobacter stenosis and Acetobacter fructus.

4. The application according to claim 2, characterized in that, In (1), the genus *Acetobacter* includes *Hansorius koalaensis*.

5. A qPCR quantitative detection method for acetic acid bacteria in vinegar, characterized in that, Includes the following steps: S01. Sample pretreatment: Take a quantitative sample solution, centrifuge to obtain precipitated bacterial cells and supernatant; wash the precipitated bacterial cells with PBS buffer at pH 7 to obtain crude extract; S02. Breaking the cell wall of acetic acid bacteria: Resuspend the crude extract in TE buffer, then add cellulase, lysozyme, and proteinase K in sequence. After inactivation, obtain the suspension and cool it on ice. S03. DNA Extraction and Purification: Add cell disruption buffer and binding buffer to the suspension, incubate at 70°C, and vortex to mix; add ethanol, mix, transfer to an adsorption column and centrifuge; add buffer GD, wash buffer and buffer EB to the adsorption column in sequence to obtain DNA extract. S04, qPCR detection: Take 2× premixed real-time PCR reagent, forward primer F and reverse primer R as described in claim 1, DNA extraction solution, and ddH2O, vortex to homogenize, and obtain the premixed solution; after analysis and calculation of the premixed solution, the bacterial concentration of the original sample solution is obtained.

6. The qPCR quantitative detection method according to claim 5, characterized in that, In step S02, the TE buffer is a mixture of 10 mM Tris-HCl and 1 mM EDTA.

7. The qPCR quantitative detection method according to claim 5, characterized in that, In step S02, the concentration of cellulase is 1 U / μL, the concentration of lysozyme is 20 mg / mL, and the concentration of proteinase K is 0.1 mg / mL.

8. The qPCR quantitative detection method according to claim 5, characterized in that, In step S03, the cell disruption solution is prepared by mixing the following reagents: Tris-HCl, EDTA, lysozyme, proteinase K, and Tween 20.

9. The qPCR quantitative detection method according to claim 5, characterized in that, In step S02 and step S04, the PCR reaction conditions are as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s; 60℃ annealing for 30 s; 60℃ extension for 30 s; a total of 40 cycles; melting curve 60℃-95℃, 0.5℃ / s, continuously collected for a total of 1 cycle.