Application of FHL2-L4 peptide fragment in preparation of medicine for treating atherosclerosis
By developing the FHL2-L4 peptide and its related vectors and viruses, gene editing targeting vascular smooth muscle cells was achieved, significantly inhibiting the formation of atherosclerotic plaques. This solves the problem of the lack of effective treatment methods in existing technologies and provides a new treatment approach for atherosclerosis.
Patent Information
- Application Number
- CN202511136556.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-14
- Publication Date
- 2025-11-18
AI Technical Summary
Current technologies lack effective drugs for treating atherosclerosis, especially in terms of treatment methods other than lowering LDL cholesterol, and gene therapy vectors targeting vascular smooth muscle cells have not yet addressed the delivery of FHL2 functional peptides.
We provided the FHL2-L4 peptide and its encoding gene, expression cassette, recombinant vector, recombinant cells or bacteria, overexpression vector, targeting sgRNA, and gene knockout vector. Through AAV-mediated specific overexpression or knockout of VSMCs, we demonstrated the role of the FHL2-L4 peptide in atherosclerosis and developed corresponding viral vectors for treatment.
Specific knockout of the FHL2-L4 peptide significantly inhibited atherosclerotic plaque formation, reduced plaque area by 18.2%, and was associated with inhibition of the CCL19/21 signaling pathway, providing a breakthrough therapeutic strategy for atherosclerosis.
Smart Images

Figure CN120965848A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular mechanism and treatment of cardiovascular diseases, and particularly relates to application of a FHL2-L4 peptide segment in preparation of a drug for treating atherosclerosis. BACKGROUND
[0002] Atherosclerosis is the main pathological basis of cardiovascular and cerebrovascular diseases, and atherosclerotic plaque rupture and thrombosis are the main causes of acute coronary syndrome and sudden cardiac death. The concentration of low-density lipoprotein cholesterol (LDL-C) is considered to be a major cardiovascular risk factor. However, in addition to successfully lowering LDL-C through lifestyle interventions or therapeutic drugs such as statins, many clinical trials have noted that many patients have residual cardiovascular disease risk, suggesting that in addition to traditional risk factor treatment, there is currently a lack of more effective therapeutic drugs and new treatment methods for atherosclerosis.
[0003] FHL2 (Four and a Half LIM Domains 2) protein is expressed in various tissues, but its function in vascular smooth muscle cells (VSMCs) has not been clearly defined. Existing studies have shown that FHL2 is involved in the regulation of smooth muscle cell cytoskeleton, but there is no direct association between FHL2 and atherosclerosis. In the prior art, gene therapy vectors targeting VSMCs (such as AAV) have been used to deliver therapeutic genes, but have not been used to deliver functional peptide segments of FHL2. SUMMARY
[0004] The present application aims to solve the technical problem of providing a FHL2-L4 peptide segment and its gene.
[0005] The present application also aims to solve the technical problem of providing an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacteria.
[0006] The present application also aims to solve the technical problem of providing an overexpression vector.
[0007] The present application also aims to solve the technical problem of providing an sgRNA targeting the fhl-l4 gene.
[0008] The present application also aims to solve the technical problem of providing a gene knockout vector.
[0009] The present application also aims to solve the technical problem of providing a virus.
[0010] The technical problems to be solved by the present application are also to provide the FHL2-L4 peptide, the fhl-l4 gene encoding the FHL2-L4 peptide, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the overexpression vector, the sgRNA, the gene knockout vector, and the virus in the preparation of a drug for treating atherosclerosis.
[0011] Technical scheme: In order to solve the above technical problems, the present application provides a FHL2-L4 peptide, the amino acid sequence of which is shown in SEQ ID NO. 1.
[0012] The present application also includes a fhl-l4 gene encoding the FHL2-L4 peptide, the nucleotide sequence of which is shown in SEQ ID NO. 2.
[0013] The present application also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacteria containing the fhl-l4 gene.
[0014] The present application also includes an overexpression vector containing the fhl-l4 gene.
[0015] The overexpression vector is obtained by introducing the fhl-l4 gene into a plasmid.
[0016] The present application also includes an sgRNA targeting the fhl-l4 gene, the DNA sequence of which is shown in SEQ ID NO. 3 and / or SEQ ID NO. 4.
[0017] The present application also includes a gene knockout vector containing the sgRNA.
[0018] The gene knockout vector is obtained by introducing the sgRNA into a plasmid.
[0019] The present application also includes a virus packaging the overexpression vector or the gene knockout vector.
[0020] The present application also includes the FHL2-L4 peptide, the fhl-l4 gene encoding the FHL2-L4 peptide, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the overexpression vector, the sgRNA, the gene knockout vector, and the virus in the preparation of a drug for treating atherosclerosis.
[0021] The present application proves for the first time that FHL2 overexpression in VSMCs significantly accelerates mouse atherosclerosis (33.1% increase in plaque area, p=0.001) and promotes the expression of pro-atherogenic chemokines CCL19 and CCL21 in the aorta through AAV-mediated VSMCs-specific overexpression / knockout experiments. FHL2 is divided into four peptide segments L1-L4, and it is found that L4 overexpression can reproduce the pro-atherogenic plaque-promoting effect of full-length FHL2 in Ldlr - / - mice fed a high-fat diet for 12 weeks.
[0022] Beneficial effects: Compared with the prior art, the present application has the following significant advantages: the present application first discovers that the L4 peptide segment is the smallest functional unit of FHL2 promoting atherosclerosis, and its specific knockout can significantly inhibit plaque formation (↓18.2%, p=0.014), and this effect is directly related to the inhibition of the CCL19 / 21 signaling pathway. Based on this, gene editing or antagonistic peptide design targeting L4 can be a breakthrough strategy for atherosclerosis treatment. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 Histological data for FHL2 overexpression accelerating atherosclerosis (with plaque staining diagram) and fluorescence quantitative qPCR detection results of CCL19, CCL21, ACTA2 (contractile phenotype marker), CNN1 (contractile phenotype marker) genes in FHL2 overexpression mice, wherein OE-Fhl2-AAV1 refers to Ldlr - / - mice injected with systemic FHL2 overexpression adeno-associated virus, Scramble-AAV1 refers to Ldlr - / - mice injected with the same amount of empty adeno-associated virus;
[0024] Figure 2 FHL2 peptide truncation schematic diagram;
[0025] Figure 3 FHL2-L4 peptide overexpression impact on plaque area comparison diagram and fluorescence quantitative qPCR detection results of CCL19, CCL21, ACTA2 (contractile phenotype marker), CNN1 (contractile phenotype marker) genes in FHL2-L4 overexpression mice. Among them, FHL2-L4 refers to Ldlr - / - mice injected with the same amount of empty adeno-associated virus, NC refers to Ldlr - / - mice injected with the same amount of empty adeno-associated virus;
[0026] Figure 4Figure A is a comparison chart of the effect of FHL2-L4 peptide segment knockout on plaque area, and Figure B is a chart of the results of Elisa detection of serum CCL19 and CCL21 levels in FHL2-L4 knockout mice. △SMC Ldlr - / - mice injected with FHL2-L4 adeno-associated virus specific for vascular smooth muscle cells, △WT Ldlr - / - mice injected with an equal amount of empty adeno-associated virus; Figure 4 Figure A is a comparison chart of the effect of FHL2-L4 peptide segment knockout on plaque area, Figure 4 Figure B is a chart of the results of Elisa detection of serum CCL19 and CCL21 levels in FHL2-L4 knockout mice, Figure 4 Figure C is a chart of the results of fluorescent quantitative qPCR detection of CCL19, CCL21, ACTA2 (contractile phenotype marker), and CNN1 (contractile phenotype marker) genes in FHL2-L4 peptide segment knockout mice.
[0027] Figure 5 Figure A is a chart of the results of fluorescent quantitative qPCR detection of CCL19, CCL21, ACTA2 (contractile phenotype marker), and CNN1 (contractile phenotype marker) genes in FHL2-L4 peptide segment knockout mice. DETAILED DESCRIPTION
[0028] The technical solutions of the present application will be further described below in conjunction with the accompanying drawings.
[0029] Example 1 AAV vector construction
[0030] 1. Construction of gene knockout vector
[0031] 1) Design and synthesis of sgRNA sequence: The sgRNA sequence was designed based on targeting the L4 domain of the mouse Fhl2 gene, and the specific sequence is as follows:
[0032] mFhl2-sgRNA-A1: GAAGCGGGAGTGGGAGGGTTG SEQ ID NO. 3
[0033] mFhl2-sgRNA-A2: CTTCCCATCCGGGGCTTACGG SEQ ID NO. 4
[0034] 2) mFhl2-sgRNA-A1 and mFhl2-sgRNA-A2 are inserted downstream of U6 promoter respectively to obtain U6-mFhl2-sgRNA-A1-U6-mFhl2-sgRNA-A2, and the gene fragment is inserted upstream of EnSM22a promoter in AAV-NC vector to construct the vector pAAV-U6>(mFhl2-sgRNA-A1 / A2)-EnSM22a>SaCas9. Wherein, the AAV-NC vector is a control vector, the sequence of the AAV-NC vector is shown as SEQ ID NO. 5, and the construction of the vector is entrusted to SAI Life Science (Suzhou) Co., Ltd.
[0035] Wherein, the sequence of the EnSM22a promoter is shown as SEQ ID NO. 6;
[0036] GCGCGGGGTGCAGGGTGCCCTCCCCCGCACCGGCCGAGCCGAGAGGCCGCGAGG
[0037]
[0038] 3, the construction of the vector is entrusted to SAI Life Science (Suzhou) Co., Ltd. Sanger sequencing is performed on the recombinant plasmid to confirm the correctness of the sgRNA and SaCas9 sequences (primer: M13 universal primer). Double enzyme digestion is performed using restriction endonuclease EcoRI and BamHI, and the size of the vector fragment is verified by electrophoresis to be consistent with the expected size.
[0039] In this embodiment, the sgRNA-A1 / A2 combined targeting knockout efficiency reaches 70% (the expression of aortic FLAG tag protein is detected by Western blot).
[0040] 2, gene overexpression vector construction
[0041] 1) Target sequence: mouse Fhl2 gene L4 peptide segment (aa 217-279, NCBI: NM_010212.5 of Fhl2 gene), C-terminal fusion 3xFLAG tag.
[0042] The amino acid sequence of the FHL2-L4 peptide segment is SEQ ID NO. 1
[0043]
[0044] The corresponding nucleic acid sequence is SEQ ID NO. 2
[0045]
[0046] 2) Construction of overexpression vector AVV:
[0047] The synthetic Kozak-FHL2-L4-3xFLAG gene fragment sequence is as follows: SEQ ID NO. 7
[0048]
[0049]
[0050] The above gene fragment is inserted into the downstream of EnSM22a promoter of AAV-NC vector (the sequence is shown in SEQ ID NO. 5) to obtain a vector overexpressing FHL2-L4, and the construction vector is entrusted to Sanyou (Suzhou) Biotechnology Co., Ltd. for synthesis. The sequence integrity is confirmed by PCR amplification (primers: F: 5'-GCCGGGGTGCAGGGTGCC-3', R: 5'-TTACTTGTACAGCTCGTCCA-3') and sequencing. The overexpression FHL2 vector OE-Fhl2-AAV1 is constructed in the same way.
[0051] 3. Virus packaging and purification
[0052] (1) 293T cell resuscitation: take the cells out of liquid nitrogen, thaw in a 37°C water bath, and transfer to a preheated complete culture medium (DMEM culture medium containing 10% fetal bovine serum) and centrifuge at 200xg for 5 min, discard the supernatant, resuspend the cells in a T75 cell culture flask, and culture at 37°C, 5% CO2.
[0053] (2) 293T cell amplification culture: when the cell culture is about 48-72 h and the confluence reaches 80-90%, the subculture can be carried out. Take out the cells, discard the supernatant, digest with an appropriate amount of 0.25% trypsin, add 3 times the volume of complete culture medium to terminate digestion, resuspend the cells, and inoculate the new culture flask at a 50% inoculation amount, and culture at 37°C, 5% CO2.
[0054] (3) Transfection: when the cell culture is 48±4 h and the confluence rate reaches 80%-90%, transfection can be carried out. The gene knockout vector constructed in step 1, the AAV-NC plasmid and the overexpression vector obtained in step 2, and the auxiliary plasmids pHelper Vector and pRC Vector (provided by Sanyou (Suzhou) Biotechnology Co., Ltd.) are mixed in a volume ratio of 1:1:1 to prepare A liquid in DMEM. Polyethyleneimine (purchased from polyscience company) is mixed with A liquid in a volume ratio of 1:3 to prepare B liquid. After mixing B liquid, stand for 30 min to form the transfection complex. The transfection complex is mixed with an appropriate amount of DMEM medium, and then added to the 293T cells with discarded supernatant, and cultured at 37°C, 5% CO2.
[0055] (4) Collection of virus: 48-72h after transfection, the supernatant and the cells were collected. The cells were added with an appropriate amount of cell lysis solution containing nuclease, incubated at 37°C for 2-3h, centrifuged at 3000xg for 10min, and the supernatant was collected and stored at 4°C. The supernatant was centrifuged at 1000xg for 5min, and the supernatant was collected. 50% PEG 8000 was added to a final concentration of 12%, and the supernatant was precipitated at 4°C. The precipitate was resuspended with cell lysis solution to obtain the sample to be purified.
[0056] (5) An Ultra-Clear centrifuge tube was taken, and gradient concentrations of Iodixanol were sequentially added to the bottom: 0.5mL 60% Iodixanol, 2mL 40% Iodixanol, 1.5mL 25% Iodixanol, 1.5mL 15% Iodixanol, and the virus suspension purified in (4) was added, and finally the cell lysis solution was added to balance;
[0057] (6) 10°C, 230000g, centrifuge speed setting 8, deceleration setting 9, ultracentrifugation for 18h. A 100kD ultrafiltration tube was taken, and the filter membrane was soaked with 1mL PBS buffer;
[0058] (7) The 40% Iodixanol-60% Iodixanol intermediate liquid layer in the ultracentrifuge tube was carefully extracted with a pipette, avoiding the absorption of protein, and transferred to the ultrafiltration tube;
[0059] (8) A 100kD ultrafiltration tube was taken, and the filter membrane was soaked with 1mL PBS buffer;
[0060] (9) The 40% Iodixanol-60% Iodixanol intermediate liquid layer in the ultracentrifuge tube was carefully extracted with a pipette, avoiding the absorption of protein, and transferred to the ultrafiltration tube;
[0061] (10) An appropriate amount of PBS buffer was added to the ultrafiltration tube and blown evenly, centrifuged at 4500g for 3-5min, and the step was repeated 5-7 times to remove Iodixanol;
[0062] (11) The last time was concentrated to 1mL, the filter membrane was washed with an appropriate amount of PBS buffer, transferred to an EP tube, filtered with a 0.22μm needle filter, and the final products of adeno-associated virus were obtained: packaged knock-out AAV vector virus, AAV vector overexpressing FHL2 and AAV vector overexpressing FHL2-L4, and AAV-NC plasmid packaged virus.
[0063] Example 2 Animal experiment
[0064] 1. Source of experimental animals
[0065] Jiangsu Jiju Yakang Biotechnology Co., Ltd. purchased Ldlr - / - A total of 48 mice (C57BL / 6J background, male, 8 weeks old) were used.
[0066] 2. Construction of mouse model of AAV intervention and arterial atherosclerosis
[0067] The virus constructed in Example 1 was used to group the mouse model purchased in Step 1, and the grouping was as follows:
[0068] Experimental group 1: 12 mice were injected with packaged viruses of the knock-out AAV vector (containing sgRNA-A1 / A2+SaCas9) constructed in Example 1;
[0069] Experimental group 2: 8 mice were injected with packaged viruses of the overexpression AAV vector (containing FHL2-L4-3xFLAG) constructed in Example 1;
[0070] Experimental group 3: 8 mice were injected with packaged viruses of the AAV vector overexpressing FHL2 (OE-Fhl2-AAV1) constructed in Example 1;
[0071] Control group: 20 mice were injected with packaged viruses of the control AAV (AAV-NC plasmid, referring to the vector AAV containing the EnSM22a promoter sequence, the sequence is shown as SEQ ID NO. 5).
[0072] The specific steps are as follows: according to the above grouping, at the age of 8 weeks, the mice were injected with the viruses constructed in Example 1 (100 μL per mouse), and the specific dose was 1×10 13 vg per mouse (titer ≥ 1×10 13 vg / ml). AAV injection was only once. At the same time, the mice were fed with high-fat diet (free access to custom-made feed containing 1.25% cholesterol and 15% fat (feed model: D12108C, Research Diets) for 12 weeks from the age of 8 weeks to construct the atherosclerosis model, and the atherosclerotic plaque and other related indicators of the mice were detected at the age of 20 weeks.
[0073] 3. Experimental results and analysis
[0074] 1) Histological detection: at 12 weeks of high-fat diet feeding, the mice were sacrificed by excessive anesthesia and inhalation. Immediately after the mice were sacrificed, they were perfused with phosphate buffer solution (PBS). The aortic root and ascending aorta were isolated, cut longitudinally up to the brachiocephalic trunk level, and the surrounding fat was removed. The samples were fixed with 4% paraformaldehyde and stained with 0.5% oil red O (37°C, 30 min). The plaque area ratio (plaque area / total aortic area) was calculated using ImageJ software. As shown in Figure 1 andFigure 3 As shown in Figs. 1C and 1D, the FHL2 overexpression group increased by 33.1% (p=0.001), and the FHL2-L4 overexpression group increased by 56.2% (p=0.001). It can be seen that overexpression of the L4 peptide segment (while the L1-L3 peptide segments do not have the relevant function) can completely reproduce the full-length FHL2 effect of promoting atherosclerosis, proving that L4 is the core functional domain of FHL2. From Figure 4 As shown in Figs. 1C and 1D, the FHL2 overexpression group increased by 33.1% (p=0.001), and the FHL2-L4 overexpression group increased by 56.2% (p=0.001). It can be seen that overexpression of the L4 peptide segment (while the L1-L3 peptide segments do not have the relevant function) can completely reproduce the full-length FHL2 effect of promoting atherosclerosis, proving that L4 is the core functional domain of FHL2. From
[0075] 2) Molecular mechanism detection: The aortic tissues of each group of mice were separated, and TRIzol reagent (Invitrogen, 15596026) was used to extract total messenger RNA from the tissues. RNA samples (1 μg) were reversely transcribed into cDNA using PrimeScript TM RT Master Mix (Takara, RR036A) at 42°C for 60 min, and then reverse transcription was performed at 95°C for 3 min in a T100 thermal cycler (Bio-Rad). RT-PCR was performed using a CFX96TM Real-time RT-PCR system (Bio-Rad) using qPCR SYBR Green Master Mix (Yeasen, 11202ES60) at 95°C for 15 min, followed by 40 cycles of 94°C for 20 s and 60°C for 34 s. The fluorescence quantitative qPCR reaction system is shown in Table 1, and the primer sequences are shown in Table 2.
[0076] Table 1 Fluorescence quantitative qPCR reaction system
[0077]
[0078] Table 2 Primer sequence table
[0079] Name Forward primer (5'-3') Reverse Primer (5'-3') CCL19 TCCTGGGAAGCTGGTGCAATG TCATCAGGGTCACAGTGCAAAGG CCL21 ATCCCGGCAATCCTGTTCTT AGTTCTCTTGCAGCCCTTGG ACTA2 GCTCCATCCTGGCCTCACTGT GAAAGGGTGTAAAACGCAGCTCA CNN1 GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT 18S GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
[0080] Fluorescence quantitative qPCR detection was performed on CCL19, CCL21, ACTA2 (marker of contractile phenotype), and CNN1 (marker of contractile phenotype), and the detection results are shown in Figs. 2A, 2B, 2C, and 2D. Figure 1 、 Figure 3 and Figure 4 As shown in Figs. 2A, 2B, 2C, and 2D, overexpression of FHL2 and overexpression of FHL2-L4 up-regulate chemokines CCL19 / 21 Figure 1 and Figure 3 ), promote inflammatory cell infiltration and smooth muscle cell phenotype conversion (ACTA2↓ / CNN1↓); from Figure 4As can be seen, knock-out of FHL2-L4, plaque reduction and significant correlation with CCL19 / 21 down-regulation (r=0.82, p<0.001) confirmed that targeting FHL2-L4 peptide segment can block disease progression. Mouse serum was taken for Elisa detection using CCL19 / CCL21 kit (R&D Systems, Cat#DY470 / DY457), and the detection results are as follows Figure 4 Figure 4 As shown in B, the serum CCL19 / 21 level of FHL2-L4 knock-out group decreased by 4.9-5.9% (p<0.01).
Claims
1. The FHL2-L4 peptide, characterized in that, Its amino acid sequence is shown in SEQ ID NO.
1.
2. Encoding the FHL2-L4 peptide fhl-l4 The gene, whose nucleotide sequence is shown in SEQ ID NO.
2.
3. An expression cassette, recombinant vector, recombinant cell, or recombinant bacteria, comprising the contents of claim 2. fhl-l4 Gene.
4. An overexpression vector, characterized in that, It contains the following as described in claim 2 fhl-l4 Gene.
5. The overexpression vector according to claim 4, characterized in that, The overexpression vector is used to express the... fhl-l4 The gene is obtained by introducing it into a plasmid.
6. A targeting method as described in claim 2 fhl-l4 The sgRNA of a gene is characterized by, The DNA sequence of the sgRNA is shown in SEQ ID NO.3 and / or SEQ ID NO.
4.
7. A gene knockout vector, characterized in that, It contains the sgRNA as described in claim 5.
8. The gene knockout vector according to claim 7, characterized in that, The gene knockout vector is obtained by introducing the sgRNA described in claim 6 into a plasmid.
9. A virus which is packaged from the overexpression vector of claim 4 or 5 or the gene knockout vector of claim 7 or 8.
10. The use of the FHL2-L4 peptide of claim 1, the fhl-l4 gene encoding the FHL2-L4 peptide of claim 2, the expression cassette, recombinant vector, recombinant cell or recombinant bacterium of claim 3, the overexpression vector of claim 4 or 5, the sgRNA of claim 6, the gene knockout vector of claim 7 or 8, and the virus of claim 9 in the preparation of a medicament for treating atherosclerosis.