Application of leucine-rich repeat receptor kinase gene OsHPCA1 to improve salt and oxidative stress tolerance of rice

Abstract

The application belongs to the field of plant genetic engineering, and discloses a key gene for positively regulating salt stress and oxidation stress tolerance of rice OsHPCA1 . The gene (accession number: Os05g40770) encodes a receptor protein specifically sensing hydrogen peroxide, which is classified into the leucine repeat receptor-like kinase (LRR-RLKs) family, which is the largest subfamily in the receptor-like kinase (RLKs) family. OsHPCA1 In response to salt and oxidation stress signals, the rice salt and oxidation stress tolerance is positively regulated. OsHPCA1 The overexpression rice strain shows strong salt tolerance; and OsHPCA1 the knockout strain oshpca1 is more sensitive to salt stress. OsHPCA1 The leucine repeat receptor protein kinase OsHPCA1 encoded by the gene can positively regulate the activity of catalase C (CatC) in the rice body, enhance the H2O2 clearance efficiency under salt stress, and thus improve the salt tolerance of the rice. When OsHPCA1 overexpressed, the activity of CatC in the overexpression strain OsHPCA1 is significantly increased, the H2O2 clearance capacity is enhanced, and the salt tolerance and oxidation stress tolerance of the rice are improved.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering. Specifically, this invention relates to... OsHPCA1 Application of genes to enhance rice's tolerance to salt and oxidative stress. Background Technology

[0002] As a major food crop in my country, the discovery and analysis of salt-tolerant genes in rice are of significant theoretical and practical importance for increasing rice yield, breeding new salt-tolerant varieties, and making full use of saline-alkali land. In recent years, some progress has been made in the breeding of salt-tolerant rice varieties and the analysis of their molecular mechanisms, but problems remain, such as the low salt tolerance of rice and the limited number of salt-tolerant genes available for breeding. Since salt tolerance in rice is a comprehensive expression regulated by multiple genes, further efforts are needed to discover salt-tolerant genes and innovate germplasm resources to cultivate higher-quality salt-tolerant rice varieties (Wang Cailin, Zhang Yadong, Zhao Ling, Zhu Zhen, Chen Tao, Zhao Qingyong, Yao Shu, Zhou Lihui, Zhao Chunfang, Liang Wenhua, Sun Mingfa, Yan Guohong. Current Status, Problems and Suggestions for Salt-Tolerant Rice Research. China Rice, 2019, 25, 1-6). Therefore, conducting research on the discovery of new salt-tolerant genes in rice and the creation of new germplasm resources, as well as studying their related mechanisms of action, has very important theoretical and practical significance.

[0003] Salt stress leads to the accumulation of reactive oxygen species (ROS) in plants, causing oxidative stress that severely inhibits plant growth and development and can even cause death. Among them, H2O2 is a very important ROS molecule, which can not only regulate intracellular signal transduction and biological processes, but also participate in many biological processes as a signaling molecule, including tolerance to biotic and abiotic stress (Jin Taicheng, Min Fei, Li Yidi, Ding Xiaoyue, Han Han, Shi Miao, Yang Liping. Molecular mechanism of abiotic stress-induced expression of defense genes in Arabidopsis thaliana [J]. Journal of Northeast Forestry University, 2023, 51(05):60-65). For example, in Arabidopsis, H2O2 was found to activate the LRR receptor kinase HPCA1 on the plasma membrane, causing HPCA1 autophosphorylation, activating calcium ion channels, and inducing stomatal closure (Wu F, Chi Y, Jiang Z, Xu Y, Pei ZM. Hydrogen peroxide sensor HPCA1 is an LRR receptor kinase in Arabidopsis. Nature, 2020, 578(7796): 577-581.). However, excessive ROS accumulation can affect the function of proteins, lipids, and nucleic acids, and if not cleared in time, it can lead to cell damage or even death. To clear excessive ROS accumulation, plants have developed adaptive mechanisms at multiple levels, including molecular, physiological, developmental, and morphological characteristics. Under stress conditions, the earliest plant response is usually a change in gene expression. The expression of a large number of genes is induced, and these gene products cause signal transduction, leading to biochemical, physiological and morphological changes involved in the final adaptation process, such as genes encoding membrane localization receptors, kinases, phosphatases, transcription factors and other regulatory proteins (Wu F, Chi Y, Jiang Z, Xu Y, Pei ZM. The receptor-like cytoplasmic kinase STRK1 phosphorylates and activates CatC, thereby regulating H2O2 homeostasis and improving salt tolerance in rice. Plant Cell, 2018, 30(5): 1100-1118).

[0004] Receptor-like protein kinases (RLKs) are a class of transmembrane proteins with an N-terminal extracellular domain and a C-terminal kinase domain. RLKs comprise a multi-gene family. To date, a large number of RLKs have been deduced from the complete genome sequences of Arabidopsis thaliana and rice. Among them, extracellular leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the most numerous subfamily in the plant receptor-like protein kinase family. There are 235 RLK family members in Arabidopsis, 309 in rice, and 467 in soybean, all possessing LRR receptor domains. LRR-RLKs sense environmental signals through extracellular leucine repeat domains and transmit signals through intracellular kinase domains, playing a pivotal role in growth, development, and stress responses (Coleman AD, Maroschek J, Raasch L, Takken FLW, Ranf S, Ralph Hückelhoven. The arabidopsis leucine‐rich repeatreceptor‐like kinase mik2 is a crucial component of early immune responses to a fungal‐derived elicitor. New Phytologist, 2021, 229(6): 3453-3466; Laohavisit A, Wakatake T, Ishihama N, Mulvey H, Takizawa K, Suzuki T, Shirasu K. Quinone perception in plants via leucine-rich-repeat). Receptor-like kinases. Nature, 2020, 587(7832): 92-97). For example, LRXs, RALF, and FER act as a module to transmit cell wall signals, thereby regulating plant growth and salt tolerance (Zhao C, Zayed O, Yu Z, Jiang W, Zhu P, Hsu CC, Zhang L, Tao WA, Lozano-Duran R, Zhu JK: Leucine-rich repeat extensin proteins regulate plant salt tolerance in Arabidopsis. Proc Natl Acad Sci U SA 2018, 115(51):13123-13128.).The bryophyte receptor protein kinase gene PnLRR-RLK2 acts as a positive regulator, enhancing Arabidopsis' response to salt and drought stress through heterologous expression of its antioxidant system and ABA-mediated signaling network (Wang J, Li C, Yao X, Liu S, Zhang P, Chen K: The Antarcticmoss leucine-rich repeat receptor-like kinase (PnLRR-RLK2) functions insalinity and drought stress adaptation. Polar Biology 2017, 41(2):353-364.). The expression of rice stress-induced protein kinase OsSIK1 is mainly induced by salt, drought, and H2O2. Overexpression of OsSIK1 in rice exhibits higher salt tolerance and stronger stems and leaves, while knockout mutants and RNA interference (RNAi) plants lead to increased sensitivity to these stresses (Ouyang SQ, Liu YF, Liu P, Lei G, He SJ, Ma B, Zhang WK, Zhang JS, Chen SY. Receptor-like kinase OsSIK1 improves drought and saltstress tolerance in rice (Oryza sativa) plants. Plant J 2010). Therefore, LRR-RLKs are the most numerous subfamily in the plant receptor protein kinase family, playing an important role in plant growth and development, hormone signal transduction, and stress resistance. Recently, this invention also identified a rice LRR receptor kinase OsHPCA1 involved in H2O2 scavenging in rice, improving the rice's salt tolerance and oxidative stress tolerance. Therefore, it is utilized through biotechnology. OsHPCA1 Developing salt-tolerant and oxidative stress-resistant rice varieties to improve saline-alkali land is of great practical significance. Summary of the Invention

[0005] This invention provides a key gene for salt and oxidative stress tolerance. OsHPCA1 This gene positively regulates rice's tolerance to salt and oxidative stress by participating in the scavenging of H2O2 in the rice plant.

[0006] The details are as follows: OsHPCA1 Application of genes in improving the regulation of salt and / or oxidative stress tolerance in rice.

[0007] According to some embodiments of the present invention, the regulation includes knocking out, silencing, or overexpressing the OsHPCA1 gene in rice through genetic engineering methods to obtain rice with different CatC activities and salt or oxidative stress responses.

[0008] According to some embodiments of the present invention, the nucleotide sequence of the OsHPCA1 gene is shown in SEQ ID NO:1;

[0009] The cDNA sequence of the OsHPCA1 gene is shown in SEQ ID NO:2;

[0010] The amino acid sequence encoded by the OsHPCA1 gene is shown in SEQ ID NO:3.

[0011] This invention also provides a method for regulating the salt and / or oxidative stress tolerance of rice, by knocking out, silencing or overexpressing the OsHPCA1 gene in rice through genetic engineering methods to obtain rice varieties with different CatC activities, salt or oxidative stress responses.

[0012] According to some embodiments of the present invention, the nucleotide sequence of the OsHPCA1 gene is shown in SEQ ID NO:1;

[0013] The cDNA sequence of the OsHPCA1 gene is shown in SEQ ID NO:2;

[0014] The amino acid sequence encoded by the OsHPCA1 gene is shown in SEQ ID NO:3.

[0015] According to some embodiments of the present invention, the method yields transgenic rice; the transgenic rice exhibits enhanced salt tolerance; the transgenic rice is sensitive to salt stress.

[0016] According to some embodiments of the present invention, the genetic engineering method is to obtain transgenic rice with gene overexpression through a transgenic method, thereby increasing the CatC activity of the transgenic rice and improving its tolerance to salt and / or oxidative stress.

[0017] According to some embodiments of the present invention, the genetic engineering method is to silence genes by gene knockout or RNAi interference to obtain transgenic rice, thereby reducing the CatC activity, salt tolerance, and / or oxidative stress tolerance of the transgenic rice.

[0018] This invention also provides an application of the OsHPCA1 gene in rice with altered CatC activity, salt tolerance, and / or oxidative stress tolerance.

[0019] According to some embodiments of the present invention, gene silencing is achieved by gene knockout or RNAi interference to obtain transgenic rice, thereby reducing the CatC activity, salt tolerance, and / or oxidative stress tolerance of the transgenic rice; or gene overexpression is achieved by transgenic methods to increase the CatC activity and improve the salt tolerance and / or oxidative stress tolerance of the transgenic rice.

[0020] This invention constructs a novel pUC1390 vector by designing primers and adding homologous arms to the pUC1390 vector, followed by homologous recombination and cloning into the pUC1390 vector. OsHPCA1 Overexpression lines were developed. Simultaneously, a CRISPR / Cas9 gene editing system was used to construct... OsHPCA1 Knockout lines were transformed using Agrobacterium-mediated transformation, and homozygous knockout lines were obtained by sequencing and Western blotting, respectively. oshpca1 and overexpression lines. Under NaCl treatment, the seedling-stage overexpression lines... OsHPCA1 The salt tolerance was significantly stronger than that of wild-type WT, and its survival rate, CAT activity, and H2O2 content were all significantly higher than those of WT, while the mutants showed the opposite. Furthermore, OsHPCA1 The tolerance of rice to salt and oxidative stress was regulated from the seedling stage, specifically by improving the tolerance of rice to salt and oxidative stress during the seedling stage.

[0021] In summary, OsHPCA1 This invention enhances the ability to scavenge reactive oxygen species and positively regulates rice's tolerance to salt and oxidative stress. The gene in this invention positively regulates rice salt tolerance. OsHPCA1 It has important application value in cultivating salt-tolerant rice and improving rice quality.

[0022] This invention provides a product containing OsHPCA1 Expression vectors, transgenic cell lines, and host bacteria.

[0023] The method described in this invention, wherein OsHPCA1 The gene is derived from rice ( Oryza sativa L.), whose nucleotide sequence is shown in SEQ ID NO:1 and whose encoding amino acid sequence is shown in SEQ ID NO:3.

[0024] This invention also provides a method for improving the salt and oxidative stress tolerance of rice: the method involves using the gene for improving the salt and oxidative stress tolerance of rice. OsHPCA1 Introducing the product into rice tissues or cells improves the rice's tolerance to salt and oxidative stress.

[0025] The genetic engineering method described herein is to silence genes through gene knockout or RNAi interference, thereby reducing the salt tolerance and oxidative stress resistance of transgenic rice; or to overexpress genes through transgenic methods, thereby increasing the salt tolerance and oxidative stress resistance of transgenic rice. Furthermore, this invention also provides... OsHPCA1Application of genes in plants with improved salt tolerance and oxidative stress resistance;

[0026] The above applications involve silencing genes through gene knockout or RNAi interference, thereby reducing the salt tolerance and oxidative stress resistance of transgenic water; or overexpressing genes through transgenic methods, thereby increasing the salt tolerance and oxidative stress resistance of transgenic rice.

[0027] This invention provides a gene for improving rice's tolerance to salt and oxidative stress and the protein it encodes. OsHPCA1 Genes play a crucial role in the salt and oxidative stress response of rice, positively regulating its salt tolerance and oxidative stress resistance. By silencing genes through gene knockout or RNAi interference, and by overexpressing genes in transgenic rice, the salt and oxidative stress tolerance of transgenic plants can be altered, thereby enabling the cultivation of transgenic plant varieties with increased salt and oxidative stress tolerance. Experiments show that gene overexpression through transgenic methods enhances the salt tolerance and oxidative stress resistance of transgenic rice. Furthermore, the CRISPR / Cas9 method can be used to... OsHPCA1 Gene knockout significantly reduced tolerance to salt and oxidative stress. This indicates that transgenic technology using gene overexpression can utilize... OsHPCA1 Genes can be used to genetically improve the salt tolerance and oxidative stress tolerance of rice, and have broad application prospects in the field of agriculture. Attached Figure Description

[0028] Figure 1 OsHPCA1 Gene structure analysis.

[0029] Figure 2 OsHPCA1 The expression pattern of [the substance] and its transcription are induced by salt and H2O2 stress.

[0030] Figure 3 OsHPCA1 Identification of transgenic plants.

[0031] Figure 4 OsHPCA1 Positively regulates the oxidative stress tolerance of rice.

[0032] Figure 5 OsHPCA1 Positive regulation of salt stress tolerance in rice seedlings. Detailed Implementation

[0033] The present invention will be further described below with reference to specific embodiments. Unless otherwise specified, the experimental methods mentioned in the following embodiments are conventional methods.

[0034] 1. OsHPCA1 Structural analysis and expression pattern analysis

[0035] (1) Gene structure analysis: Downloaded from the rice database (http: / / rice.plantbiology.msu.edu) OsHPCA1 The coding sequence of (LOC Os05g40770) was compared with that of Japan's Haruhi. OsHPCA1 The cDNA and its genomic DNA sequence were found OsHPCA1 There are 18 exons (5' end of SEQ ID No:1: 275-362, 512-632, 727-798, 1384-1458, 1556-1627, 1726-1877, 1994-2065, 2146-2217, 2317-2388, 2463-2531, 2616-2690, 2780-2852, 2937-3069, 3178-3656, 3939-4097, 4274-4633, 4758-4990, 5444-5968) and 17 introns (SEQ ID No:1). The 5' end of No:1 is 363-511, 633-726, 799-1383, 1459-1555, 1628-1725, 1878-1993, 2066-2145, 2218-2316, 2389-2462, 2532-2615, 2691-2779, 2853-2936, 3070-3177, 3657-3938, 4098-4273, 4634-4757, 4991-5443; its full-length genome is 6143 bp (SEQ ID No:1), and its full-length cDNA is 2619 bp (SEQ ID No:2). Its open reading frame is SEQ ID No. No:2 contains 2619 bases from position 1 to position 2619 at the 5' end; the protein encoded by this gene is 872 amino acids in length. Figure 1 ).

[0036] (2) Expression pattern analysis: To investigate the subcellular localization, expression characteristics, and expression pattern of OsHPCA1 in different tissues and organs, this invention constructed corresponding vectors. Subcellular localization analysis revealed that OsHPCA1 is granularly localized on the cell membrane and in the cell nucleus ( Figure 2 A). Tissue-specific expression suggests that OsHPCA1 is mainly expressed in stems, 4-day-old seedlings, leaf sheaths, and young spikelets, with the highest expression level in stems (A). Figure 2The presence of BG suggests that OsHPCA1 may function in these different tissues and organs. Expression pattern analysis was then performed. Nipponbare seedlings were treated with 140 mM NaCl, 20% PEG, 60 mMALK, and 1% H2O2 for 0, 2, 4, 6, 8, 10, 12, and 24 h, respectively. RNA was then extracted and reverse transcribed into cDNA. qRT-PCR was performed using the cDNA as a template. OsHPCA1 Changes in transcriptional levels.

[0037] The qRT-PCR primers are F: 5'-GCCATGTCTCCACCCAAGTC-3';

[0038] R: 5'-TCACCAGCTCCAGCATCAC-3'.

[0039] The results showed that, under the conditions of NaCl, H2O2, PEG, and ALK treatment, the wild type showed increasing degradation with increasing treatment time. OsHPCA1 mRNA expression level with OsHPCA1 Gene expression levels increased, with the highest levels observed at 6 or 8 hours. Figure 2 HK), and then the expression level began to decrease, but except for NaCl, PEG and H2O2 treatment for 10 h, ALK from the treatment for 10 h, OsHPCA1 Gene expression levels began to rise again. These results indicate that... OsHPCA1 The expression of OsHPCA1 is induced by salt, alkali, drought, and H2O2, suggesting that OsHPCA1 plays an important role in these four stress responses. As an H2O2-specific receptor, OsHPCA1's function is closely related to plant oxidative stress tolerance. Simultaneously, salt stress induces intracellular ROS bursts (including excessive H2O2 accumulation), leading to oxidative damage. Therefore, this invention focuses on the dual regulatory mechanism of OsHPCA1 in salt and oxidative stress, exploring how this gene simultaneously enhances rice's salt tolerance and oxidative stress resistance through the H2O2-CatC signaling axis.

[0040] 2. Gene cloning and vector construction

[0041] (1) Homologous recombination cloning:

[0042] Designed using Primer Premier 5 OsHPCA1 Specific primers;

[0043] Positive: 5' ATGGAGCCGCGGGTGTTGA 3';

[0044] Reverse: 5' CTTGGGCTTGACCTCAAAATAGG 3'.

[0045] And add a homologous arm of the pUC1390 vector at the 5' end;

[0046] Positive: TCTGCACTAGGTACCTGCAG;

[0047] Reverse: ATGGATCCGTCGACCTGCAG.

[0048] Using *Oryza sativa* L. japonica cv. Nipponbare cDNA as a template, PCR amplification was performed. OsHPCA1 The full-length gene sequence was obtained. The target gene was cloned into the pUC1390 vector via homologous recombination. After sequencing verification, it was transformed into E. coli DH5α by heat shock to obtain the recombinant plasmid pUC1390-OsHPCA1.

[0049] (2) Construction of CRISPR / Cas9 knockout vector

[0050] A sgRNA targeting OsHPCA1 was designed, and the pYLCRISPR / Cas9-OsHPCA1 knockout vector was constructed. This vector was then transformed into callus tissue of the rice variety Kitaake using Agrobacterium EHA105. The infected callus tissue was co-cultured for 3 days (in the dark, at 28℃), followed by selection of resistant callus on a selection medium containing 50 mg / L hygromycin, and differentiation into resistant seedlings on a differentiation medium. The differentiated rice plants were then hydroponically hardened off in a cool place for one week before being transplanted to the field. Twelve OsHPCA1-FLAG overexpression lines were successfully obtained, and two lines (OsHPCA1-FLAG-21 and OsHPCA1-FLAG-41) were selected for subsequent experiments. Figure 3 B) and two homozygous mutants ( oshpca1-3 and oshpca1-4 , Figure 3 D).

[0051] The mutant oshpca1-3, due to a 4 bp deletion at the target site, causes premature termination of the protein at the 35th amino acid. -4 The protein terminates prematurely at the 36th amino acid due to the deletion of 1 bp. Figure 3 ).

[0052] 3. OsHPCA1 Gene function research

[0053] (1) Phenotypic analysis of transgenic plants

[0054] Methyl viologen (MV), a plant oxidative stress inducer, was used to simulate oxidative stress on wild-type and... OsHPCA1When transgenic rice seedlings were treated, it was found that under normal conditions, there was no significant difference in growth between transgenic and wild-type seedlings. Figure 4 A).

[0055] In contrast, after 6 days of treatment with 4 μM MV, overexpression OsHPCA1 The seedlings are greener than the wild type, and oshpca1 The mutants exhibited yellowing and dwarfing phenotypes. Figure 4 A). Subsequently, to assess its oxidative tolerance from physiological data, seedling length, CAT activity, and H2O2 content of wild-type and transgenic plants under the above normal and treatment conditions were measured. The results showed that the plant height and CAT activity of the overexpression lines were significantly higher than those of the wild type, while the H2O2 content was significantly lower; conversely, oshpca1 The mutant's plant height and CAT activity were significantly lower than those of the wild type. Figure 4 BC), while the H2O2 content increased significantly ( Figure 4 D), Explanation OsHPCA1 Positively regulates the oxidative tolerance of rice.

[0056] Furthermore, this invention also demonstrated the results in another oxidative stress experiment. Wild-type and transgenic seedlings at the three-leaf stage were treated with 100 mM H2O2. After 2 days of H2O2 treatment, [the following was observed / observed / etc.]. oshpca1 The mutant exhibited severe necrosis and bleaching, with a greater degree of bleaching than the wild type, while overexpression remained green. However, under normal conditions, the leaves of both wild-type and transgenic plants were normal. Figure 4 E). In addition, the accumulation of H2O2 was further detected by DAB staining.

[0057] Under normal growth conditions, no obvious staining was observed in either transgenic or wild-type plants; after 2 days of H2O2 treatment, compared with the wild-type, overexpression... OsHPCA1 The staining intensity of the leaves was lower than that of WT, meaning that less H2O2 accumulated during overexpression. oshpca1 The mutant leaves showed the most severe staining, indicating a higher accumulation of H2O2 in the mutant. Figure 4 F).

[0058] Salt stress can also induce oxidative stress, and improving antioxidant capacity can also improve the salt tolerance of rice. The following section of this invention will further investigate... OsHPCA1 The study investigated whether this would alter the salt tolerance of rice: wild-type and... OsHPCA1 Genetically modified plants were discovered. OsHPCA1 The overexpression transgenic lines showed significantly better growth than the wild-type. oshpca1 The mutant strains mostly withered compared to the wild type, while under normal conditions, there was little difference in the growth status of each plant. Figure 5A). Further statistical analysis of the survival rate of each plant revealed... OsHPCA1 The survival rate of overexpression lines was significantly higher than that of wild-type lines, while the survival rate of mutant lines was significantly lower than that of wild-type lines. Figure 5 (BC). Relative ion leakage rate can directly reflect the integrity of plant cell membranes. The results showed that under normal conditions, there was no significant difference in the relative conductivity between wild-type and transgenic lines, but after treatment with 140 mM NaCl... OsHPCA1 The relative electrical conductivity of the overexpressing transgenic lines was significantly lower than that of the wild type. oshpca1 The relative conductivity of the mutant lines is higher than that of the wild type. Figure 5 F). This indicates that the membrane damage in the overexpressing plants was significantly less than that in the wild type, while the damage in the mutants was significantly greater than that in the wild type. Furthermore, chlorophyll content analysis results also showed that under normal conditions, there was no significant difference in chlorophyll content between the wild-type and transgenic lines, but under NaCl treatment conditions… OsHPCA1 The chlorophyll content in the overexpressing transgenic lines was significantly higher than that in the wild type, while the content in the mutant lines was significantly lower than that in the wild type. Figure 5 D). MDA is one of the products of cell membrane lipid peroxidation. Accumulation of MDA can further exacerbate membrane damage, affecting plasma membrane integrity and normal physiological function. Therefore, MDA content is often used to evaluate the degree of damage to plants under abiotic stress. MDA detection results in this study showed that under salt treatment, overexpression... OsHPCA1 The malondialdehyde (MDA) content in the transgenic lines was significantly reduced, while that in their mutants it was significantly increased. Figure 5 E). The results of these physiological indicators further prove that... OsHPCA1 It positively regulates the salt tolerance and antioxidant stress resistance of rice seedlings.

[0059] It should be noted that the present invention is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments that have the same structure and perform the same effects as the technical concept within the scope of the present invention are included within the scope of the present invention. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of the present invention, are also included within the scope of the present invention.

Claims

1. OsHPCA1 Application of genes in improving rice tolerance to salt and / or oxidative stress; characterized by, The OsHPCA1 The cDNA sequence of the gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, Using genetic engineering methods to extract the essence of rice OsHPCA1 Genes are overexpressed to obtain rice varieties that improve tolerance to salt or oxidative stress.

3. The application according to claim 1, characterized in that, The OsHPCA1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

3.

4. A method for improving the tolerance of rice to salt and / or oxidative stress, characterized in that, Using genetic engineering methods to extract the essence of rice OsHPCA1 Gene overexpression was used to obtain rice varieties with improved tolerance to salt or oxidative stress. The OsHPCA1 The cDNA sequence of the gene is shown in SEQ ID NO:

2.

5. The method as described in claim 4, characterized in that, The OsHPCA1 The amino acid sequence encoded by the gene is shown in SEQ ID NO:

3.

6. The method as described in claim 4 or 5, characterized in that, The method yields transgenic rice; the transgenic rice exhibits enhanced salt tolerance.

7. The method as described in claim 4 or 5, characterized in that, The genetic engineering method described above obtains transgenic rice with overexpressed genes through transgenic methods, thereby improving its tolerance to salt and / or oxidative stress.

8. A kind OsHPCA1 The application of the gene in rice with improved salt tolerance and / or oxidative stress tolerance is characterized by, The OsHPCA1 The cDNA sequence of the gene is shown in SEQ ID NO:

2.

9. The application as described in claim 8, characterized in that, Transgenic rice with overexpressed genes was obtained through transgenic methods, which improved the salt tolerance and / or oxidative stress tolerance of transgenic rice.

Images