SNP (Single Nucleotide Polymorphism) molecular marker associated with soybean flowering period and application

Abstract

The invention relates to the field of biotechnology and molecular genetic breeding, and provides an SNP (Single Nucleotide Polymorphism) molecular marker associated with a soybean flowering period and application. The SNP molecular marker is located on a soybean chromosome 13, and contains a nucleotide sequence of which the polymorphism at the 201st site of the sequence as shown in SEQ ID NO: 1 is A / G. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and C / T mutation exists at the 23rd basic group. A KASP primer group for detecting the molecular marker comprises a forward primer 1, a forward primer 2 and a universal reverse primer, and the sequences of the forward primer 1, the forward primer 2 and the universal reverse primer are respectively shown as SEQ ID NO: 2-4. The KASP primer group developed by the invention can directly and specifically distinguish and detect A or G basic groups of SNP sites, has important application value in soybean eurytopic breeding, and can realize preselection and molecular assisted breeding of soybean flowering time traits.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and molecular genetic breeding, and more specifically, to a SNP molecular marker associated with soybean flowering period and its application. Background Technology

[0002] Soybeans Glycine max Soybeans are important food and oilseed crops, widely used in food processing, feed production, and oil extraction. However, as a short-day crop, soybeans are extremely sensitive to day length, with their growth cycle and flowering time strictly regulated by photoperiod. Most varieties can only grow under specific day conditions, limiting their planting areas and hindering widespread adoption, thus affecting the utilization of superior germplasm resources and the development of the soybean industry.

[0003] Traditional breeding methods are time-consuming, complex, rely on phenotypic selection, are easily affected by the environment, have low success rates, and struggle to accurately locate target genes, failing to meet the efficiency and precision requirements of modern breeding. Therefore, soybean breeding urgently needs new, efficient, and precise methods. Molecular marker-assisted selection (MAS) has emerged to address this need, using the detection of genes or markers associated with target traits to screen superior plants early on, improving breeding efficiency and accuracy. Among these, KASP technology stands out due to its low cost, ease of operation, and high throughput, making it suitable for large-scale breeding practices and laboratories of varying sizes. It is phenotype-independent, rapidly identifying superior plants by detecting target genes, accurately locating target genes, and is unaffected by environmental interference. KASP technology can detect target genes in the early stages of soybean growth, even at the seed stage, saving time and resources, accelerating the cultivation of superior varieties, and can be combined with gene editing, genome-wide selection, and other technologies to further improve breeding efficiency and precision. KASP technology provides a new approach to solving the problems of limited soybean planting areas and low efficiency in traditional breeding, and is expected to drive technological innovation and industrial development in soybean breeding. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker associated with soybean flowering period and its application.

[0005] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides an SNP molecular marker associated with the flowering period of soybean, the SNP molecular marker containing a nucleotide sequence (n is a or g) with a polymorphism of A / G at position 201 of the sequence shown in SEQ ID NO:1.

[0006] Furthermore, the genotype of the site with the aforementioned polymorphism is AA, corresponding to the early flowering phenotype of soybean; the genotype of the site with the aforementioned polymorphism is GG, corresponding to the late flowering phenotype of soybean.

[0007] Secondly, the present invention provides a set of KASP primers for amplifying the SNP molecular marker, including forward primer 1, forward primer 2 and universal reverse primer, the sequences of which are shown in SEQ ID NO:2-4 respectively.

[0008] Thirdly, the present invention provides detection reagents or kits containing the primers.

[0009] Fourthly, the present invention provides the application of the SNP molecular marker, the primer set, or the detection reagent or kit in identifying the flowering phenotype of soybean.

[0010] Fifthly, the present invention provides the application of the SNP molecular marker, the primer set, or the detection reagent or kit in the identification of soybean germplasm resources.

[0011] In a sixth aspect, the present invention provides the application of the SNP molecular marker, the primer set, or the detection reagent or kit in soybean targeted breeding or the creation of new soybean varieties.

[0012] In a seventh aspect, the present invention provides the application of the SNP molecular marker, the primer set, or the detection reagent or kit in the breeding of new soybean varieties with wide adaptability.

[0013] Eighthly, the present invention provides the application of the SNP molecular marker, the primer set, or the detection reagent or kit in marker-assisted breeding of soybean.

[0014] Ninthly, the present invention provides the SNP molecular marker, the primer set, or the detection reagent or kit in soybeans. qFT13-3 Gene( qFT13-3 The application of gene-encoded proteins (NCBI ID: XP_006594103.1) in typing.

[0015] In a tenth aspect, the present invention provides a method for identifying the flowering stage phenotype of soybeans, comprising the following steps: 1) Detect the genotype of the polymorphic sites of the SNP molecular marker in the soybean to be tested; 2) Determine the flowering phenotype of the soybean to be tested based on the genotype obtained in step 1); The specific method for determining step 2) is as follows: if the genotype is AA, the soybean to be tested is an early-flowering soybean; if the genotype is GG, the soybean to be tested is a late-flowering soybean.

[0016] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention develops an SNP locus located on soybean chromosome 13 that controls the flowering time of soybean, and develops a rapid and efficient KASP primer that can be used for molecular-assisted breeding of soybean with wide adaptability. This KASP primer has important value in the breeding of soybean with wide adaptability.

[0017] The KASP primers provided by this invention can directly and specifically distinguish and detect the A or G bases at SNP mutation sites. The application method of the KASP primers provided by this invention is accurate, reliable, and easy to operate. In terms of both detection throughput and accuracy, they are superior to traditional markers such as SSR, CAPS, or SCAR, and are suitable for soybean flowering time identification and assisted selection breeding.

[0018] The detection technology based on KASP primers in this invention has the characteristics of low cost and high throughput in practical applications, and it is also highly specific, making it particularly suitable for the classification, screening and identification of different genotypes in breeding populations. Attached Figure Description

[0019] Figure 1 This is a KASP marker classification diagram in a preferred embodiment of the present invention. Detailed Implementation

[0020] The present invention adopts the following technical solution: The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0021] Example 1: Obtaining SNP loci associated with soybean flowering period In previous studies, FarmCPU software was used to perform genome-wide association analysis on 1192 cultivated soybean accessions and their corresponding genotype data, successfully identifying genes associated with flowering time. qFT13-3 (Gene ID: 100796933). Haplotype analysis showed that... qFT13-3 There are two main haplotypes of genes, namely qFT13-3 H1 and qFT13-3 H2 Among them, carrying qFT13-3 H1 The flowering time of haploid germplasm is significantly earlier than that of carrier germplasm. qFT13-3 H2 Haplotype germplasm. Further analysis identified a SNP locus, Gm13:24842656, significantly associated with soybean flowering time. This locus is located in the gene... qFT13-3 At position 1358bp, a substitution from base A to base G occurred. The nucleotide sequence containing this SNP is shown in SEQ ID NO:1.

[0022] Example 2: Design of KASP primers Download from Phytozome (https: / / phytozome-next.jgi.doe.gov / ) qFT13-3 The gene sequence was used to design three primers using Primer5 software: upstream primer Primer_AlleleFAM, upstream primer Primer_AlleleHEX, and universal downstream primer Primer_Common. Specific sequence information is as follows: Primer_AlleleFAM: gaaggtgaccaagttcatgctCAGTGGGAGATTTCTTAGGGTTTG (SEQID NO: 2); Primer_AlleleHEX: gaaggtcggagtcaacggattCAGTGGGAGATTTCTTAGGGTTTA (SEQ ID NO: 3).

[0023] Primer_Common:GTCTTTTGCTACAGGTACAATGCA (SEQ ID NO:4) The three primers were designed based on a KASP primer developed from a single nucleotide polymorphism (SNP) site significantly associated with a soybean flowering gene. This SNP site is located in the soybean genome version Glycine max The specific location of Wm82.a2.v1 (Soybean, http: / / www.phytozome.net) on chromosome 13 is Chr13:24842656. Basic information about this locus is shown in Table 1.

[0024] Table 1. Basic information on single nucleotide polymorphism sites at Chr13:24842656

[0025] Example 3: Application of primers in identifying or assisting in the identification of soybean flowering time 1. Extracting genomic DNA DNA was extracted from the leaves of each soybean variety using the CTAB method to ensure high-quality genomic DNA for subsequent PCR amplification.

[0026] 2. PCR amplification Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-4.

[0027] The amplification system used was: 5 μL reaction mixture (2.43 μL DNA, 2.5 μL 2× Master Mix, 0.07 μL primer mixture (final concentration of each primer was 100 μM). The volume ratio of the primers shown in SEQ ID NO:2, 3, and 4 in the primer mixture was 2:2:5.

[0028] The PCR reaction program was as follows: (1) KASP cycle: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; 61℃-55℃ annealing / extension for 60 s, 10 cycles (each cycle decreasing by 0.6℃); 94℃ denaturation for 20 s; 55℃ annealing / extension for 60 s, 26 cycles; 37℃ reading for 1 min.

[0029] 3. Correlation analysis between Chr13:24842656 locus genotype and flowering (1) Identifying the flowering time of soybean varieties To verify the reliability of the markers, the flowering time of 48 soybean varieties was investigated. Field trials were conducted in 2018 at the Liaocheng Experimental Base in Shandong Province. Rows were 2 meters long, with a plant spacing of 0.1 meters and a row spacing of 0.55 meters. Local standard management practices were followed to ensure normal growth and maturity of the experimental materials. Field phenotypic identification was performed according to the "Soybean Germplasm Resource Description Specifications and Data Standards" (Qiu et al., 2006), investigating emergence and flowering dates. Field surveys were conducted row by row. Emergence date was defined as the date when more than 50% of the seedlings' cotyledons emerged from the soil; flowering date was defined as the date when 50% of the plants began to flower. Flowering time (days) = flowering period - emergence date.

[0030] (2) The Chr13:24842656 genotype was detected using the primers provided in Example 1. The results are shown in Tables 2 and 3.

[0031] Table 2. Genotypes and flowering time at the Chr13:24842656 locus in 48 soybean accessions.

[0032] Table 3. Genotypes and flowering time at the Chr13:24842656 locus in 48 soybean accessions.

[0033] Note: The soybean varieties mentioned in Tables 2 and 3 can be found in the following references: Wang Guoxun. Catalogue of Chinese Soybean Variety Resources. Beijing: China Agriculture Press, 1982; Chang Ruzhen and Sun Jianying. Catalogue of Chinese Soybean Variety Resources: Continued Volume 1. Beijing: Agriculture Press, 1991; Chang Ruzhen, Sun Jianying, Qiu Lijuan, and Chen Yiwu. Catalogue of Chinese Soybean Variety Resources: Continued Volume 2. Beijing: China Agriculture Press, 1996. The above soybean varieties are available for purchase.

[0034] Genotypes at the Chr13:24842656 locus in 48 accessions were determined using whole-genome resequencing. Of these, 22 accessions carried the AA genotype (blue dots) and 26 carried the GG genotype (red dots). In the Gongzhuling environment, the average flowering time for materials carrying the AA genotype was 29.45 ± 6.24 days, while the average flowering time for the GG genotype was 44.65 ± 7.45 days. t Tests showed that the flowering time of AA genotype materials ( P The KASP marker genotype (<0.0001) significantly predates the flowering time of materials carrying the GG genotype. See the KASP marker genotyping diagram. Figure 1 .

[0035] Therefore, it can be determined that using the SNP sites provided by this invention to detect the flowering time of soybeans is feasible and accurate.

[0036] The specific method for detecting the flowering time of soybeans using the SNP sites provided by this invention is as follows: The whole-genome resequencing method provided in Example 1 is used to identify the genomic DNA of the soybeans to be tested and obtain the sample genotype: if the obtained genotype is AA, then the soybeans to be tested are candidate materials with an early flowering phenotype; if the obtained genotype is GG, then the soybeans to be tested are candidate materials with a late flowering phenotype.

[0037] In summary, the genotype at the Chr13:24842656 locus in soybean can serve as a new genetic resource for marker-assisted selection in the breeding of widely adaptable and high-quality soybeans, and has very important guiding significance.

[0038] Example 4: Application of soybean SNP sites in soybean variety breeding Based on the findings of Example 1, among 421 soybean materials containing the Chr13:24842656 locus, the average flowering time of 220 soybean materials with genotype AA was 33.5 days, while the average flowering time of 201 soybean materials with genotype GG was 38.5 days. This indicates that the average flowering time of soybean materials with genotype AA was significantly earlier than that of soybean materials with genotype GG. This result further confirms the potential role of this locus in regulating soybean flowering time.

[0039] When soybeans were tested using the KASP marker primers developed in Example 2, if the genotyping result showed an AA genotype, it could be determined that the soybean individual flowered earlier; if the genotyping result showed a GG genotype, it could be determined that the soybean individual flowered later. This test result is highly consistent with the conclusion in Example 1.

[0040] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A SNP molecular marker associated with soybean flowering period, characterized in that, The SNP molecular marker contains a nucleotide sequence with a polymorphism of A / G at position 201 of the sequence shown in SEQ ID NO:

1.

2. The SNP molecular marker according to claim 1, characterized in that, The genotype of the site with the aforementioned polymorphism is AA, corresponding to the early flowering phenotype of soybean; the genotype of the site with the aforementioned polymorphism is GG, corresponding to the late flowering phenotype of soybean.

3. A KASP primer set for amplifying the SNP molecular marker of claim 1, characterized in that, It includes forward primer 1, forward primer 2 and universal reverse primer, the sequences of which are shown in SEQ ID NO:2-4, respectively.

4. A detection reagent or kit containing the primer set described in claim 3.

5. The application of the SNP molecular marker of claim 1 or 2, the primer of claim 3, or the detection reagent or kit of claim 4 in identifying the flowering phenotype of soybean.

6. The application of the SNP molecular marker of claim 1 or 2, the primer set of claim 3, or the detection reagent or kit of claim 4 in the identification of soybean germplasm resources.

7. The application of the SNP molecular marker of claim 1 or 2, the primer set of claim 3, or the detection reagent or kit of claim 4 in soybean directional breeding or the creation of new soybean varieties.

8. The application of the SNP molecular marker of claim 1 or 2, the primer set of claim 3, or the detection reagent or kit of claim 4 in soybean molecular marker-assisted breeding.

9. The SNP molecular marker of claim 1 or 2, or the primer set of claim 3, or the detection reagent or kit of claim 4 in soybean qFT13-3 Applications in genotyping; in, soybeans qFT13-3 The reference sequence number of the protein encoded by the gene in NCBI is XP_006594103.

1.

10. A method for identifying the flowering stage phenotype of soybean, characterized in that, Includes the following steps: 1) Detect the genotype of the polymorphic site of the SNP molecular marker described in claim 1 or 2 in the soybean to be tested; 2) Determine the flowering phenotype of the soybean to be tested based on the genotype obtained in step 1); The specific method for determining step 2) is as follows: if the genotype is AA, the soybean to be tested is an early-flowering soybean; if the genotype is GG, the soybean to be tested is a late-flowering soybean.

Images