ApisceranaDnaJC28 gene and application thereof
By studying the DnaJC28 gene and its encoded protein in the Chinese honeybee, and regulating its expression or silencing, the problem of unclear molecular mechanisms of the Chinese honeybee's response to heat stress was solved, the survival rate and antioxidant capacity of the insect under heat stress were improved, and new gene targets were provided for heat-resistant breeding.
Patent Information
- Application Number
- CN202511500318.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2025-12-23
- Estimated Expiration
- 2045-10-21
AI Technical Summary
In the current technology, the adaptation of Chinese honeybees to heat stress and the molecular mechanism of heat stress response are not fully understood, and the expression patterns and heat tolerance of different DnaJ genes in heat stress response are different, lacking effective heat tolerance gene targets.
The DnaJC28 gene and its encoded protein in the Chinese honeybee were identified and studied. By regulating its expression or silencing, the survival rate of insects under heat stress was improved. Recombinant vectors and RNA interference technology were used to overexpress or silence DnaJC28 in Drosophila cells to enhance heat resistance.
It improves the survival rate of insects under heat stress conditions, reduces oxidative damage, provides new heat-resistant gene targets, and has the potential to breed heat-resistant transgenic bee varieties to adapt to climate change.
Smart Images

Figure CN120966914B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of cell biology and molecular biology, and particularly relates to a gene of Apis cerana DnaJC28 and an encoded protein thereof and application. BACKGROUND
[0002] Heat stress refers to the stress response at the molecular, physiological and biochemical levels of organisms when they encounter high temperature environments beyond their optimal growth temperature range. Heat stress disrupts the homeostasis of organisms, causes the accumulation of reactive oxygen species, induces oxidative damage, leads to metabolic disorders, growth and development inhibition, and even causes death. Global climate change has further intensified the intensity and frequency of heat stress, which has attracted the attention of researchers. Heat stress research is related to ecological balance, food security and the survival and evolution of organisms, and is a key link in addressing the challenge of global warming. Therefore, it is of great significance to screen and identify heat stress response genes, provide new heat-resistant candidate target genes, and in-depth analyze the mechanism of responding to heat stress.
[0003] Heat shock proteins (Hsps) are one of the key protein families responding to heat stress, which can repair denatured proteins, prevent protein aggregation and help protein folding. According to the molecular weight (kDa), Hsps are generally divided into six subfamilies: small Hsp (sHsp), Hsp40, Hsp60, Hsp70, Hsp90 and Hsp100. Among them, Hsp40 is an important auxiliary factor of the Hsp70 molecular chaperone system. It is worth mentioning that although Hsps were first discovered in Drosophila due to their expression induced by heat stress. However, with subsequent research, it was found that not all Hsps respond to heat stress. Cell localization and growth environment can affect the ability of Hsps to respond to heat stress. In addition, the expression pattern and regulation mode of the same Hsp protein may be different in different species, which indicates the species specificity of Hsp expression.
[0004] Among Hsps in multiple species, the number of genes in the Hsp40 subfamily is the largest. For example, 45, 27, 22, 17, 7 and 6 potential Hsp40 Hsp40 genes were found in humans, Apis cerana, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Escherichia coli and Drosophila, respectively. Due to the presence of J domain (about 70 amino acid residues) in the structure of Hsp40 protein, it is often named as DnaJ. According to the difference in protein structure, DnaJ can be divided into DnaJA, DnaJB and DnaJC. In multiple species, the number of DnaJC is much larger than that of DnaJA and DnaJB. Studies have shown that part of DnaJC can form a complex with Hsp70 and Hsp40 to form a chaperone system, which can assist the folding of proteins and prevent the aggregation of denatured proteins. DnaJGenes play important roles in responses to diseases and stresses, and different genes have different expression patterns under different stress conditions. DnaJ However, related researches mainly focus on DnaJA and DnaJB As the largest number of DnaJ subfamily members, DnaJC What are the main functions of DnaJC genes? Which genes can be used as key factors in response to heat stress? These questions need to be further analyzed.
[0005] The Chinese honeybee is a subspecies of Apis cerana native to China. It has strong cold tolerance and can adapt to large temperature differences, especially in mountainous environments. It is good at collecting scattered nectar sources and is an important species for maintaining the ecological balance of China. The heat tolerance of Chinese honeybees in different dimensions of China varies. For example, Chinese honeybees in low-latitude areas have strong heat tolerance and can easily adapt to high-temperature environments. Chinese honeybees in mid-latitude areas have moderate heat tolerance and can cope with high-temperature weather. Chinese honeybees in high-latitude areas have weak heat tolerance and are more suitable for low-temperature environments. Heat stress has a negative impact on the foraging ability, growth, and development of Chinese honeybees. Therefore, studying the mechanisms of Chinese honeybees in response to heat stress, identifying heat-tolerant genes, and exploring the differences in heat tolerance can not only provide key candidate target genes for breeding heat-tolerant bees, but also help Chinese honeybees better adapt to future climate change. In addition, candidate target genes in Chinese honeybees can also be transferred into other economic animals through gene editing or transgenic technology, which is expected to improve their survival ability and yield in a global warming environment, and has important economic value. SUMMARY
[0006] In view of the above prior art, the purpose of the present application is to provide an DnaJC28 gene and its encoded protein and application, and the research results of the present application have important reference value for innovative research on heat-tolerant breeding.
[0007] To achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0008] In the first aspect of the present application, an DnaJC28 gene is provided, and the gene has the following application in any one of (1)-(3):
[0009] (1) regulating the survival rate of insects under heat stress conditions;
[0010] (2) preparing a product for regulating the heat resistance of insects under heat stress;
[0011] (3) breeding insect varieties with enhanced heat resistance under heat stress conditions;
[0012] The DnaJC28The gene nucleotide sequence is shown in SEQ ID NO. 1, and is as follows:
[0013]
[0014] In a second aspect, the application provides an Apis cerana DnaJC28 application of a protein encoded by the Apis cerana
[0015] (1) regulating survival rate of insects under heat stress;
[0016] (2) preparing a product for regulating heat resistance of insects under heat stress;
[0017] The Apis cerana DnaJC28 The amino acid sequence of the protein encoded by the Apis cerana
[0018] MTIRFNSHRKHLFFKNMLRFNQYNRKILKNIICVPYWEFMLMKRFKHQHNMKKWYQTLEVAEDCEDETLRLAFVYQAKRFHPDSGTSEANATKFSEIETAYRQIRKARIEKKENCTNLPEVEEFDIKHTAPQHRHYLVYNVGIGTHSKRQKLYTMERAQKAVDSVLEHRLKKLQTEERNTLVGMDKQHAKNIKTRFGMDRLVEDLIQEAMNRGEFKDLPGMGKPLKENTNTRNPYVDFVTYKLNEILIENGFTPEWIQLSKEIREEIQDLRKKLINARSKVGHIPLNYKDEKTWKNIVENFKSKTKEINIKVDKYNLLVPILQKQMLHVKLEDLAKEALSTPAQETLKEKVNSDISVERKNNLLTEMISSIFNK.
[0019] In a third aspect, the application provides a biological material containing the Apis cerana DnaJC28 application of the biological material containing the Apis cerana
[0020] (1) regulating survival rate of insects under heat stress;
[0021] (2) preparing a product for regulating heat resistance of insects under heat stress;
[0022] (3) breeding an insect variety with enhanced heat resistance under heat stress.
[0023] The biological material is a recombinant vector, a recombinant bacterium, or a transgenic cell line containing the Apis cerana DnaJC28 gene.
[0024] In the present application, the heat resistance is specifically manifested as: reducing the oxidative damage degree of insects under heat stress, and improving the survival rate of insects under heat stress.
[0025] Preferably, the survival rate of insects under heat stress is improved by up-regulating the expression of Apis cerana DnaJC28 gene or increasing the activity of the protein encoded by Apis cerana DnaJC28 gene.
[0026] Since Apis cerana DnaJC28 gene can be used to regulate the survival rate of insects under heat stress, for harmful insects, the homologous gene of Apis cerana DnaJC28 gene in the harmful insects can be found, and the survival rate of the harmful insects under heat stress is reduced by down-regulating the expression of the homologous gene in the harmful insects or reducing the activity of the protein encoded by the homologous gene in the harmful insects. DnaJC28 Specifically, double-stranded RNA (dsRNA) of the homologous gene in the harmful insects can be artificially synthesized through RNA interference technology, and the harmful insects are fed with the dsRNA, so that the homologous gene in the harmful insects is silenced after the harmful insects take the food, and the survival rate of the harmful insects under heat stress is reduced. DnaJC28 DnaJC28 DnaJC28
[0027] Preferably, a recombinant expression vector capable of over-expressing Apis cerana DnaJC28 gene is introduced into a recipient insect variety, and an insect variety with enhanced heat resistance under heat stress is bred.
[0028] Advantages of the present application:
[0029] The present application first found that short-term heat stress and long-term heat stress can both induce the expression of Apis cerana DnaJC28 gene, and silencing DnaJC28 the Apis cerana DnaJC28 gene can reduce the survival rate of Apis cerana under heat stress, and over-expressing the Apis cerana DnaJC28 gene in Drosophila S2 cells can increase the survival rate of Drosophila S2 cells under heat stress. Multiple antioxidant genes can partially compensate for the function under heat stress, and reduce the oxidative damage caused by heat stress to Apis cerana. DnaJC28 In view of the heat resistance of Apis cerana , it can be used as a new heat-resistant gene target, and the gene can be over-expressed in other economic animals in the future, which is expected to improve the yield and heat resistance of the animals under heat stress. If successfully applied, it can provide a sustainable solution for livestock production under climate change.
[0030] DnaJC28 This diagram shows the subcellular localization of DnaJC28 in the Chinese honeybee; the red color after Cy3 staining indicates the expression of DnaC28, and the blue color after DAPI staining indicates the location of the cell nucleus.
[0031] Figure 1 Chinese honeybee under heat stress Figure 2 The expression pattern detection map; among which, DnaJC28 A in the figure represents the result of a 5-hour non-stress treatment at 33°C. Figure 2 The expression situation, DnaJC28 B in the figure represents the result of a 5-hour non-stress treatment at 40°C. Figure 2 The expression situation, DnaJC28 C in the figure represents 43°C after 5 hours of non-stress treatment. Figure 2 The expression situation, DnaJC28 D in the figure represents the result of a 5-hour non-stress treatment at 46°C. Figure 2 The expression situation, DnaJC28 E in the figure represents the result of a 48-hour non-stress treatment at 33°C. Figure 2 The expression situation, DnaJC28 F in the figure represents the result of a 40°C non-stress treatment for 48 h. Figure 2 The expression of .
[0032] DnaJC28 For silence Figure 3 The effect of heat stress on the response of the Chinese honeybee is shown in the following graph; among them, DnaJC28 A in the text represents identification. Figure 3 The efficiency of silence, DnaJC28 B in the figure represents statistical silence. Figure 3 Survival rate of Chinese honeybees under heat stress conditions.
[0033] DnaJC28 Heterologous overexpression of *Apis cerana* under heat stress conditions Figure 4 The effect of the effect on the state and survival rate of Drosophila S2 cells is shown in the graph; among them, DnaJC28 In the figure, A represents heterologous overexpression of *Apis cerana* in Drosophila S2 cells. Figure 4 The cells were then subjected to heat stress at 37°C. The state of the fruit fly S2 cells after treatment for 0 h, 18 h and 48 h is shown in the figure. Myc: pUAST-6×Myc, Myc-DnaJC28: pUAST-6×Myc-DnaJC28. DnaJC28 In the text, B represents heterologous overexpression of *Honeysuckle chinensis* under heat stress treatment. Figure 4 The result of trypan blue staining of Drosophila S2 cells at 48 h. The dark blue cells indicated by the red arrow are some of the dead cells after trypan blue staining. DnaJC28 In the figure, C represents the difference between heat stress treatment and heterologous overexpression of *Apis cerana* compared to the control group. Figure 4 The cell mortality rate of Drosophila S2 cells after 48 h is shown in the figure.
[0034] DnaJC28 for silencing Figure 5 The effect of the application on the expression of antioxidant genes in the body of Apis cerana; wherein, DnaJC28 A in the expression of Figure 5 B in the expression of CYP4G11 C in the expression of Figure 5 D in the expression of CDK5 E in the expression of Figure 5 F in the expression of CDK5r G in the expression of Figure 5 H in the expression of Trx1 I in the expression of Figure 5 J in the expression of Trx2 K in the expression of Figure 5 L in the expression of Tpx4 M in the expression of Figure 5 N in the expression of Tpx5 O in the expression of Figure 5 P in the expression of Hsp22.6 Q in the expression of Figure 5 R in the expression of MsrB S in the expression of Figure 5 T in the expression of GSTO2 K in the expression of Figure 5 L in the expression of GSTS4 M in the expression of Figure 5 N in the expression of GSTD O in the expression of Figure 5 P in the expression of GSTT1 Q in the expression of Figure 5 R in the expression of SOD1 S in the expression of Figure 5 T in the expression of MKK4 P in the expression of Figure 5 Q in the expression of CYP336A1 R in the expression of Figure 5 S in the expression of GSTZ1 T in the expression of Figure 5 S in the expression of TrxR1 T in the expression of Figure 5 U in the expression of p38b V in the expression of Figure 5 W in the expression of DETAILED DESCRIPTION
[0035] It should be noted that the following detailed description is merely illustrative in nature and is in no way intended to limit the application, application, or uses of the application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the application belongs.
[0036] As mentioned earlier, many questions remain regarding the adaptability of the Chinese honeybee to heat stress and the specific molecular mechanisms of its heat stress response, requiring further investigation. Due to differences in subcellular localization, developmental stage, and growth environment, different responses to heat stress under various stress conditions will lead to different outcomes. Tpx3 Genes also differ in their ability to respond to heat stress.
[0037] Based on this, the present invention provides the Chinese honeybee. DnaJ Genes, their encoded proteins, and applications further supplement different DnaJC28 The study of gene expression patterns, heat tolerance, and participation in heat stress response in Chinese honeybees provides new candidate heat stress response genes for breeding heat-resistant transgenic honeybee varieties.
[0038] Specifically, the Chinese honeybee is a subspecies of the Eastern honeybee. This invention is based on the Eastern honeybee genome published on NCBI. DnaJ Nucleotide sequence design and amplification of *Apis cerana* (registration number: LOC108001060) DnaJC28 Specific primers were used to amplify the cDNA of the Chinese honeybee using PCR. DnaJC28 The coding area. The obtained Chinese honeybee DnaJC28 The coding region was constructed into the eukaryotic expression vector pUAST-6×Myc and transfected into Drosophila S2 cells. Immunofluorescence assays and two-photon laser confocal microscopy revealed that the DnaJC28 of the Chinese honeybee was located in the cytoplasm.
[0039] This invention utilizes reverse transcription quantitative PCR (RT-qPCR) to discover that different degrees of heat stress (40°C, 43°C, and 46°C) can induce induced ... DnaJC28 The expression of [the condition]. Furthermore, 4-5 hours after treatment, with increasing heat stress, [the following occurred]. DnaJC28 The degree of induction increases. Furthermore, under both short-term and long-term thermal stress conditions, DnaJC28 The expression levels of all of them increased. These results indicate that... DnaJC28 It plays an important role in the heat stress response of the Chinese honeybee.
[0040] This invention also provides a method to silence Chinese honeybees. DnaJC28 The nucleotide sequence is described. Using this nucleotide sequence to synthesize dsRNA and feeding it to Chinese honeybees can silence them. DnaJC28 Furthermore, this invention provides a silent... DnaJC28 The reduction in the tolerance of Chinese honeybees to heat stress indicates DnaJC28 8. Plays an important role in heat stress. This invention further provides that, compared with the control group, heterologous overexpression of *Apis cerana* plays a crucial role.DnaJC2 It can improve the survival rate of Drosophila S2 cells under heat stress conditions, further illustrating... DnaJC28 It is a key gene in the response to heat stress.
[0041] This invention also provides a silent Chinese honeybee. DnaJC28 Upregulates multiple antioxidant genes ( DnaJC28 , CYP4G11 , CDK5 , CDK5r , Trx1 , Trx2 , Tpx4 , Tpx5 , Hsp22.6 , MsrB, GSTO2 , GSTS4 , GSTD , GSTT1 The transcriptional level of these antioxidant genes is upregulated. Heat stress can induce oxidative damage in honeybees, and these upregulated antioxidant genes may partially compensate for the silencing of other genes. SOD1, MKK4 This function helps reduce oxidative damage to Chinese honeybees caused by heat stress.
[0042] The specific embodiments of the present invention will be described in further detail below with reference to examples. The following detailed descriptions are illustrative and intended to provide further explanation of this application, rather than limiting the scope of the invention.
[0043] Example 1: Subcellular localization analysis of DnaJC28 in Honeybee (Apis cerana)
[0044] 1. Total RNA extraction and first-strand cDNA synthesis from *Apis cerana*
[0045] Total RNA was extracted from Chinese honeybees using the Trizol method. Then, using this RNA as a template, the first strand of Chinese honeybee cDNA was synthesized using the TaKaRa PrimeScript™ RT reagent Kit with gDNA Eraser.
[0046] 2. Construction of pUAST-6×Myc-DnaJC28 eukaryotic expression vector
[0047] (1) Based on the published genome of the Eastern honeybee DnaJC28 Nucleotide sequence design to amplify Chinese honeybee DnaJC28 The specific primers SEQ ID NO.3-SEQ ID NO.4 were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0048] Upstream primer (SEQ ID NO.3):
[0049] 5'- DnaJC28GCGGCCGCGATGCGCATTATATATTTATTGTATA-3'
[0050] Note: The sequence with line is the protection base, and the bold sequence is AAGGAAAAAA I enzyme cutting site.
[0051] Downstream primer (SEQ ID NO. 4):
[0052] 5'- Not TCTAGATTATTTATTAAAAATCGAAGATATC-3'
[0053] Note: The sequence with line is the protection base, and the bold sequence is GC I enzyme cutting site.
[0054] (2) The coding region of Apis cerana cerana was amplified by PCR. The PCR system used was as follows: Xba
[0055] Table 1: PCR system
[0056]
[0057] The PCR reaction program used was as follows: 94°C for 5 min, 94°C for 40 sec, 57°C for 30 sec (35 cycles), 72°C for 60 sec, and 72°C for 10 min.
[0058] (3) After the PCR product amplified in (2) was subjected to 1% agarose gel electrophoresis, it was recovered. The recovered product containing the coding region of Apis cerana cerana and the pUAST-6xMyc eukaryotic expression empty vector plasmid were simultaneously subjected to digestion with EcoRI and BamHI. After the digestion products were subjected to 1% agarose gel electrophoresis and recovered, the recovered product was ligated to the empty vector pUAST-6xMyc using T4 DNA ligase to construct the pUAST-6xMyc-DnaJC28 eukaryotic expression vector. Then, the pUAST-6xMyc-DnaJC28 plasmid was extracted using the gold medal super amount endotoxin-free plasmid large extraction kit (Kangwei Reagent Co., Ltd.). DnaJC28 DnaJC28 Not Xba 3. Resuscitation, subculture and transfection of Drosophila S2 cells
[0059] (1) The Drosophila S2 cells stored at low temperature and the Drosophila S2 cell special culture medium (iCell) were preheated using a 25°C water bath.
[0060]
[0061] (2) The fruit fly S2 cells of step (1) are added to a sterile culture dish together with the culture medium, and are cultured in a sterile incubator (25°C) to carry out the first recovery of the fruit fly S2 cells. When the cells grow to cover the dish, the cells are equally divided into two sterile culture dishes, the culture medium is added, and the culture is placed in a sterile incubator (25°C) to carry out the second recovery of the fruit fly S2 cells. When the cells grow to cover the dish, 1 mL of the fruit fly S2 cells is transferred to a new sterile culture dish, 3 mL of the culture medium is added, and the culture is placed in a sterile incubator (25°C) to carry out the passage of the fruit fly S2 cells. When the cells grow to cover the dish, the transfection experiment of the fruit fly S2 cells is carried out.
[0062] (3) The transfection reagent PEI and pUAST-6xMyc-DnaJC28 are added to 400 uL of PBS in a mass ratio of 2:1 on a sterile clean bench, mixed, and left to stand at room temperature for 15 min. Then, the mixture is transfected into the fruit fly S2 cells that have completed the passage in step (2), mixed gently, and placed in a sterile incubator (25°C) to culture for 48 h, and then the immunofluorescence experiment is carried out.
[0063] 4. Immunofluorescence experiment
[0064] The transfected cells are collected into a centrifuge tube, centrifuged at 12000 rpm for 3 min, the supernatant is removed, and the precipitate is suspended with PBS (1 mL). Then, 4% formaldehyde (1 mL) is added to the centrifuge tube, the mixture is shaken on a shaking table for 20 min, centrifuged at 12000 rpm for 3 min, the supernatant is removed, and the precipitate is washed with PBS (1 mL) for 10 min, and the washing is repeated for 3 times. The mixture is centrifuged at 12000 rpm for 3 min, the supernatant is removed, and PBT (1 mL) is added to the precipitate and shaken for 10 min. Then, the mixture is centrifuged at 12000 rpm for 1 min, the supernatant is removed, and the precipitate is suspended with PBS (200 uL). The mouse-derived primary antibody anti-Myc is added at a ratio of 1:200, and the mixture is shaken at 4°C for 12 h. Then, the mixture is centrifuged at 12000 rpm for 3 min, the supernatant is removed, and the precipitate is washed with PBS (1 mL) for 10 min, and the washing is repeated for 3 times. The mixture is centrifuged at 12000 rpm for 3 min, the supernatant is removed, and PBS (200 uL) is added. Then, the Cy3-labeled affinity-purified goat anti-mouse IgG (H+L) secondary antibody is added at a ratio of 1:200, and the mixture is shaken in the dark at room temperature for 2 h. After PBS (300 uL) is added, DAPI (1:1000) is added, and the mixture is shaken in the dark at room temperature for 15 min. The mixture is centrifuged at 12000 rpm for 3 min, the precipitate is washed with PBS (1 mL) for 10 min, and the washing is repeated for 3 times. A slide is prepared, and the subcellular localization of DnaJC28 is observed by means of a two-photon laser confocal microscope. DnaJC28 It can be seen that the Apis cerana DnaJC28 is located in the cytoplasm.
[0065] Example 2: Detection of expression patterns of Apis cerana after heat stress treatment Figure 1
[0066] 1. 300 bees were collected and divided into six groups (50 bees in each group). The first three groups of bees were placed in incubators at 46°C, 43°C and 40°C, respectively, and sampled at 0 h, 1 h, 2 h, 3 h, 4 h and 5 h after treatment; the control group 1 (the fourth group of bees) was placed in an incubator at 33°C, and the sampling time was the same as that of the first three groups.
[0067] The fifth group of bees was placed in an incubator at 40°C, and sampled at 0 h, 12 h, 24 h, 36 h and 48 h after treatment; the control group 2 (the sixth group of bees) was placed in an incubator at 33°C, and the sampling time was the same as that of the first group.
[0068] 2. Total RNA of Apis cerana was extracted using the Trizol method. Then, the RNA was used as a template to synthesize the first strand of cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser kit (TaKaRa).
[0069] 3. The first strand of cDNA synthesized in step 2 was used as a template to perform RT-qPCR with the aid of CFX96TM Real-Time System instrument (Bio-Rad) and TB Green™ Premix Ex Taq™ (Tli RNaseH Plus) kit (TaKaRa). The internal reference gene was DnaJC28 (GenBank registration number: HM640276.1).
[0070] 4. The primer sequences used for RT-qPCR are as follows:
[0071] β-actin Primer of Apis mellifera:
[0072] Upstream primer (SEQ ID NO. 5): ACAGCACCACAACATCGT;
[0073] Downstream primer (SEQ ID NO. 6): GATCCATGCCAAAACGTG.
[0074] DnaJC28 Primer of Apis cerana:
[0075] Upstream primer (SEQ ID NO. 7): TTATATGCCAACACTGTCCTTT;
[0076] Downstream primer (SEQ ID NO. 8): AGAATTGATCCACCAATCCA.
[0077] By β-actin It can be seen that under different degrees of heat stress conditions Figure 2 There are differences in the expression patterns, and both short-term heat stress and long-term heat stress can induce the expression level of DnaJC28 In addition, 4 h-5 h after treatment, with the increase of the degree of heat stress, DnJC28 The degree of induction increases.
[0078] Example 3: Explore the effect of silencing DnaJC28 on the response of Apis cerana to heat stress
[0079] 1. Amplify part of the coding region (74-574 nt, SEQ ID NO. 9) of DnaJC28 by PCR technology. At the same time, 500 bp of DnaJC28 (U87974) sequence is amplified.
[0080] The sequence of SEQ ID NO. 9 is as follows:
[0081] CTCTAGAAGTTGCAGAAGATTGTGAAGATGAGACATTAAGATTAGCATTTGTCTATCAAGCAAAAAGATTCCATCCAGATAGTGGTACATCAGAAGCTAATGCAACTAAATTTTCTGAGATTGAAACTGCTTATAGACAAATTCGTAAAGCAAGAATAGAAAAGAAAGAAAATTGTACAAATCTACCTGAAGTTGAAGAATTTGACATTAAACATACAGCACCACAACATCGTCATTATTTAGTTTATAATGTAGGTATTGGAACACATAGCAAAAGACAAAAATTATATACAATGGAAAGAGCTCAAAAAGCAGTTGATAGTGTATTGGAACATAGATTAAAAAAATTACAAACTGAAGAACGTAATACATTAGTTGGAATGGATAAACAACATGCAAAAAATATTAAAACACGTTTTGGCATGGATCGTTTAGTAGAAGATTTAATTCAAGAAGCAATGAATAGAGGTGAATTTAAAGATCTACCAGGAATGGGTAAAC.
[0082] Amplification GFPThe primer of SEQ ID NO. 9 sequence is:
[0083] The upstream primer (SEQ ID NO. 10) is:
[0084] GGATCC DnaJC28 CTCTAGAAGTTGCAGAAGATTG;
[0085] The downstream primer (SEQ ID NO. 11) is:
[0086] GGATCC TAATACGACTCACTATAGG GTTTACCCATTCCTGGTAGATC.
[0087] The primer for amplifying GFP is:
[0088] The upstream primer (SEQ ID NO. 12) is:
[0089] GGATCC TAATACGACTCACTATAGG AGTGGAGAGGGTGAAGGTGA;
[0090] The downstream primer (SEQ ID NO. 13) is:
[0091] GGATCC TAATACGACTCACTATAGG GGTAAAAGGACAGGGCCATC.
[0092] Note: The sequence of T7 RNA polymerase promoter is underlined.
[0093] 2, respectively, gel recovery of step 1 of the PCR product of TAATACGACTCACTATAGG and DnaJC28 The dsRNA (dsRNA-DnaJC28 and dsRNA-GFP) of GFP and DnaJC28 is synthesized by means of T7 RiboMAX™ Express RNAi System (Promega) with the gel recovery product as template.
[0094] 3, take 30 bees, and divide them into two groups (15 bees in each group). Each bee in the first group is fed with 5 ug of dsRNA-GFP (control group), and each bee in the second group is fed with 5 ug of dsRNA-DnaJC28 (experimental group). After two days of feeding, the total RNA of the bees in the two groups is extracted respectively, and is reversely transcribed into cDNA. The cDNA is used as template, and the efficiency of silencing GFP is detected by RT-qPCR. According to A in DnaJC28 , compared with the control group, dsRNA - DnaJC28 can reduce Figure 3The expression level in the Chinese honeybee reached a silencing level. DnaJC28 The effect.
[0095] 4. Identify the Chinese honeybee DnaJC28 After successful silencing with dsRNA-DnaJC28, 60 foraging bees were collected and divided into two groups (30 bees per group). Following the method in step 3, the two groups were fed dsRNA-GFP and dsRNA-DnaJC28 respectively. After two days of incubation, both groups were treated with heat stress (43°C), and mortality was recorded every 0.5 hours. DnaJC28 From B, we can know that silence Figure 3 Reduce the survival rate of Chinese honeybees under heat stress conditions.
[0096] Example 4: Detection of Heterologous Overexpression of Honeybee DnaJC28 Effects on the heat resistance of Drosophila S2 cells
[0097] 1. Following the method in step 3 of Example 1, the pUAST-6×Myc-DnaJC28 eukaryotic expression vector was transfected into S2 cells of Drosophila, with cells transfected with the empty vector pUAST-6×Myc as a control.
[0098] 2. After culturing the cells from step 1 in a 25°C sterile incubator for 48 h, they were transferred to a 37°C sterile incubator for heat stress treatment. Cell status was observed at 0 h, 18 h, and 48 h after treatment using an inverted white light / fluorescence microscope. Additionally, at 48 h after treatment, both groups of cells were stained with trypan blue using a cell viability assay kit (Beyotime). After trypan blue staining, cell status was observed using a normal white light microscope. Furthermore, the number of dead cells and the total number of cells were counted using a hemocytometer to calculate the cell death rate. Observations of cell status and trypan blue staining results showed that, compared with the control group, heterologous overexpression of *Apis cerana* significantly increased cell viability. DnaJC28 It can significantly reduce the mortality rate of Drosophila S2 cells under heat stress. DnaJC28 These results further prove that the Chinese honeybee... Figure 4 It plays an important role in the thermal stress response.
[0099] Example 5: Analysis of Silent Chinese Honeybees DnaJC28 Effects on the expression levels of other antioxidant genes
[0100] 1. Take 60 foraging bees and divide them into two groups (30 bees in each group). Feed the two groups of bees dsRNA-GFP and dsRNA-DnaJC28 respectively according to the method in step 3 of Example 3. After two days of culture under normal conditions, store the samples.
[0101] 2. RNA was extracted from two groups of bees, and cDNA was synthesized. Antioxidant genes were detected using RT-qPCR. DnaJC28 , CYP4G11 , CDK5 , CDK5r , Trx1 , Trx2 , Tpx4 Tpx5 , Hsp22.6 , MsrB, GSTO2 , GSTS4 , GSTD , GSTT1 , SOD1, MKK4 , CYP336A1 , GSTZ1 , TrxR1 , p38b , Tpx3 The expression level of ). The internal reference gene is β-actin (GenBank registration number is HM640276.1).
[0102] 3. The primer sequences used for RT-qPCR are as follows:
[0103] Table 2: Primer sequences for RT-qPCR
[0104]
[0105] The study results showed that, compared with the control group, silence DnaJC28 Increase the body of Chinese honeybees CYP4G11 , CDK5 , CDK5r , Trx1 , Trx2 , Tpx4 , Tpx5 , Hsp22.6 , MsrB , GSTO2 , GSTS4 , GSTD , GSTT1 , SOD1 , MKK4 The amount of expression, reduced CYP336A1 , GSTZ1 and TrxR1 The amount of expression, for p38b , Tpx3 The expression level was not affected. Figure 5 ).
[0106] In summary, this invention reveals that DnaJC28 in *Apis chinensis* plays a role in the cytoplasm. Compared to the control group, both short-term and long-term heat stress can induce cytoplasmic hyperthermia in *Apis chinensis*. DnaJC28 The expression; and as the degree of heat stress increases, DnaJC28 The degree of induction increases. Furthermore, this invention provides a method for silencing hysteria in Chinese honeybees.DnaJC28 nucleotide sequence fragments. And it is confirmed that the silencing DnaJC28 reduces the survival rate of Apis cerana under heat stress. The silencing DnaJC28 subsequently, the induced expression of some antioxidant genes may make up DnaJC28 the function of the gene, reducing the oxidative damage of Apis cerana under heat stress. Subsequently, the present application provides heterologous overexpression of Apis cerana DnaJC28 can improve the survival rate of Drosophila S2 cells under heat stress, further confirming DnaJC28 plays an important role in heat stress, and has the potential to promote heat-resistant breeding innovation. In the context of global warming, the heat resistance of Apis cerana DnaJC28 , it is expected to improve the survival rate and yield of other economic animals under heat stress by expressing the gene in other economic animals through gene editing or transgenic technology in the future, which has important economic value.
[0107] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications
[0108] equivalent replacements, improvements, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. Apis cerana DnaJC28 Use of the gene in any one of the following (1)-(2): (1) preparing a product that modulates the ability of an insect to resist heat stress; (2) breeding an insect variety that has an enhanced ability to resist heat stress under heat stress conditions; The Apis cerana DnaJC28 The gene is a DNA molecule as shown in i) or ii): i) a DNA molecule having the nucleotide sequence set forth in SEQ ID NO. 1 ; ii) a DNA molecule other than i) that encodes the amino acid sequence set forth in SEQ ID NO.
2.
2. Apis cerana DnaJC28 Use of a protein encoded by a gene in the preparation of a product for regulating the heat resistance of insects under heat stress; the Apis cerana DnaJC28 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.
2.
3. A biological material comprising the Apis cerana cerana of claim 1. DnaJC28 Use of the biological material of the Apis cerana cerana gene in any one of (1) to (2) below: (1) preparing a product that modulates the ability of an insect to resist heat stress; (2) breeding an insect variety that has an enhanced ability to resist heat stress under heat stress conditions.
4. Use according to claim 3, characterized in that, The biological material is a Chinese honey bee DnaJC28 recombinant vector, recombinant bacteria or transgenic cell line containing the gene.
5. The use according to claim 1, characterized in that, By introducing into the recipient insect variety a recombinant expression vector capable of overexpressing the Apis cerana DnaJC28 gene, insect varieties are bred that have enhanced resistance to heat under heat stress conditions.
Citation Information
Patent Citations
Apis cerana heat-resistant related gene DnaJ1 and application thereof
CN111088281A
Compositions and methods for treating p53 mediated cancer
CN118488962A