Primer probe group and kit for detecting helicobacter pylori virulence typing based on multi-gene joint

By using a multi-gene joint detection system and specific primer probe sets and qPCR technology, the problem of accuracy in Helicobacter pylori virulence typing has been solved, enabling rapid and accurate detection of Helicobacter pylori virulence, and improving detection efficiency and the precision of treatment strategies.

CN120945084APending Publication Date: 2025-11-14西安良升生物科技有限公司
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511226158.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing technologies cannot accurately distinguish between highly virulent and low-virulence strains of Helicobacter pylori, leading to misdiagnosis, missed diagnosis, and antibiotic overuse. They also cannot provide real-time feedback on treatment effectiveness, and traditional genetic testing is complex and not accurate enough.

Method used

A multi-gene joint detection system was designed, including a highly specific primer and probe set targeting 16S rRNA, VacA, and CagA genes, combined with the ATCB internal standard gene, to achieve rapid and accurate virulence typing of Helicobacter pylori using qPCR technology.

Benefits of technology

It enables efficient identification of high and low virulence strains of Helicobacter pylori, improves the accuracy of treatment strategies, reduces invasive procedures, and enhances detection efficiency and result reliability. It is suitable for rapid detection of various sample types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945084A_ABST
    Figure CN120945084A_ABST
Patent Text Reader

Abstract

The invention discloses a primer probe group and a kit for jointly detecting helicobacter pylori virulence typing based on multiple genes. The primer probe group comprises upstream primers with nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, downstream primers with nucleotide sequences as shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, and fluorescent probes with nucleotide sequences as shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9. The method can be applied to the technical fields of PCR, qPCR, sequencing and the like, has the characteristics of rapidness, simplicity, convenience and objectiveness, has high-throughput detection capability, is very suitable for large-scale screening and precise treatment guidance in clinic, not only improves the overall level of biological clinical detection, but also provides a solid foundation for wide application of the technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a primer and probe set and kit for detecting Helicobacter pylori virulence typing based on multi-gene combined detection. Background Technology

[0002] Helicobacter pylori (H. pylori) is a spiral-shaped, curved, Gram-negative bacillus. Studies have found that this bacterium is a major pathogenic factor for chronic gastritis and peptic ulcers, and is also associated with the occurrence and development of gastric cancer. According to epidemiological surveys by the World Health Organization, H. pylori is present in the stomachs of more than 50% of the world's population. In 1994, H. pylori was classified as a Group 1 carcinogen by the WHO.

[0003] Currently, Helicobacter pylori (H. pylori) can be divided into two types: Type I and Type II, based on whether it expresses VacA and CagA proteins. Type I strains are highly virulent, carrying the CagA gene and / or the VacA gene, and expressing at least one of these two proteins, thereby producing at least one toxin, either vacuole toxin (VacA) or cytotoxin-associated protein (CagA). Type II strains, on the other hand, are less virulent, carrying the VacA gene but not the CagA gene, and do not express CagA protein or any active VacA protein.

[0004] Clinically, serological antibody testing is commonly used for the diagnosis of Helicobacter pylori infection, but it has significant limitations. First, it cannot accurately determine whether a patient is currently infected, as antibodies persist in the body for a long time; even after the infection has been cleared, antibodies can still be detected, easily leading to misdiagnosis. Second, this method cannot be used to assess treatment effectiveness, as antibody levels change slowly and cannot reflect the effectiveness of treatment in a timely manner, making it difficult to provide real-time feedback. Furthermore, individual differences in antibody responses affect the accuracy of the test, and it has low sensitivity for detecting early infections, easily leading to missed diagnoses. Therefore, although it has some value in initial screening, its application is limited when accurate assessment of infection status and evaluation of treatment effectiveness are required.

[0005] The core genome of Helicobacter pylori contains approximately 1100 genes, of which about 200 are functionally specific. Its main virulence-related genes include CagA, VacA, UreA / B, babA2, dupA, and omp genes. CagA is closely associated with various gastric diseases, while VacA plays a crucial role in pathological processes by disrupting mitochondrial function and inducing apoptosis. The Ure gene helps bacteria survive in the acidic environment of the stomach, but it has little variation, making it difficult to distinguish virulence differences between strains. The babA2 and dupA genes are associated with certain gastric diseases, but their distribution and expression vary greatly, and their correlation is less clear than that of CagA and VacA. The omp gene family has many members, high variation, and complex typing. Therefore, although these genes are important in pathogenic mechanisms, their application in routine genotyping is limited due to their low variation, unclear correlation, and complex detection. Currently, CagA and VacA genes are widely used for strain virulence typing due to their crucial roles and ease of detection.

[0006] The presence of the CagA gene is usually associated with highly virulent strains, but not all strains containing the CagA gene are highly virulent. The VacA gene is present in all Helicobacter pylori strains. The expressed VacA protein is a cytotoxin that can induce vacuolation in host cells, inhibit T cell proliferation, and induce apoptosis. The VacA gene is polymorphic, mainly consisting of a signal sequence (S region) and an intermediate sequence (M region). The VacA genotype can be divided into four subtypes: s1m1, s1m2, s2m1, and s2m2. The VacA proteins of the s1m1, s1m2, and s2m1 genotypes have strong cytotoxicity, while the VacA protein of the s2m2 genotype has weaker cytotoxicity and is associated with milder disease manifestations. Based on the above, gene fragments of highly virulent and low-virulence strains are compared to design primers and probes to distinguish between them.

[0007] Helicobacter pylori typing is of great significance in clinical practice. First, it allows for accurate assessment of virulence and individualized treatment. Type I strains are highly virulent, and eradication therapy is recommended for infected individuals, regardless of symptom presence. Type II strains are less virulent, and eradication therapy is chosen based on specific circumstances. Second, it enables early identification of high-risk groups, especially those at high risk for gastric cancer, allowing for more precise intervention and treatment. Third, it helps avoid antibiotic overuse. Typing can prevent unnecessary eradication therapy for low-virulence strains, reducing antibiotic use and the emergence of drug-resistant strains. Fifth, it facilitates the rational allocation of medical resources. Typing helps differentiate between highly virulent strains requiring treatment and low-virulence strains that do not require treatment, thus enabling the rational allocation of medical resources.

[0008] Therefore, developing a hierarchical detection technology for Helicobacter pylori gene polymorphism that can distinguish between highly virulent and low-virulence strains is of great value for the prevention and control of Helicobacter pylori infection. Summary of the Invention

[0009] The technical problem to be solved by the present invention is to provide a primer and probe set and kit for detecting Helicobacter pylori virulence typing based on multiple genes, in order to address the shortcomings of the prior art.

[0010] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a primer and probe set for detecting Helicobacter pylori virulence typing based on multi-gene joint detection, characterized in that it includes upstream primers with nucleic acid sequences as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, downstream primers with nucleic acid sequences as shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, and fluorescent probes with nucleic acid sequences as shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9.

[0011] The primer and probe set for detecting Helicobacter pylori virulence typing based on multiple genes is characterized in that it further includes an upstream primer with a nucleic acid sequence as shown in SEQ ID NO:10, a downstream primer with a nucleic acid sequence as shown in SEQ ID NO:11, and an ATCB internal control gene probe with a nucleic acid sequence as shown in SEQ ID NO:12.

[0012] The primer and probe set for detecting Helicobacter pylori virulence typing based on multiple genes is characterized in that the genes used to detect Helicobacter pylori nucleic acid typing are 16S rRNA, VacA and CagA, SEQ ID NO:1, SEQ ID NO:4 and SEQ ID NO:7 are 16S rRNA sequences, SEQ ID NO:2, SEQ ID NO:5 and SEQ ID NO:8 are VacA sequences, and SEQ ID NO:3, SEQ ID NO:6 and SEQ ID NO:9 are CagA sequences.

[0013] The primer and probe set for the above-mentioned multi-gene joint detection of Helicobacter pylori virulence typing is characterized in that the 16S rRNA probe 16S-P is labeled with the fluorescent group FAM, the VacA probe VacA-P is labeled with the fluorescent group VIC, the CagA probe CagA-P is labeled with the fluorescent group ROX, the ATCB probe ATCB-P is labeled with the fluorescent group Cy5, and the quenching group is any one of BHQ1, BHQ2, TAMRA, DABCYL, MGB and Eclipse.

[0014] Furthermore, the present invention provides a kit for detecting Helicobacter pylori virulence typing based on multi-gene combined detection, characterized in that it includes the above-mentioned primer and probe set.

[0015] The kit described above is characterized in that the concentration of each upstream primer is 0.025 μM, the concentration of each downstream primer is 0.025 μM, and the concentration of each fluorescent probe is 0.015 μM.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] 1. This invention innovatively constructs a multi-gene joint detection system, specifically designing multiple sets of highly specific primer and probe sets targeting the 16S rRNA, VacA, and CagA virulence genes of Helicobacter pylori. This system can efficiently identify and detect these two crucial virulence genes, enabling the typing of infected Helicobacter pylori and determining whether the infection is a highly virulent or low-virulence strain. Its core advantage lies in its ability to assist clinicians in developing more precise treatment strategies, significantly improving the eradication efficiency of Helicobacter pylori, and thus effectively curbing the rise in the incidence of gastric cancer.

[0018] 2. This invention features specially designed highly specific primers for different subtypes of the VacA gene (S1, S2, M1, M2). Given the differences in virulence among these subtypes, the sequence characteristics of high- and low-virulence strains were compared in detail, and specific primer sequences for high-virulence VacA strains were precisely constructed accordingly. For the CagA gene, sequences from high-virulence strains containing this gene were carefully selected for comparison, and highly homologous sequence fragments were screened out. These fragments were then used as templates for specific primer design. Simultaneously, corresponding primers were designed for 16S rRNA, and a dedicated ATCB internal control gene primer was also provided for internal control detection.

[0019] 3. The primer and probe set of this invention integrates three major modules: nucleic acid extraction, amplification and analysis, enabling integrated, efficient and rapid detection. It provides comprehensive support for various sample types such as gastric mucosa, saliva, and feces, effectively avoiding the invasive procedures associated with traditional gastroscopy.

[0020] 4. The primer and probe set and kit of this invention, using qPCR technology, allow the detection process to be completed within one working day, with highly reliable results. This not only improves the overall level of biological clinical testing but also provides a solid foundation for the widespread application of this technology.

[0021] 5. The primer and probe set and kit of this invention can be applied to PCR, qPCR, sequencing and other technical fields. They are characterized by speed, simplicity, and objectivity, as well as high-throughput detection capabilities, making them ideal for large-scale screening and precision medicine guidance in clinical settings. This not only improves the overall level of biological clinical testing but also provides a solid foundation for the widespread application of this technology.

[0022] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0023] Figure 1 The results of the 16S rRNA sensitivity test in Experiment Example 1 of this invention;

[0024] Figure 2 The results are the VacA sensitivity test results from Experiment Example 1 of this invention;

[0025] Figure 3 The results are the CagA sensitivity test results from Experiment Example 1 of this invention;

[0026] Figure 4 The results are the ATCB sensitivity test results from Experiment Example 1 of this invention;

[0027] Figure 5 This refers to the specificity test results in Experiment Example 2 of this invention;

[0028] Figure 6 The results of the detection of the highly toxic strain in Experimental Example 3 of this invention;

[0029] Figure 7 This is the detection result of the low-toxicity strain in Experiment Example 3 of this invention. Detailed Implementation

[0030] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.

[0031] The following terms or definitions are provided merely to aid in understanding the invention. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0032] Unless otherwise defined below, all technical and scientific terms used in the specific embodiments of this invention are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain the invention.

[0033] As used in this invention, the terms “comprising,” “including,” “having,” “containing,” or “involving” are inclusive or open-ended and do not exclude other unlisted elements or method steps.

[0034] The term “consisting of” is considered a preferred embodiment of the term “comprising”. If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of these embodiments.

[0035] When referring to a singular noun, the indefinite or definite article used, such as "a" or "a kind of," "the," includes the plural form of the noun.

[0036] The terms "approximately" and "generally" in this invention refer to a range of accuracy that, as would be understood by those skilled in the art, still guarantees the technical effects of the discussed features. This term typically indicates a deviation from the indicated value of ±10%, preferably ±5%.

[0037] The term "nucleic acid" or "nucleic acid sequence" as used in this invention refers to any molecule, preferably a polymeric molecule, containing units of ribonucleic acid, deoxyribonucleic acid, or similar molecules. The nucleic acid may be single-stranded or double-stranded. A single-stranded nucleic acid may be the nucleic acid of one strand of denatured double-stranded DNA. Alternatively, a single-stranded nucleic acid may be a single-stranded nucleic acid derived from any double-stranded DNA.

[0038] The present application will be further described in detail below with reference to the embodiments.

[0039] Example 1

[0040] This example illustrates the design and synthesis of upstream primers, downstream primers, and fluorescent probes.

[0041] This application provides a primer and probe set for detecting Helicobacter pylori nucleic acid typing, including a primer and probe set for detecting 16S rRNA, a primer and probe set for detecting VacA, a primer and probe set for detecting CagA, and a primer and probe set for detecting the internal standard ATCB. After individual screening of primers for each genotype and optimization of the combination of primers for each genotype, the optimized final primer and probe sequences used in this invention are determined as follows.

[0042] The primer and probe set for detecting 16S rRNA includes:

[0043] 16S-F, sequence listing is shown in SEQ ID NO:1; 16S-R, sequence listing is shown in SEQ ID NO:4; 16S-P, sequence listing is shown in SEQ ID NO:7;

[0044] The primer and probe set for detecting VacA includes:

[0045] VacA-F, sequence listing is shown in SEQ ID NO:2; VacA-R, sequence listing is shown in SEQ ID NO:5; VacA-P, sequence listing is shown in SEQ ID NO:8;

[0046] The primer and probe set for detecting CagA includes:

[0047] CagA-F, sequence listing as shown in SEQ ID NO:3; CagA-R, sequence listing as shown in SEQ ID NO:6; CagA-P, sequence listing as shown in SEQ ID NO:9;

[0048] The primer and probe set for detecting ATCB includes:

[0049] ATCB-F, sequence listing is shown in SEQ ID NO:10; ATCB-R, sequence listing is shown in SEQ ID NO:11; ATCB-P, sequence listing is shown in SEQ ID NO:12;

[0050] The specific sequence of this application is shown in Table 1 below.

[0051] Table 1 Sequence List

[0052] SEQID Gene Sequence information 5'-3' NO:1 16S-F TAATGTTCCAGCAGGTCGCC NO:2 VacA-F GTCGCACCCTTTGTGCA NO:3 CagA-F GTCCCATCAAAACGATCCGTCT NO:4 16S-R ACTCCTTTTGTTAGAGAAGATAATGACGGTA NO:5 VacA-R TAAGAAGCCCTGAGACCGTT NO:6 CagA-R GGTAAGCCTTGTATGTCGGTGGTG NO:7 16S-P GTCAGTCAGGTGTGAAATCCTATGGCTTAACC NO:8 VacA-P TAAGAAGCCCTGAGACCGTT NO:9 CagA-P TCCAACCAATCCCCACCAGTAGGC NO:10 ATCB-F TAGGCGGACTATGACTTA NO:11 ATCB-R CCACATTGTGAACTTTGG NO:12 ATCB-P ACTGCTGTCACCTTCACCGT

[0053] The primer and probe set designed in this embodiment is specifically for Helicobacter pylori typing detection and can simultaneously detect 16S rRNA, VacA, CagA, and ATCB. The primer and probe set described in this application can be widely used in the field of fluorescent qPCR amplification for Helicobacter pylori detection.

[0054] Example 2

[0055] This embodiment illustrates a kit for detecting Helicobacter pylori virulence typing based on multi-gene combined detection, including the primer and probe set described in Example 1, with each upstream primer having a concentration of 0.025 μM, each downstream primer having a concentration of 0.025 μM, and each fluorescent probe having a concentration of 0.015 μM.

[0056] Centrifuge the synthesized qPCR primers / probes from Example 1 at 6000 rpm for 5 min; open the cap, add nuclease-free water, dilute the primers and probes to 10 μM, and vortex thoroughly to mix before use.

[0057] qPCR amplification reagents include:

[0058] 0.05 μL of the upstream primer (10 μM) shown in SEQ ID NO.1;

[0059] 0.05 μL of the upstream primer (10 μM) shown in SEQ ID NO.2;

[0060] 0.05 μL of the upstream primer (10 μM) shown in SEQ ID NO.3;

[0061] 0.05 μL of the downstream primer (10 μM) shown in SEQ ID NO.4;

[0062] 0.05 μL of the downstream primer (10 μM) shown in SEQ ID NO.5;

[0063] 0.05 μL of the downstream primer (10 μM) shown in SEQ ID NO.6;

[0064] 0.03 μL of the fluorescent probe (10 μM) shown in SEQ ID NO.7;

[0065] 0.03 μL of the fluorescent probe (10 μM) shown in SEQ ID NO.8;

[0066] 0.03 μL of the fluorescent probe (10 μM) shown in SEQ ID NO.9;

[0067] 0.05 μL of the upstream primer (10 μM) shown in SEQ ID NO.10;

[0068] 0.05 μL of the downstream primer (10 μM) shown in SEQ ID NO.11;

[0069] 0.03 μL of the fluorescent probe (10 μM) shown in SEQ ID NO.12;

[0070] PCR reaction buffer 10 μL;

[0071] 9.48 μL of nuclease-free water.

[0072] Example 3

[0073] This embodiment provides a method for Helicobacter pylori virulence typing based on multi-gene joint detection, including the following steps:

[0074] Step 1: Collect samples and prepare DNA templates; the sample type can be any one of gastric mucosal biopsy tissue, gastric juice, saliva, feces, and dental plaque.

[0075] Step 2: The DNA template prepared in Step 1 was amplified by qPCR using the qPCR amplification reagent of Example 2. The qPCR amplification reaction program was as follows: 95℃, 3 min; 95℃, 5 s; 60℃, 30 s; 40 cycles. Fluorescence was collected in real time during the reaction, and the detection results were analyzed and determined.

[0076] The test results can be determined by the amplification curve:

[0077] ① If the 16S rRNA amplification curve shows a value, it indicates that the sample is infected with Helicobacter pylori. Based on this, if at least one of the VacA and CagA amplification curves shows a value, it is determined to be an infection of a highly virulent Hp strain. If neither the VacA nor the CagA amplification curves show a value, it is determined to be an infection of a low-virulence Hp strain.

[0078] ②If the 16S rRNA amplification curve does not show any value, it indicates that the sample subject is not infected with Helicobacter pylori.

[0079] Experimental Example 1

[0080] This experimental example is used to verify the sensitivity of the method of the present invention.

[0081] To evaluate the sensitivity of the detection method, synthetic plasmids targeting different Helicobacter pylori targets (16S rRNA, VacA, CagA, ATCB) were serially diluted to prepare a series of sensitivity evaluation samples at concentrations of 200,000 copies / ml, 20,000 copies / ml, 2,000 copies / ml, and 200 copies / ml, with sterile double-distilled water used as a negative control. These samples were tested according to the method in Example 3, and the results are as follows:

[0082] Detection results of 16S rRNA, VacA, CagA, and ATCB (as shown below) Figure 1 , Figure 2 , Figure 3 , Figure 4 As shown in the figure: when the concentration of 16S rRNA / VacA / CagA / ATCB target nucleotides in the sample is as low as 200 copies / ml, clear detection results can still be obtained, showing extremely high detection sensitivity.

[0083] Experiment Example 2

[0084] This experimental example is used to verify the specificity of the method of the present invention.

[0085] Nucleic acids were extracted from Campylobacter jejuni, Klebsiella pneumoniae, Staphylococcus aureus, Bacillus atrophicus, Enterococcus faecalis, Streptococcus pneumoniae, Salmonella paratyphi B, Escherichia coli, Proteus, and Candida albicans. Plasmids targeting different Helicobacter pylori targets were used as positive controls, and deionized water (ddH2O) was used as a negative control. The samples used for specificity assessment and the negative control samples were tested according to the method in Example 3.

[0086] Test results as follows Figure 5 As shown, from Figure 5 It can be observed that the Helicobacter pylori detection system used does not have cross-reaction with other common pathogens, demonstrating good specificity.

[0087] Experimental Example 3

[0088] This experimental example is used to verify the accuracy of the method of the present invention.

[0089] One hundred clinical samples were extracted and tested for nucleic acid according to the method in Example 3. The control reagent used was the commercially available Beijing Xinji Yongkang Helicobacter pylori Nucleic Acid Detection Kit (PCR-fluorescent probe method), and the detection method was strictly performed according to the kit instructions. The detection results were compared with the actual clinical sample results, and the accuracy was calculated. The detection results are shown in Table 2.

[0090] Table 2. Accuracy Verification Test Results

[0091]

[0092] As can be seen from the table, the detection results of the present invention are accurate and reliable.

[0093] Experiment Example 4

[0094] This experimental example is used to verify the ability of the primers and probes designed in this invention to distinguish between highly toxic and low-toxic strains.

[0095] This invention involves four targets of Helicobacter pylori genes. Highly virulent strains (ATCC26695, ATCC 43504) and lowly virulent strains (ATCC 51932) reported in the literature were selected as test samples. The primers and probes designed in this invention were used for verification according to the method in Example 3, and first-generation sequencing was performed simultaneously for verification.

[0096] Figure 6 This indicates that the highly virulent strains reported in the literature, when tested using the method of this invention, contain the CagA and vacA genes, consistent with the literature reports. First-generation sequencing results show that ATCC 26695 and ATCC 43504 belong to the HpI type strain. This demonstrates that the test results of this method are consistent with the content reported in the literature.

[0097] Figure 7 This indicates that the low-virulence strain reported in the literature, when tested using the method of this invention, shows that the low-virulence strain (ATCC 51932) does not contain the CagA and vacA genes, consistent with the literature reports. First-generation sequencing results show that ATCC 51932 belongs to the HpII type strain. This demonstrates that the test results of this method are consistent with the content reported in the literature.

[0098] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in the present invention, and these modifications or substitutions should all be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A primer and probe set for detecting Helicobacter pylori virulence typing based on multi-gene combined detection, characterized in that, Includes upstream primers for nucleic acid sequences shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, downstream primers for nucleic acid sequences shown in SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, and fluorescent probes for nucleic acid sequences shown in SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:

9.

2. The primer and probe set for detecting Helicobacter pylori virulence typing based on multi-gene joint detection according to claim 1, characterized in that, It also includes an upstream primer for the nucleic acid sequence shown in SEQ ID NO:10, a downstream primer for the nucleic acid sequence shown in SEQ ID NO:11, and an ATCB internal standard gene probe for the nucleic acid sequence shown in SEQ ID NO:

12.

3. The primer and probe set for detecting Helicobacter pylori virulence typing based on multi-gene joint detection according to claim 1, characterized in that, The genes used for detecting Helicobacter pylori nucleic acid typing are 16S rRNA, VacA, and CagA. SEQ ID NO:1, SEQ ID NO:4, and SEQ ID NO:7 are 16S rRNA sequences, SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:8 are VacA sequences, and SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9 are CagA sequences.

4. The primer and probe set for detecting Helicobacter pylori virulence typing based on multi-gene joint detection according to claim 3, characterized in that, The 16S rRNA probe 16S-P is labeled with the fluorescent group FAM, the VacA probe VacA-P is labeled with the fluorescent group VIC, the CagA probe CagA-P is labeled with the fluorescent group ROX, the ATCB probe ATCB-P is labeled with the fluorescent group Cy5, and the quenching group is any one of BHQ1, BHQ2, TAMRA, DABCYL, MGB and Eclipse.

5. A kit for detecting Helicobacter pylori virulence typing based on multi-gene combined detection, characterized in that, Includes the primer-probe set as described in any one of claims 1 to 4.

6. The reagent kit according to claim 5, characterized in that, The concentrations of all upstream primers and downstream primers were 0.025 μM, and the concentrations of all fluorescent probes were 0.015 μM.