Nucleic acid aptamer test strip for detecting escherichia coli by using AlphaFold 3 for auxiliary screening and preparation method of nucleic acid aptamer test strip

Abstract

The invention provides a nucleic acid aptamer test strip for auxiliary screening by utilizing AlphaFold 3 and a preparation method thereof, aiming at the defects of an existing lateral flow immunochromatography test strip for detecting escherichia coli. The test strip comprises a sample pad, a combination pad and the like, the combination pad is provided with a gold nanoparticle-nucleic acid aptamer conjugate, and a nucleic acid aptamer is obtained through AlphaFold 3 screening; and a specific nucleic acid aptamer is fixed on the detection line. The preparation method comprises the steps of nucleic acid aptamer screening, verification and test strip assembly, a random ssDNA library is constructed during screening, and an AlphaFold 3 model is used for prediction after preliminary screening. According to the test strip, the nucleic acid aptamer is used for replacing a traditional antibody, the complex antibody protein preparation process is avoided, the cost is reduced, the nucleic acid aptamer is stable in structure, the storage life of the test strip is prolonged, the environmental tolerance is improved, and the preparation method improves the aptamer hit rate and shortens the research and development cycle.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection and in vitro diagnostic technology, and in particular to a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening and its preparation method. Background Technology

[0002] Lateral flow immunochromatographic test strips are widely used in rapid clinical testing due to their ease of use and intuitive results. Current methods for detecting target antigens (such as specific IgM / IgG antibodies following viral or bacterial infections) in these test strips typically require immobilizing the pathogen antigen onto the test line as a recognition element. However, the preparation of antigen proteins is complex, costly, and involves batch-to-batch variability and biosafety risks. Furthermore, proteins are easily inactivated at room temperature and high temperatures, limiting the storage stability of the test strips. Therefore, there is an urgent need to develop an economical, stable, easily synthesized, and highly affinity alternative recognition molecule.

[0003] Therefore, we propose a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening and its preparation method. Summary of the Invention

[0004] Therefore, it is necessary to address the technical problems of existing lateral flow immunochromatographic test strips for detecting E. coli, such as the complex and costly preparation process of antigen proteins, batch-to-batch variability and biosafety risks, and the easy inactivation of proteins at room temperature and high temperature conditions, which limits the storage stability of the test strips. This paper proposes a nucleic acid aptamer test strip for detecting E. coli using AlphaFold 3-assisted screening and its preparation method, thereby simplifying the detection process, reducing costs, and increasing stability, making it suitable for on-site food and environmental testing.

[0005] The first aspect of the present invention provides a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening, comprising a sample pad, a conjugate pad, a nitrocellulose membrane carrier, a detection line, and a control line. The sample pad holds the test sample, allowing it to move to subsequent components during chromatography. The conjugate pad contains a 20-40 nm diameter gold nanoparticle-nucleic acid aptamer conjugate. The aptamer is a high-affinity aptamer obtained by modeling the complex of the target *E. coli* OmpA protein structure with a random single-stranded DNA sequence using the AlphaFold 3 artificial intelligence structure prediction model and screening based on binding energy. When the sample flows through the conjugate pad, the target antigen in the sample forms a complex with the gold-labeled aptamer. The nitrocellulose membrane carrier contains a detection line and a control line. The detection line is immobilized with a nucleic acid aptamer with an affinity not exceeding 40 nM and an amino group modified at the 5' end via EDC / NHS activation coupling. This captures the gold-labeled aptamer complex containing the target antigen flowing from the conjugate pad, fixing the complex at the detection line position. The control line is located on the nitrocellulose membrane to provide a control for the test results. Under chromatography, the sample flows sequentially from the sample pad through the conjugation pad and the nitrocellulose membrane carrier. The color intensity of the detection line and control line is used for qualitative or semi-quantitative analysis of the target *E. coli* in the sample. This test strip utilizes a nucleic acid aptamer screened by AlphaFold 3 to replace traditional antibodies, avoiding the complex process of antibody protein preparation and reducing costs. Simultaneously, the stable structure of the nucleic acid aptamer improves the shelf life and environmental tolerance of the test strip, enabling rapid and accurate detection of *E. coli*.

[0006] A second aspect of this invention provides a method for preparing a nucleic acid aptamer test strip for detecting *E. coli* using AlphaFold 3-assisted screening, comprising a nucleic acid aptamer screening step, a nucleic acid aptamer verification step, and a test strip assembly step. The nucleic acid aptamer screening step employs the AlphaFold 3 artificial intelligence structure prediction model to model the complex of the target *E. coli* OmpA protein structure with random single-stranded DNA sequences and screen candidate nucleic acid aptamers based on binding energy. Specifically, this involves constructing an ssDNA library containing 40-60 nt of random sequences and using AlphaFold 3... The model predicts three-dimensional complexes and selects candidate nucleic acid aptamer sequences with binding energy ≤ -30 kJ·mol⁻¹ and high stability based on indicators such as total binding energy, number of interfacial hydrogen bonds, and molecular dynamics RMSD. The nucleic acid aptamer validation step involves in vitro synthesis of candidate nucleic acid aptamers and verification of their dissociation constant (KD) with the target antigen using enzyme-linked nucleic acid adsorption assay (ELONA) and surface plasmon resonance (SPR). In the test strip assembly step, nucleic acid aptamers with affinity KD ≤ 30 nM are modified with a 5' terminal amino group and coupled to the carboxyl activation site on a nitrocellulose membrane to construct a test line. A gold nanoparticle-nucleic acid aptamer conjugate is prepared and sprayed onto the conjugate pad. The sample pad, conjugate pad, nitrocellulose membrane carrier with a flow rate of 90-135 s / 4 cm, control line, and absorbent pad are then assembled to complete the test strip assembly for detecting the target *E. coli* in samples. This method utilizes AlphaFold 3 computationally assisted screening to improve aptamer hit rate and shorten the research and development cycle. The prepared test strips have sensitivity and specificity no lower than those of traditional antigen-antibody systems, making them suitable for rapid in vitro diagnostics.

[0007] In other embodiments, the nucleotide sequence of the nucleic acid aptamer is: GCCTTGCCAAGTAACGGCCG,TTGGATCCGATTGACTGCTCGTACTT, and this nucleic acid aptamer has a KD value of 35 nM for the E. coli OmpA protein. This specific sequence of nucleic acid aptamer has been optimized to have higher affinity for the target and can bind more effectively to the E. coli OmpA protein, thereby improving the accuracy and sensitivity of the test strip detection.

[0008] In other embodiments, during the nucleic acid aptamer screening step, after constructing a random ssDNA library, the library is first pre-screened to remove obviously unsuitable sequences before AlphaFold 3 model prediction. This pre-screening reduces the workload of subsequent model prediction, improves screening efficiency, and allows the AlphaFold 3 model to focus more on analyzing promising sequences, thereby finding high-affinity nucleic acid aptamers more quickly.

[0009] In other embodiments, during the nucleic acid aptamer validation step, when using ELONA and SPR for validation, multiple repeated experiments are conducted, and the average value is taken as the final dissociation constant (KD) result. Multiple repeated experiments can reduce experimental errors, improve the accuracy and reliability of the results, and ensure that the screened nucleic acid aptamers have stable and accurate affinity for the target antigen, providing high-quality nucleic acid aptamers for the preparation of test strips.

[0010] In other embodiments, during the test strip assembly step, when constructing the test line, the coupling conditions between the nucleic acid aptamer and the carboxyl activation sites on the nitrocellulose membrane are controlled, including reaction time, temperature, and reactant concentration. Appropriate coupling conditions ensure a strong binding between the nucleic acid aptamer and the nitrocellulose membrane, improving the stability and reliability of the test line, thereby ensuring that the test strip accurately captures the target antigen during detection and produces clear and accurate test results.

[0011] In other embodiments, during the test strip assembly step, when preparing the gold nanoparticle-nucleic acid aptamer conjugate, the ratio of gold nanoparticles to nucleic acid aptamers is controlled to ensure the stability and activity of the conjugate. A suitable ratio allows the gold nanoparticles and nucleic acid aptamers to fully bind, forming a stable and uniform conjugate. This ensures that the gold-labeled nucleic acid aptamer can effectively bind to the target antigen during detection, producing a noticeable color change on the detection line, thus improving the sensitivity and accuracy of the detection.

[0012] In other embodiments, during the test strip assembly step, when spraying the gold nanoparticle-nucleic acid aptamer conjugate onto the conjugate pad, the uniformity and amount of spraying are controlled. Uniform spraying ensures a uniform distribution of the gold-labeled nucleic acid aptamers on the conjugate pad, allowing the sample to fully contact the gold-labeled nucleic acid aptamers as it flows through the conjugate pad, thus improving the accuracy and repeatability of the detection. An appropriate amount of spraying ensures that enough gold-labeled nucleic acid aptamers bind to the target antigen while avoiding material waste and affecting the detection results.

[0013] In other embodiments, the nitrocellulose membrane carrier has a flow rate of 90-135 s / 4 cm. Selecting a suitable flow rate for the nitrocellulose membrane carrier ensures uniform flow of the liquid in the sample across the membrane, allowing the nucleic acid aptamers to fully bind to the target protein. This avoids problems such as insufficient binding due to excessively fast flow or prolonged detection time due to excessively slow flow, thereby improving the detection efficiency and accuracy of the test strip. Attached Figure Description

[0014] Figure 1-3 This is a schematic diagram of the Escherichia coli OmpA protein before it binds to the nucleic acid aptamer.

[0015] Figure 2 This is a schematic diagram of the binding of Escherichia coli OmpA protein to a nucleic acid aptamer.

[0016] Figure 3 This is a schematic diagram showing the binding of Escherichia coli OmpA protein to a nucleic acid aptamer. Detailed Implementation

[0017] The specific embodiments of the present invention will now be described with reference to the accompanying drawings.

[0018] Example 1

[0019] This embodiment discloses a method for preparing nucleic acid aptamer test strips for detecting *E. coli* using AlphaFold 3-assisted screening. The method employs large-scale structure prediction models such as AlphaFold 3, combined with computer-aided screening, which significantly improves the efficiency and affinity of nucleic acid aptamer preparation. AlphaFold 3, as a currently advanced large-scale structure prediction model, possesses powerful computational capabilities and accurate prediction functions. It can simulate the three-dimensional structure of biological macromolecules and accurately predict the spatial conformation of molecules such as proteins and nucleic acids through complex algorithms. In the process of nucleic acid aptamer preparation, traditional methods often require a significant amount of time and resources for experimental screening, and the screening results are subject to considerable uncertainty. However, by combining computer-aided screening with AlphaFold 3, massive amounts of random single-stranded DNA sequences can be rapidly analyzed. By constructing a complex model of the target protein and nucleic acid sequence, the interaction mechanism between them can be understood at the atomic level, and then candidate nucleic acid aptamers can be evaluated and screened based on key parameters such as binding energy. This computational approach significantly reduces the randomness of experiments and improves the targeting of screening, enabling the identification of high-affinity nucleic acid aptamers in a shorter time, thereby significantly improving the efficiency of nucleic acid aptamer preparation. Furthermore, due to the accurate predictions of AlphaFold 3, the selected nucleic acid aptamers bind more tightly and stably to the target protein, effectively enhancing affinity and laying a solid foundation for subsequent detection applications.

[0020] This invention develops a nucleic acid aptamer based on AlphaFold 3 artificial intelligence-assisted screening for rapid lateral flow detection of *E. coli*. In today's rapidly developing field of biodetection, rapid and accurate detection of pathogens is crucial. *E. coli*, a common pathogen, is widely present in various fields such as food and the environment, and its infection can cause a variety of diseases, posing a serious threat to human health. Traditional detection methods, such as culture and PCR, while having high accuracy, suffer from drawbacks such as complex operation, long detection time, and the need for specialized equipment and technicians, making it difficult to meet the needs of rapid on-site detection. The nucleic acid aptamer developed in this invention based on AlphaFold 3 artificial intelligence-assisted screening for rapid lateral flow detection of *E. coli* provides a new approach to solving this problem. Firstly, the outer membrane protein OmpA of *E. coli* is used as the target. OmpA is an important structural protein on the surface of *E. coli* cells, exhibiting high conservation and specificity, making it an ideal detection target. AlphaFold 3 is used for high-throughput computational screening of random ssDNA sequences. High-throughput computational screening can analyze a large number of nucleic acid sequences in a short time, greatly improving screening efficiency. By constructing a complex model of the target protein and nucleic acid sequence, the interaction mechanism between them is understood at the atomic level. Candidate nucleic acid aptamers are then evaluated and screened based on key parameters such as binding energy to obtain high-affinity nucleic acid aptamers. The captured nucleic acid aptamers are then immobilized on a nitrocellulose membrane test line. The nitrocellulose membrane, with its excellent porous structure and protein-binding ability, provides stable support for the immobilization of the nucleic acid aptamers. The detection nucleic acid aptamer is coupled to gold nanoparticles and placed on the binding pad. Gold nanoparticles possess unique optical properties; when coupled with the nucleic acid aptamer, they produce a noticeable color change during detection, easily observed by the naked eye. After the test strip is assembled, E. coli in the sample is captured and colored by the dual-site nucleic acid aptamer. This dual-site capture mechanism improves the specificity and sensitivity of the detection. Visual interpretation is possible within 5–15 minutes, significantly shortening the detection time and improving detection efficiency. The detection limit can reach 10. 2The CFU·mL⁻¹ method can meet the detection requirements for low concentrations of E. coli. This method avoids antibody preparation, which is complex, requiring multiple steps such as cell culture and protein purification, resulting in high costs and poor stability. Nucleic acid aptamers, on the other hand, can be prepared chemically, offering low cost and high stability, making them suitable for on-site food and environmental testing, and providing strong technical support for ensuring food safety and public health. (This innovative technology integrates knowledge from multiple fields such as artificial intelligence, biotechnology, and nanotechnology. Through the accurate prediction and computer-aided screening of AlphaFold 3, it achieves efficient preparation of nucleic acid aptamers. Lateral flow detection technology has advantages such as ease of operation, speed, and visualization. Combined with the high specificity and affinity of nucleic acid aptamers, this test strip can play an important role in E. coli detection. In food testing, it can quickly detect the presence of E. coli contamination in food, ensuring food safety; in environmental testing, it can timely monitor the content of E. coli in water bodies, soil, and other environments, providing a basis for environmental hygiene assessment. At the same time, the low cost and high stability of this technology also make its widespread application in primary healthcare and on-site testing possible.)

[0021] The preparation method in this embodiment avoids the problems of antibody protein preparation and stability, reduces costs and improves detection sensitivity, and is suitable for rapid in vitro diagnostics. It includes the following steps:

[0022] a) The AlphaFold 3 artificial intelligence structure prediction model was used to model the complex of the target *E. coli* OmpA protein structure and random single-stranded DNA sequence, and candidate nucleic acid aptamers were screened based on binding energy. Specifically, a random ssDNA library was first constructed and screened using AlphaFold 3. The structure of the target antigen and nucleic acid sequence complex was predicted and affinity scored to select high-affinity nucleic acid aptamers. Constructing a random ssDNA library is the foundation for screening nucleic acid aptamers. A large number of ssDNA molecules with different sequences can be generated through chemical synthesis, and these molecules exhibit rich diversity, making it possible to screen for high-affinity nucleic acid aptamers. The AlphaFold 3 model can model the complex of the target *E. coli* OmpA protein structure and random single-stranded DNA sequence, simulating their interaction at the atomic level. By calculating the binding energy of the complex, the affinity of different nucleic acid sequences for the target protein can be evaluated. The lower the binding energy, the tighter the binding between the nucleic acid sequence and the target protein, and the higher the affinity. Screening candidate nucleic acid aptamers based on key parameters such as binding energy allows for the rapid and accurate identification of nucleic acid aptamers with high affinity, significantly improving screening efficiency. This computational approach avoids the blind spots of traditional experimental screening, reduces the number of experiments and costs, and provides a new pathway for the preparation of nucleic acid aptamers.

[0023] (b) The candidate nucleic acid aptamers are synthesized in vitro and their affinity for the target antigen is determined. In vitro synthesis of candidate nucleic acid aptamers can be achieved through chemical synthesis, which offers advantages such as ease of operation, high synthesis efficiency, and high product purity. The synthesized nucleic acid aptamers need to have their affinity for the target antigen determined. Commonly used methods include enzyme-linked nucleic acid adsorption assay (ELONA) and surface plasmon resonance (SPR). The ELONA method is based on the principle of antigen-antibody specific binding. It involves immobilizing the target antigen on a solid-phase support, adding the nucleic acid aptamer, and then detecting it using an enzyme-labeled secondary antibody, thereby determining the affinity between the nucleic acid aptamer and the target antigen. SPR technology is a real-time, label-free detection method that can monitor the refractive index change during the binding process of the nucleic acid aptamer and the target antigen, thus obtaining binding kinetic parameters such as the binding constant (Ka) and dissociation constant (Kd). By determining the affinity, nucleic acid aptamers with stronger binding ability to the target antigen can be further screened, providing high-quality raw materials for subsequent test strip preparation.

[0024] c) Nucleic acid aptamers with an affinity not exceeding 40 nM are chemically coupled to the detection line of a nitrocellulose membrane. Nitrocellulose membranes are commonly used bioseparation and detection materials with excellent porous structure and protein binding capacity. Immobilizing nucleic acid aptamers with an affinity not exceeding 40 nM onto the detection line of the nitrocellulose membrane ensures effective binding of the aptamers to the target protein. Chemical coupling is a commonly used immobilization method. By modifying the 5' end of the nucleic acid aptamer with an amino group, it can undergo a coupling reaction with the carboxyl activation site on the nitrocellulose membrane, thereby firmly immobilizing the nucleic acid aptamer on the membrane. This immobilization method is simple to operate, has good stability, and can ensure the activity and specificity of the nucleic acid aptamer during the detection process.

[0025] d) Assemble the lateral flow chromatography test strip and use it to detect target *E. coli* in the sample. Assembling the lateral flow chromatography test strip involves assembling components such as a nitrocellulose membrane immobilized with nucleic acid aptamers, a conjugate pad, a sample pad, and an absorbent pad in a specific order. The conjugate pad is coated with a gold nanoparticle-nucleic acid aptamer conjugate. When the sample is dropped onto the sample pad, the liquid in the sample flows forward under capillary action, first binding with the gold-labeled nucleic acid aptamers on the conjugate pad to form a complex. The complex then continues to flow forward, reaching the detection line, where it binds with the nucleic acid aptamers immobilized on the detection line, producing a visible red band. By observing the color intensity of the detection line and the control line, qualitative or semi-quantitative analysis of the target *E. coli* in the sample can be performed. This lateral flow chromatography test strip has the advantages of simple operation, speed, and visualization, making it suitable for rapid on-site detection.

[0026] Specifically, (1) an ssDNA library containing 40–60 nt random sequences was constructed, and the AlphaFold 3 model was used to predict the three-dimensional complex of the target E. coli OmpA protein structure with the ssDNA library. Constructing an ssDNA library containing 40–60 nt random sequences was to ensure library diversity. Longer sequence lengths provide more structural information and binding sites, which is beneficial for screening high-affinity nucleic acid aptamers. The AlphaFold 3 model can predict the three-dimensional complex of the target protein with each sequence in the ssDNA library, simulating their interactions at the atomic level, providing accurate data support for subsequent screening.

[0027] (2) Candidate nucleic acid aptamer sequences with binding energy ≤ -30 kJ·mol⁻¹ and high stability were selected based on indicators such as total binding energy, number of interfacial hydrogen bonds, and molecular dynamics RMSD. Total binding energy reflects the tightness of binding between the nucleic acid sequence and the target protein; the lower the binding energy, the tighter the binding. The number of interfacial hydrogen bonds is one of the important indicators for measuring the interaction between the nucleic acid sequence and the target protein; the formation of hydrogen bonds can enhance the binding stability between them. Molecular dynamics RMSD (root mean square deviation) is used to evaluate the structural stability of the nucleic acid sequence-target protein complex during the simulation process; the smaller the RMSD value, the more stable the structure of the complex. By comprehensively considering these indicators, candidate nucleic acid aptamer sequences with binding energy ≤ -30 kJ·mol⁻¹ and high stability are selected, ensuring that the screened nucleic acid aptamers have high affinity and good stability.

[0028] (3) Candidate aptamers were synthesized in vitro, and their dissociation constants (KD) with the target antigen were verified using enzyme-linked nucleic acid adsorption assay (ELONA) and surface plasmon resonance (SPR). The in vitro synthesis of candidate aptamers provided the material basis for subsequent affinity assays and test strip preparation. ELONA and SPR are two commonly used methods for determining affinity. The ELONA method is simple to operate and low in cost, making it suitable for large-scale screening; the SPR technology has advantages such as real-time operation, label-free operation, and high sensitivity, providing more accurate binding kinetic parameters. By using these two methods to verify the dissociation constants (KD) between candidate aptamers and the target antigen, a comprehensive understanding of their affinity can be obtained, providing a basis for screening the optimal nucleic acid aptamer.

[0029] (4) Nucleic acid aptamers with an affinity KD ≤ 30 nM are modified with a 5' terminal amino group and coupled to the carboxyl activation site on a nitrocellulose membrane to construct a test line. Modifying the 5' terminal amino group of the nucleic acid aptamer with an affinity KD ≤ 30 nM enables it to undergo a coupling reaction with the carboxyl activation site on the nitrocellulose membrane, thereby immobilizing the nucleic acid aptamer on the membrane. This immobilization method is simple to operate, has good stability, and can ensure the activity and specificity of the nucleic acid aptamer during the detection process. Constructing the test line is one of the key steps in test strip preparation, and the quality of the test line directly affects the accuracy and reliability of the detection results.

[0030] (5) Prepare the gold nanoparticle-nucleic acid aptamer conjugate and spray it onto the conjugate pad to complete the test strip assembly. The preparation of the gold nanoparticle-nucleic acid aptamer conjugate utilizes the unique optical properties of gold nanoparticles and the high specificity of nucleic acid aptamers, combining the two through chemical bonds. Gold nanoparticles exhibit strong absorption and scattering characteristics in the visible light region; when bound to the nucleic acid aptamer, they produce a noticeable color change during detection, easily observed by the naked eye. The conjugate is sprayed onto the conjugate pad to provide reactants for subsequent detection. After the test strip assembly is complete, all components work together to achieve rapid detection of the target *E. coli* in the sample.

[0031] (6) After the sample is added to the sample pad, if the sample contains a target antigen, it will form a complex with the gold-labeled nucleic acid aptamer and be immobilized on the nucleic acid aptamer of the test line, producing a visible red band. When the sample is added to the sample pad, the liquid in the sample flows forward under capillary action, first binding with the gold-labeled nucleic acid aptamer on the conjugate pad to form a complex. If the sample contains a target antigen, the complex will continue to flow forward, and when it reaches the test line, it will bind with the nucleic acid aptamer immobilized on the test line, causing the gold nanoparticles to aggregate and produce a visible red band. This visual detection method is simple to operate, provides intuitive results, requires no complex instruments or equipment, and is suitable for rapid on-site detection.

[0032] (7) Qualitative or semi-quantitative analysis of the target antigen is performed by measuring the color intensity of the test line and the control line. The control line is used to determine whether the test strip is working properly. Usually, other substances that can bind to the gold-labeled nucleic acid aptamer are fixed on the control line. When the test strip is working properly, the control line will always show a red band. By observing the color intensity of the test line and the control line, the target antigen in the sample can be qualitatively or semi-quantitatively analyzed. If a red band appears on the test line, it indicates that the sample contains the target antigen; based on the ratio of the color intensity of the test line and the control line, the content of the target antigen can also be semi-quantitatively estimated. This analytical method is simple and easy to implement, and can meet the needs of rapid on-site testing.

[0033] The nucleic acid aptamer contains an amino group at its 5' end. This amino group modification enables chemical coupling between the aptamer and nitrocellulose membranes or other carriers. The amino-modified aptamer reacts with active groups such as carboxyl and epoxy groups on the carrier surface to form stable covalent bonds, thus immobilizing the aptamer on the carrier. This immobilization method is simple to operate, has good stability, and ensures the activity and specificity of the aptamer during detection. Furthermore, the amino group modification does not affect the binding ability of the aptamer to the target protein, ensuring the accuracy and reliability of the detection. (In chemical coupling, the reaction between amino and carboxyl groups is a common coupling method. Using activators such as EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and NHS (N-hydroxysuccinimide) can improve the efficiency and specificity of the reaction. EDC activates the carboxyl group, making it easier for it to react with the amino group, while NHS forms a stable intermediate, further improving the stability of the coupling. This chemical coupling method firmly immobilizes nucleic acid aptamers on nitrocellulose membranes, providing a stable basis for subsequent detection.)

[0034] In step c), the nucleic acid aptamer is immobilized using EDC / NHS activation coupling. EDC / NHS activation coupling is a commonly used chemical coupling method with wide applications in the field of biomolecule immobilization. EDC is a carbodiimide compound that can activate carboxyl groups, forming an active intermediate. NHS is an activator that reacts with the carboxyl groups activated by EDC to form a stable NHS ester. NHS esters have high reactivity and can react with amino groups to form stable amide bonds. In the process of immobilizing nucleic acid aptamers, the carboxyl groups on the nitrocellulose membrane are first activated with EDC and NHS to form NHS esters. Then, the amino-modified nucleic acid aptamer reacts with the activated carboxyl groups to form a stable covalent bond, thereby immobilizing the nucleic acid aptamer on the nitrocellulose membrane. This activation coupling method has the advantages of mild reaction conditions, high reaction efficiency, and good coupling stability, ensuring the activity and specificity of the nucleic acid aptamer during the detection process. Compared to traditional physical adsorption methods, the EDC / NHS activation coupling method exhibits stronger binding force and stability. Physical adsorption primarily relies on intermolecular forces to immobilize nucleic acid aptamers on the support; these forces are relatively weak and easily affected by environmental factors, leading to aptamer detachment. In contrast, the EDC / NHS activation coupling method immobilizes nucleic acid aptamers on the support through the formation of stable covalent bonds, resisting interference from the external environment and ensuring the accuracy and reliability of the detection.

[0035] The carrier membrane of the lateral flow test strip is a 90–135 s / 4 cm nitrocellulose membrane. The nitrocellulose membrane is a crucial component of the lateral flow test strip, and its performance directly affects the test strip's detection efficiency. A 90–135 s / 4 cm nitrocellulose membrane possesses a suitable pore structure and flow rate, ensuring uniform flow of the liquid in the sample across the membrane and facilitating the full binding of nucleic acid aptamers to target proteins. If the pores are too large and the flow rate is too fast, insufficient binding of nucleic acid aptamers to target proteins will occur, affecting detection sensitivity; if the pores are too small and the flow rate is too slow, it will prolong detection time and reduce detection efficiency. Therefore, selecting a nitrocellulose membrane with appropriate pore structure and flow rate is crucial for ensuring the test strip's detection performance. (In addition, nitrocellulose membranes possess excellent protein binding capacity and chemical stability, providing stable support for the immobilization of nucleic acid aptamers. When preparing test strips, the nitrocellulose membrane needs to be pretreated, such as soaking or drying, to improve its performance and stability. Simultaneously, attention must be paid to the storage conditions of the nitrocellulose membrane to avoid moisture and contamination, ensuring the quality of the test strips and the detection effect.)

[0036] The gold-labeled conjugate is a combination of gold nanoparticles with a diameter of 20–40 nm and nucleic acid aptamers. Gold nanoparticles possess unique optical properties, exhibiting strong absorption and scattering characteristics in the visible light region. These optical properties are most pronounced when the diameter of the gold nanoparticles is between 20–40 nm, producing a noticeable color change during detection, easily observed with the naked eye. By combining gold nanoparticles with nucleic acid aptamers to form the gold-labeled conjugate, the high specificity of the nucleic acid aptamers in recognizing the target antigen is utilized. When the target antigen is present, the gold-labeled conjugate binds to the target antigen to form a complex, which aggregates on the detection line, producing a red band. This visual detection method based on gold nanoparticles is simple to operate, provides intuitive results, requires no complex instruments, and is suitable for rapid on-site detection. There are various methods for preparing gold nanoparticles, such as chemical reduction and physical methods. Chemical reduction is a commonly used method, where gold ions are reduced to gold nanoparticles by reacting a chloroauric acid solution with a reducing agent (such as sodium citrate or sodium borohydride). During preparation, the diameter and dispersibility of the gold nanoparticles can be adjusted by controlling reaction conditions (such as reaction temperature, reducing agent concentration, and reaction time). The prepared gold nanoparticles need to be coupled with nucleic acid aptamers. Common coupling methods include electrostatic adsorption and covalent bonding. Electrostatic adsorption utilizes the electrostatic interaction between the negative charge on the surface of the gold nanoparticles and the positive charge on the surface of the nucleic acid aptamer to achieve coupling; covalent bonding involves modifying the surface of the gold nanoparticles with active groups (such as thiol or amino groups), which react with the corresponding groups on the nucleic acid aptamer to form covalent bonds. By selecting appropriate coupling methods, stable and highly active gold-labeled conjugates can be prepared, providing a reliable material basis for test strip detection.

[0037] The nucleic acid aptamer was then modified and immobilized onto the nitrocellulose membrane detection line to assemble the test strip. An E. coli nucleic acid aptamer with the nucleotide sequence: GCCTTGCCAAGTAACGGCCG,TTGGATCCGATTGACTGCTCGTACTT, obtained through optimization, exhibits higher affinity for the target and a KD value of 35 nM for the E. coli OmpA protein. (This nucleic acid aptamer was obtained through screening and optimization of a random ssDNA library. During the screening process, the AlphaFold 3 model was used to model the complex and assess the affinity between the target *E. coli* OmpA protein structure and the random ssDNA sequence, selecting candidate nucleic acid aptamers with high affinity. Then, the sequence and structure of the candidate nucleic acid aptamers were further optimized through in vitro synthesis and affinity assays to improve their affinity and specificity to the target protein. The final nucleic acid aptamer sequence GCCTTGCCAAGTAACGGCCG,TTGGATCCGATTGACTGCTCGTACTT exhibits high affinity for the *E. coli* OmpA protein.)

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] By avoiding antibody protein expression and purification processes, the preparation cost is significantly reduced.

[0040] The aptamer structure is stable and not easily inactivated, which improves the shelf life and environmental tolerance of the test strip products.

[0041] AlphaFold 3's computational-assisted screening improves aptamer hit rate and shortens the R&D cycle;

[0042] Its sensitivity and specificity are no less than those of traditional antigen-antibody systems.

[0043] Example 2

[0044] This embodiment discloses a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening, which adopts the preparation method of the nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening in Embodiment 1.

[0045] A nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening, comprising:

[0046] Sample pad: Used to hold the sample to be tested, allowing the sample to move to subsequent components during chromatography;

[0047] Binding pad: It is provided with a gold nanoparticle-nucleic acid aptamer conjugate. The gold nanoparticles have a diameter of 20-40 nm. The nucleic acid aptamer is a high-affinity nucleic acid aptamer obtained by modeling the complex of the target E. coli OmpA protein structure and random single-stranded DNA sequence using the AlphaFold 3 artificial intelligence structure prediction model and screening based on binding energy. When the sample flows through the binding pad, the target antigen in the sample can form a complex with the gold-labeled nucleic acid aptamer.

[0048] Nitrocellulose membrane carrier: The nitrocellulose membrane is equipped with detection lines and quality control lines;

[0049] Detection line: An aptamer with an affinity of no more than 40 nM is immobilized by EDC / NHS activation coupling. The aptamer has an amino group modified at the 5' end to capture the gold-labeled aptamer complex containing the target antigen flowing from the binding pad, thus immobilizing the complex at the detection line position.

[0050] Control line: Set on the nitrocellulose membrane to provide a reference for test results;

[0051] Under chromatography, the sample to be tested flows sequentially from the sample pad through the conjugation pad and the nitrocellulose membrane carrier. The target Escherichia coli in the sample is qualitatively or semi-quantitatively analyzed by the color intensity of the detection line and the control line.

[0052] Figures 1-3 The flowchart illustrates the binding process of E. coli OmpA protein and nucleic acid aptamers on a test strip according to the method of the present invention; as shown in the figure. Figure 1 A schematic diagram of the OmpA protein in *Escherichia coli* before it binds to the nucleic acid aptamer; Figure 2 The OmpA protein in *Escherichia coli* binds to the nucleic acid aptamer without translocation. Figure 3 The OmpA protein of *Escherichia coli* and its nucleic acid aptamer complex migrate to the detection line T, resulting in color development.

[0053] The above description is an explanation of the present invention and not a limitation thereof. The scope of the present invention is defined by the claims. Within the scope of protection of the present invention, any form of modification may be made.

Claims

1. A nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening, characterized in that, include: Sample pad: Used to hold the sample to be tested, allowing the sample to move to subsequent components during chromatography; Binding pad: It is provided with a gold nanoparticle-nucleic acid aptamer conjugate. The gold nanoparticles have a diameter of 20-40 nm. The nucleic acid aptamer is a high-affinity nucleic acid aptamer obtained by modeling the complex of the target E. coli OmpA protein structure and random single-stranded DNA sequence using the AlphaFold 3 artificial intelligence structure prediction model and screening based on binding energy. When the sample flows through the binding pad, the target antigen in the sample can form a complex with the gold-labeled nucleic acid aptamer. Nitrocellulose membrane carrier: The nitrocellulose membrane is equipped with detection lines and quality control lines; Detection line: An aptamer with an affinity of no more than 40 nM is immobilized via EDC / NHS activation coupling. This aptamer contains an amino group modified at its 5' end to capture the gold-labeled aptamer complex containing the target antigen flowing from the binding pad, thus immobilizing the complex at the detection line position; Control line: Set on a nitrocellulose membrane to provide a control for the test results; Under chromatography, the sample to be tested flows sequentially from the sample pad through the conjugation pad and the nitrocellulose membrane carrier. The target Escherichia coli in the sample is qualitatively or semi-quantitatively analyzed by the color intensity of the detection line and the control line.

2. A method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening, characterized in that, Includes the following steps: Nucleic acid aptamer screening steps: The AlphaFold 3 artificial intelligence structure prediction model was used to model the complex of the target E. coli OmpA protein structure and random single-stranded DNA sequence, and candidate nucleic acid aptamers were screened based on binding energy; specifically: Construct an ssDNA library containing 40-60 nt random sequences; The AlphaFold 3 model was used to predict the three-dimensional complex structure of the target E. coli OmpA protein with the ssDNA library. Candidate nucleic acid aptamer sequences with binding energy ≤ -30 kJ·mol⁻¹ and high stability were selected based on indicators such as total binding energy, number of interfacial hydrogen bonds and molecular dynamics RMSD. Nucleic acid aptamer verification steps: The candidate nucleic acid aptamer was synthesized in vitro and its dissociation constant (KD) with the target antigen was verified by enzyme-linked nucleic acid adsorption assay (ELONA) and surface plasmon resonance (SPR). The test strip assembly includes the following steps: Nucleic acid aptamers with an affinity KD≤30nM were modified with a 5' terminal amino group and coupled to the carboxyl activation site on a nitrocellulose membrane to construct a test line; A gold nanoparticle-nucleic acid aptamer conjugate was prepared and sprayed onto a conjugate pad, wherein the gold nanoparticles had a diameter of 20-40 nm. Assemble the sample pad, conjugate pad, nitrocellulose membrane carrier (flow rate 90-135s / 4cm), control line and absorbent pad in sequence to complete the test strip assembly; Used to detect target E. coli in samples, after the sample is dropped onto the sample pad, if the sample contains target antigen, it will form a complex with the gold-labeled nucleic acid aptamer and be immobilized on the nucleic acid aptamer of the test line, producing a visible red band. The target antigen can be qualitatively or semi-quantitatively analyzed by the color intensity of the test line and the control line.

3. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid aptamer is: GCCTTGCCAAGTAACGGCCG,TTGGATCCGATTGACTGCTCGTACTT, and the KD value of this nucleic acid aptamer for Escherichia coli OmpA protein is 35 nM.

4. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, In the nucleic acid aptamer screening step, after constructing a random ssDNA library, the library is first preliminarily screened to remove sequences that obviously do not meet the requirements, and then AlphaFold 3 model prediction is performed.

5. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, In the nucleic acid aptamer validation process, when using ELONA and SPR for validation, multiple repeated experiments were set up, and the average value was taken as the final dissociation constant (KD) result.

6. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, In the test strip assembly step, when constructing the test line, the coupling conditions between the nucleic acid aptamer and the carboxyl activation site on the nitrocellulose membrane are controlled, including reaction time, temperature, and reactant concentration.

7. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, In the test strip assembly step, when preparing the gold nanoparticle-nucleic acid aptamer conjugate, the ratio of gold nanoparticles to nucleic acid aptamers is controlled to ensure the stability and activity of the conjugate.

8. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, In the test strip assembly step, when spraying the gold nanoparticle-nucleic acid aptamer conjugate onto the conjugate pad, the uniformity and amount of spraying should be controlled.

9. The method for preparing a nucleic acid aptamer test strip for detecting Escherichia coli using AlphaFold 3-assisted screening according to claim 2, characterized in that, The nitrocellulose membrane carrier (with a flow rate of 90-135 s / 4 cm).

Images