Microminiature amyotrophy-resistant related protein Utro-H3-R22, coding gene, recombinant vector, recombinant virus, product and application

Abstract

The invention belongs to the technical field of fusion proteins, and particularly relates to a mini-utrophin Utro-H3-R22 (mini-utrophin) Utro-H3-R22) as well as a coding gene and an application of the mini-utrophin Utro-H3-R22. The amino acid sequence of the mini-utrophin provided by the invention is as shown in SEQ ID NO. 1. The invention also provides a preparation method of the mini-utrophin. The method comprises the following steps: firstly, predicting the structure of a wild type amyotrophin resisting related protein (utrophin) by adopting protein structure prediction software Alphafold 3; on the basis of reading a large number of literatures and mastering the function of each structural domain, the mini-utrophin which can be loaded in the 4.7 kb capacity of the delivery carrier adeno-associated virus AAV is provided. According to the Utro-H3-R22, an N-terminal structural domain of wild type utrophin is reserved, a C-terminal structural domain is deleted, and the Utro-H3-R22 is mini-utrophin formed by connecting an R3 structural domain and an R22 structural domain through an H3 hinge region. Compared with mini-utrophin in the prior art, the compound disclosed by the invention has certain advantages in structure and function, and can be used for remarkably protecting muscle cells and improving the functions of muscles, so that the effect of treating Duchenne muscular dystrophy (DMD) is achieved.

Description

Technical Field

[0001] This invention belongs to the field of fusion protein technology, specifically relating to the micro-sized anti-muscular dystrophy-related protein Utro-H3-R22, its encoding gene, recombinant vector, recombinant virus, products, and applications. Background Technology

[0002] Duchenne muscular dystrophy (DMD) is one of the most common fatal genetic diseases in children. DMD originates from thousands of variations in the largest human gene, DMD, most of which are sporadic frameshift deletions of multiple exons, resulting in the loss of dystrophin, the anti-dystrophin protein encoded by DMD; or exon deletions occurring within the frame, leading to the production of dystrophin protein with internal shrinkage. Dystrophin protein forms an important mechanical link between cytoskeletal actin and the dystrophin-associated glycoprotein complex (DGC), which together protect the muscle membrane from damage caused by stress generated during muscle contraction. In the absence of dystrophin or dystrophin dysfunction, DGC complex expression is reduced, the myofibril membrane becomes extremely fragile, leading to myofibril necrosis, inflammatory cell infiltration, myofibril regeneration, and ultimately, the replacement of myofibrils with connective tissue, accompanied by progressive muscular sclerosis and loss of contractile function. Gene therapy-based artificial introduction of mini-dystrophin can effectively treat this muscle disease; however, a bottleneck is the inability to remove the immunogenicity of dystrophin.

[0003] Utrophin is a homolog of dystrophin, sharing high structural homology (80%) and evolutionary conservation. It also shares similar N- and C-terminal domains, spectrin-like repeats (SLRs), and hinge regions (H1, H2, H3, H4) with dystrophin. Utrophin utilizes the same structure to connect the intracellular cytoskeleton and extracellular matrix. Structural and functional diagrams can be found in [reference needed]. Figure 1 , 2Utrophin can compensate for the function of dystrophin, significantly delaying the progression of muscular dystrophy. Gene therapy-based artificial delivery of mini-utrophin, an anti-muscular dystrophy-associated protein, has become an important approach to treating DMD. Compared to mini-dystrophin gene therapy, this strategy has the advantage of supplementing the protein already present in the body, thus circumventing the immune response to dystrophin. However, experimental verification of stably expressed functional mini-utrophin is needed. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and, based on animal experimental data, to provide a highly stable mini-utrophin and its encoding gene, which significantly reduces the degree of damage to muscle cells and improves muscle function, thereby achieving the effect of treating DMD.

[0005] The first aspect of the present invention is to disclose a miniature anti-muscular dystrophy-associated protein, Utro-H3-R22, with an amino acid sequence as shown in SEQ ID NO.1.

[0006] A second aspect of the invention is to disclose a gene encoding the micro-sized anti-muscular dystrophy-associated protein Utro-H3-R22 described in the first aspect.

[0007] In some embodiments of the present invention, the nucleotide sequence is as shown in SEQ ID NO.2.

[0008] A third aspect of the invention is to disclose a recombinant vector comprising a base vector and a gene described in the second aspect inserted into the base vector.

[0009] In some embodiments of the present invention, the base vector includes a recombinant adeno-associated virus vector.

[0010] In some embodiments of the present invention, the nucleotide sequence of the promoter of the base vector is shown in SEQ ID NO. 3.

[0011] In some embodiments of the present invention, the nucleotide sequence of the RNA structural stabilizing element of the basic vector is shown in SEQ ID NO.4.

[0012] A fourth aspect of the invention is to disclose a recombinant virus comprising at least one of the coding gene described in the second aspect and the recombinant vector described in the third aspect.

[0013] In some embodiments of the present invention, the recombinant vector is transferred into the host cell by co-transfection of the host cell with three plasmids.

[0014] The fifth aspect of the present invention is to disclose a product for treating DMD, comprising at least one of the following: the miniature anti-muscular dystrophy-associated protein Utro-H3-R22 described in the first aspect, the encoding gene described in the second aspect, the recombinant vector described in the third aspect, and the recombinant virus described in the fourth aspect.

[0015] In some embodiments of the present invention, the product is a pharmaceutical product, a reagent kit, or a medical device.

[0016] The sixth aspect of the present invention discloses the use of the miniature anti-muscular dystrophy-associated protein Utro-H3-R22 described in the first aspect, the encoding gene described in the second aspect, the recombinant vector described in the third aspect, and the recombinant virus described in the fourth aspect in the preparation of products for treating DMD.

[0017] In some embodiments of the present invention, the product for treating DMD is a medicine, reagent kit, or medical device for treating DMD.

[0018] Beneficial effects:

[0019] This invention provides mini-utrophin Utro-H3-R22. Utro-H3-R22 is a mini-utrophin that retains the N-terminal domain of wild-type utrophin, deletes the C-terminal domain, and connects the R3 and R22 domains with the H3 hinge region. Compared with previously reported mini-utrophins, Utro-H3-R22 has significantly improved stability in both structure and function, can significantly protect against myocyte damage, improve muscle function, and thus achieve the effect of treating DMD. Attached Figure Description

[0020] Figure 1 Schematic diagram of the structure of wild-type anti-muscular dystrophy-related protein and Utro-H3-R22;

[0021] Figure 2 The image shows the predicted structures of wild-type anti-muscular dystrophy-related proteins and the recombinant Utro-H3-R22, as predicted by Alphafold3. Blue: Actin-binding domain (ABD); Light blue: Spectrin 1-3; Green: Spectrin 4-22; Red: CR domain (WW+ZZ).

[0022] Figure 3 The pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL) plasmid map;

[0023] Figure 4The results of staining for the MyoAAV 2A-Utro-H3-R22 capsid protein subunit;

[0024] Figure 5 Differential analysis of mini-utrophin expression and α-sg recruitment levels in mdx mice by Utro-H3-R22 and Utro-H3 / H4;

[0025] Figure 6 To analyze the difference in the proportion of central nucleus myofibrils between Utro-H3-R22 and Utro-H3 / H4 in mdx mice;

[0026] Figure 7 Differential behavioral analysis of Utro-H3-R22 and Utro-H3 / H4 in mdx mice. Detailed Implementation

[0027] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0028] mini-utrophin Utro-H3-R22, the amino acid sequence of which is shown in SEQ ID NO.1.

[0029] SEQ ID NO.1:

[0030]

[0031] The nucleotide sequence of the gene encoding the mini-utrophin Utro-H3-R22 is shown in SEQ ID NO.2.

[0032] SEQ ID NO.2:

[0033]

[0034] A recombinant vector comprising a base vector and a mini-utrophin Utro-H3-R22 encoding gene inserted into the base vector.

[0035] The base vector is preferably a recombinant adeno-associated virus vector, and the nucleotide sequence of the promoter is preferably as shown in SEQ ID NO.3.

[0036] SEQ ID NO.3:

[0037] CTAGAGCTTGCATGTCTAAGCTAGACCCTTCAGATTAAAAATAACTGAGGTAAGGGCCTGGGTAGGGGAGGTGGTGTGAGACGCTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCATGGAGCCAGAGGGGCGAGGGCAACAGACCTTTCATGGGCAAACCTTGGGGCCCTGCTGTCTAGCATGCCCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGTCCCTGGTGGATCCCCTGCATGCGAAGATCTTCGAACAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAGC。

[0038] The nucleotide sequence of the RNA structural stability element of the recombinant vector is preferably as shown in SEQ ID NO.4.

[0039] SEQ ID NO.4:

[0040] TGATCTAGAGTCGAGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGA CAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTTTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCGGCCGC.

[0041] The present invention preferably uses pAAV-MCS vector as backbone vector, modifies its promoter to the promoter shown in SEQ ID NO.3, and uses the nucleotide sequence shown in SEQ ID NO.4 as RNA structural stabilizing element. The resulting recombinant vector is short in length and easier to package into MyoAAV 2A.

[0042] The recombinant virus comprises a gene encoding the mini-utrophin Utro-H3-R22 protein or a recombinant vector. Preferably, the recombinant vector described above is introduced into the host cell via co-transfection with three plasmids. The three plasmids include the recombinant vector, a capsid plasmid, and a helper plasmid. The capsid plasmid is preferably obtained by inserting the GPGRGDQTTL motif between Q585 and A586 of the Cap protein coding sequence in the pAAV2 / 9n plasmid; the helper plasmid is preferably pAd-helper. The method of co-transfection with the host cell is not strictly required; conventional procedures in the art are acceptable.

[0043] The recombinant virus provided by this invention has a low degree of protein contamination and a viral titer as high as 5.0 × 10⁻⁶. 12 vg / ml, recruits α-Sarcoglycan (α-sg), one of the DGC complexes, which significantly protects against myocyte damage and improves muscle function, thereby achieving the effect of treating DMD.

[0044] A medicament for treating DMD, the medicament comprising mini-utrophin Utro-H3-R22 or its encoding gene or recombinant vector or recombinant virus, and pharmaceutically acceptable excipients. The preferred dosage of the medicament is 1.0 × 10⁻⁶. 13 vg / kg; the preferred method of administration is injection.

[0045] Unless otherwise specified, the following embodiments are all conventional methods.

[0046] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0047] To further illustrate the present invention, the following detailed description of the mini-utrophinUtro-H3-R22, its encoding gene, and its applications, in conjunction with the accompanying drawings and embodiments, is provided but should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] 1. Determination of the structure of Utro-H3-R22

[0050] The wild-type anti-muscular dystrophy-related protein mentioned in this invention has the accession number UniProtKB-P46939.

[0051] Utrophin (UniProtKB—P46939) exists under the fascia during the embryonic period and functions as a connector between intracellular bone cells.

[0052] The scaffold and extracellular matrix function of urotrophin is mediated by a 395 kDa protein encoded by the UTRN gene located on chromosome 6q24. The full-length UTRN transcript is 13 kb and contains 73 exons. Utrophin belongs to the spectrin family and, starting from the N-terminus, contains an N-terminal domain (N), 22 SLRs (R1-R22), four hinge structures (H1-H4), a CR, and a C-terminal domain. Studies have also identified three short N-terminal utrophin transcripts: Up71, Up113, and Up140. The promoter regions of Up71, Up113, and Up140 are located in introns 62, 55, and 44, respectively. Up113 is a 5.5kb mRNA-encoded protein with a molecular weight of 113kDa. Its N-terminus consists of 48 specific amino acids and a truncated SLR 20 (R20), while the middle region contains only the last two SLRs (R21-R22). The CR and C-terminal domains are identical to the full-length utrophin structure. It is highly expressed in sensory ganglia and is the main utrophin isoform expressed in the adult brain, hence it is also known as G-utrophin. Up71 contains only the CR region and C-terminus of the full-length utrophin, while Up140 contains 6 SLRs (R17-R22) and the C-terminus of the CR region. Up71 and Up140 are widely expressed in human tissues, relatively abundantly in lung and kidney tissues, and less abundantly in fetal testes, brain, and adult muscle tissues. As mentioned above, the full-length utrophin transcript is 13kb, which cannot accommodate the 4.7kb AAV payload. Therefore, utrophin needs to be truncated to design mini-utrophin to meet the delivery capacity of AAV. The principle of designing mini-utrophin is to remove some non-essential structural domains to meet the AAV packaging requirements while retaining as many key utrophin structural domains as possible. After designing the structural domains, the codons of mini-utrophin are optimized to improve expression levels.

[0053] Both dystrophin (UniProtKB—P46939) and utrophin (UniProtKB—P46939) belong to the spectrin family and share a common N-terminus, an intermediate rod-like structure composed of SLRs (dystrophin contains 24, utrophin contains 22), a CR domain, and a C-terminal structure. Based on a thorough review of literature investigating the effects of mini-dystrophin / utrophin with different truncation and combination methods on muscle function in DMD animal models, the design principles for mini / micro-utrophin are summarized as follows: 1) Necessity of the N-terminal domain; 2) Integrity, culpability, and essentiality of individual SLR domains; 3) Necessity and adjustability of hinges (necessity of H1 and 4, importance of H2 and H3 for connecting adjacent SLRs); 4) Necessity of the CR domain; 5) C-terminal culpability of the CT domain.

[0054] In summary, the mini-utrophin Utro-H3-R22 was designed. Utro-H3-R22 retains the N-terminal domain of the wild-type utrophin, removes the C-terminal domain, and connects the R3 and R22 domains using the H3 hinge region to form a mini-utrophin. A schematic diagram of the Utrophin and Utro-H3-R22 structures is shown below. Figure 1 As shown.

[0055] 2. Determination of the Utro-H3-R22 amino acid sequence

[0056] Utro-H3-R22, in addition to retaining some domains of the full-length utrophin, also generated new splicing regions. For the original utrophin domains, the original amino acid sequence of utrophin was maintained. For the newly generated splicing regions, the amino acid combination of the new splicing regions of SLRs was analyzed using the protein structure prediction software Alphafold 3. The predicted structure diagram is shown below. Figure 2 Although Alphafold 3 can accurately predict protein structures, its actual sequences still need to be analyzed and verified experimentally.

[0057] Utro-H3-R22 uses H3 to connect R3 and R22. This combination method retains the original hinge region while removing redundant rod-shaped regions. Its amino acid sequence is shown in SEQ ID NO.1.

[0058] Example 2

[0059] Preparation of high-titer MyoAAV 2A-Utro-H3-R22

[0060] 1. Construct a core plasmid carrying the Utro-H3-R22 gene expression cassette.

[0061] Using the pAAV-MCS vector from the AAV Helper-Free System (240071, Agilent Technologies) kit as the original backbone, the CMV promoter sequence of the pAAV-MCS vector was replaced with MHCK7, as shown in SEQ ID NO. 3. A scaled-down version of the CW3SL sequence (SEQ ID NO. 4) with WPRE and SV40PA functions was used as a stabilizing element for RNA (changing the CW3SL sequence in the original pAAV-MCS vector) to obtain the new backbone pAAV-(ITR-MHCK7-CW3SL). A codon-optimized Utro-H3-R22 gene expression cassette (SEQ ID NO. 2) was synthesized artificially and placed between the SalI and EcoRI restriction sites of the pAAV-(ITR-MHCK7-CW3SL) plasmid to obtain the pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL) core plasmid. The plasmid map is shown below. Figure 3 pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL) was identified using Sanger sequencing.

[0062] 2. Synthesis of MyoAAV 2A capsid plasmid

[0063] The GPGRGDQTTL motif was inserted between Q585 and A586 of the pAAV2 / 9n(plasmid#112865, addgene)Cap protein coding sequence using cloning technology to obtain a muscle-targeting MyoAAV 2A capsid plasmid.

[0064] 3. MyoAAV 2A-Utro-H3-R22 virus was prepared using the HEK293T triple plasmid co-transfection method.

[0065] HEK293T cells were co-transfected with the core plasmid pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL), the MyoAAV 2A capsid plasmid, and the pAd-helper plasmid (240071, Agilent Technologies). The specific method was as follows: HEK293T cells were passaged into 15 cell culture dishes with a diameter of 10 cm, each dish containing 7 × 10⁻⁶ cells. 6 cell / ml ~ 1×10 7Cells were seeded at a density of 10 cells / ml, and 10 ml of high-glucose DMEM medium containing 2% FBS and 1% penicillin antibiotics was added to each dish. Transfection was performed within 24 hours after cell seeding. The transfection steps are as follows:

[0066] 1) Calculate the amount of plasmid and PEI: The plasmid transfection mass per dish is calculated according to a fixed ratio. The amount of PEI is twice the total amount of plasmid (actual experiment: 6 μg of pAd-helper plasmid, 5 μg of MyoAAV 2A capsid plasmid, 3 μg of core plasmid pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL) and 28 μg of PEI per dish).

[0067] 2) Dilute each plasmid and PEI in 500 μl of serum-free and antibiotic-free DMEM, and let stand for 5 min; 3) Mix the diluted plasmid and PEI, let stand for 15 min, and then add them evenly to the cell culture dish. 72 h after transfection, collect the cells and supernatant for virus purification.

[0068] 4. Purification and titer determination of MyoAAV 2A-Utro-H3-R22

[0069] The virus was purified using ultracentrifugation, with the following steps: Cells were first subjected to six freeze-thaw cycles in liquid nitrogen and a 37°C water bath. Then, 4 volumes of lysis buffer (containing 50 U / mL benzonase (Sigma) and 150 mM NaCl) were added to both cells and supernatant, and the mixture was treated at 37°C for 1 h. The cells were then centrifuged at 2500 × g for 15 min, and the cells and supernatant were combined and purified further using density gradient centrifugation with iodixanol (OptiPrep (Sigma)). The main steps are as follows: First, prepare iodixanol gradient solutions of 15%, 25%, 40%, and 58% concentrations using 60% iodixanol and PBS-MK Buffer (1×PBS, 1mM MgCl2, 2.5mM KCl), and add them sequentially to 39mL Quick-Seal tubes (Beckman 30Coulter). Then, add the supernatant containing the lysis buffer of the treated MyoAAV 2A-Utro-H3-R22, and centrifuge at 48,000 rpm at 18°C ​​for 2 hours using a Backman ultracentrifuge (Optima XPN-100) with a 70Ti rotor. After centrifugation, aspirate the 40% gradient phase solution, dialyze it with PBS buffer, and then concentrate it by ultrafiltration using an Amicon Ultra-15 (MWCO 100 kDa, Merck Millipore) tube to obtain purified MyoAAV 2A-Utro-H3-R22. Aliquot the purified solution and store it at -80°C.

[0070] The purified MyoAAV 2A-Utro-H3-R22 virus titer was determined by real-time PCR using the iQSYBR Green Supermix kit (Bio-Rad). The DNA copy number of MyoAAV 2A-Utro-H3-R22 virus was determined and the titer of MyoAAV 2A-Utro-H3-R22 was obtained by plotting a standard curve based on the CT (Cycle Threshold) value and copy number of the plasmid standard.

[0071] The formula for calculating plasmid copy number is: 6.02 × 10⁻⁶. 23 (Copies / mol) × Plasmid concentration (g / μl) / Average molecular weight of plasmid (MV) (g / mol) = Copy number / μl. The pAAV-(ITR-MHCK7-Utro-H3-R22-CW3SL) plasmid standard was prepared according to the above formula, and six gradients were prepared using the 10-fold dilution method: 1 × 10⁻⁶ 9 1×10 8 1×10 7 1×10 6 1×10 5 1×10 4 (copy / μl); the primers selected were the MHCK7 promoter-specific quantitative primers MHCK7-F (SEQ ID NO.5, 5'-GCTTATACGTGCCTGGGACT-3') and MHCK7-R (SEQ ID NO.6, 5'-TGACTTGCTCACTGGTTCCT-3'). The viral titer was expressed as vector genome (VG) / ml. The detection results showed that the MyoAAV 2A-Utro-H3-R22 viral titer provided by this invention was 5.0 × 10⁻⁶. 12 The viral purity was analyzed using vg / ml and combined with protein staining results of the three subunits of the viral capsid protein. The results showed that the MyoAAV 2A-Utro-H3-R22 virus of this invention had low protein contamination, and the three subunits of the capsid protein showed single and proportionate bands (see results). Figure 4 (As shown).

[0072] Example 3

[0073] 1. According to 1.0×10 13At a dose of vg / kg, MyoAAV 2A-Utro-H3-R22 purified in Example 2 and another mini-utrohpin viral vector, MyoAAV 2A-Utro-H3 / H4 (which has been submitted for approval), were delivered intraperitoneally (1710SN syringe, Hamilton) to five newborn 3-day-old mdx mice (DMD model mice, Jackson Laboratory). Simultaneously, five age-matched mdx mice and five age-matched C57 mice (Wildtype, WT) were injected with the corresponding volume of PBS, and the mice were labeled using an Aramis Micro tattoo kit (Ketchum Manufacturing Inc, Canada). Four weeks later, behavioral indicators were assessed, or the extensor digitorum longus muscle was dissected or the quadriceps femoris, gastrocnemius muscle, myocardium, diaphragm, and liver were cryopreserved under isoflurane (R510-22-10, Reward) anesthesia.

[0074] 2. Expression level of Utro-H3-R22 and recruitment level of DGC in injected mice

[0075] Using Vinculin as an internal control, the expression level of Utro-H3-R22 and the recruitment level of α-sg (a DGC) in injected mice were detected by immunoblotting. Simultaneously, the therapeutic effect was evaluated by comparing the expression and α-sg recruitment levels of Utro-H3-R22 and Utro-H3 / H4 in injected mouse tissues. The specific procedure was as follows: 30 mg of tissue was added to 300 μl of pre-chilled protein lysis buffer (89901, ThermoFisher), placed on ice, appropriately chopped, and a small amount of zirconium oxide particles were added. The mixture was then homogenized at 12000 rpm in a Bullet Blender Storm / Lite chromatography chamber at 4°C. After homogenization, the sample was removed, incubated at 4°C for 30 min, centrifuged at 12000 rpm for 10 min at 4°C, and 200 μl of the supernatant was used for protein quantification (23227, ThermoFisher). After quantification, place the protein sample in a water bath or metal container and heat at 85℃ for 10 min. Spot the sample from the collection tube cap, aliquot, and store at -80℃ for later use. Before electrophoresis, place the pre-cast gel (M00657, Nanjing Genscript Biotech Co., Ltd.) in the electrophoresis tank and add the required volume of 1×MESSDS Running Buffer. Load 20 μg of the target tissue protein into each well, and simultaneously load 3 μl of PageRuler pre-stained protein marker into one well. Electrophore at 80V for approximately 30 min. After the sample enters the separating gel, increase the voltage to 130V and electrophore until the target proteins are completely separated (refer to the separation distance of the pre-stained marker bands). During transfer, place the sponge pad, filter paper, gel, PVDF membrane (IPVH00010, Immobilon), filter paper, and sponge pad sequentially on the black side of the transfer clamp, and then fold the white side over to clamp the black side. The entire process is carried out in a vessel containing transfer buffer, while avoiding air bubble formation. The PVDF membrane needs to be pre-cut and activated in methanol for 3 seconds. The assembled transfer clamps are placed into the transfer tank according to the corresponding electrodes. A certain volume of pre-cooled transfer buffer is added to the transfer tank. After powering on, the tank is placed in an ice-filled foam box for transfer. Based on the molecular weight of the protein to be detected according to this invention, 300 mA and 90 min are determined to be the optimal transfer conditions. After transfer, the membrane is removed and placed in 5% skim milk blocking buffer, blocked at room temperature for 2 h, rinsed with 1×PBT for 5 min × 3, and then the band containing the target protein is cut out according to the pre-stained protein marker. The primary antibody is diluted with 1×PBST.

[0076] In this invention, the antibody utrophin(3B6) (sc-33699, Santa), which specifically recognizes the N-terminus of Utrophin, is used to recognize Utro-H3-R22 at a dilution of 1:200. The antibody α-sarcoglycan(ɑ-sg) (189254, Abcom) is diluted 1:2000, and the antibody vinculin (V9131, Sigma) is diluted 1:10000. The corresponding antibodies and protein bands are placed in an antibody incubation chamber and incubated overnight at 4°C. The next day, the bands are removed and washed in 1×PBST for 5 min × 3. The secondary antibody is diluted with 1×PBST. The secondary antibody is HRP-goat anti-rabbit IgG(H+L) (SA00001-2, Proteintech), diluted 1:5000. The primary antibody band corresponding to the secondary antibody's properties is placed in the corresponding secondary antibody dilution buffer and incubated at room temperature for 1 h. Remove the band and rinse it in 1×PBST for 5 min × 3 times. After washing, place the band in 1×PBS. Develop the gel imaging system; the results are as follows. Figure 5 As shown.

[0077] according to Figure 5 It can be seen that, compared with PBS-injected MDX mice, Utro-H3-R22-injected MDX mice significantly expressed Utro-H3-R22 in the gastrocnemius, myocardium, and diaphragm, with the highest expression level of Utro-H3-R22 in the myocardium. Figure 5 C), followed by the diaphragm ( Figure 5 B), the lowest expression level was found in the gastrocnemius muscle tissue ( Figure 5 A) Utro-H3-R22, when significantly expressed, can recruit a certain level of DGC complex. Furthermore, myocardial tissue with the highest Utro-H3-R22 expression level recruited α-sg higher than Utro-H3 / H4.

[0078] 3. Effect of Utro-H3-R22 on the proportion of central nuclei in muscle fibers of mice injected with mdx

[0079] An increased proportion of the central nucleus in muscle fibers indicates regenerative activity following chronic or recurrent injury and is a pathological feature of DMD patients. In this invention, the hematoxylin and eosin (H&E) staining method was used to detect the effect of Utro-H3-R22 on the proportion of central nucleus muscle fibers injected with mdx. The specific method is as follows: Fresh tissue was picked up with forceps and quickly immersed in pre-cooled isopentane for 10-20 seconds until the tissue was completely frozen. The frozen tissue block was then placed on a specimen holder, and OCT embedding agent was added to cover the tissue. Using a cryostat, the tissue was cut into 8-10 μm thick sections, attached to pre-treated glass slides, and the pathological characteristics of the quadriceps femoris muscle in four groups of mice were detected according to the standard H&E method. The results are as follows: Figure 6As shown, compared with the WT+PBS group, the central nucleus proportion of the mdx+PBS group was significantly increased (P<0.0001). Utro-H3-R22 could significantly downregulate the central nucleus proportion of mdx mice (P<0.001), and its downregulation level was higher than that of mdx delivered with Utro-H3 / H4, but the difference was not statistically significant.

[0080] 4. Effects of Utro-H3-R22 on grip strength in mice injected with mdx

[0081] Grip strength is a key indicator for assessing muscle function decline and treatment effectiveness. Because MDX mice lack dystrophin, their skeletal and cardiac muscles gradually degenerate, and grip strength testing can directly reflect this progressive decline in muscle strength. This invention uses the YLS-13A rat and mouse grip strength meter (Jinan Yiyan Technology Development Co., Ltd.) to measure the grip strength of each group of mice. Since grip strength is affected by body weight, this invention uses relative grip strength to reflect the actual strength level. Results are as follows... Figure 7 As shown in Figure A, compared with the WT+PBS group, the relative grip strength of the mdx+PBS group was significantly decreased (P<0.0001). Delivery of Utro-H3-R22 could increase the grip strength, but the difference was not statistically significant (P>0.05). Delivery of Utro-H3 / H4 had no statistically significant effect on the grip strength of mdx mice compared with Utro-H3-R22 (P>0.05), indicating that Utro-H3-R22 and Utro-H3 / H4 had no significant effect on the grip strength of mice.

[0082] 5. Effects of Utro-H3-R22 on motor function in mice injected with mdx

[0083] This invention uses the time to exhaustion and distance to exhaustion in a treadmill test to evaluate the effect of MyoAAV 2A-Utro-H3-R22 delivery on the motor ability of MDX mice. The specific test method is as follows: Before the test, all animals ran on a treadmill at a speed of 10 m / min for 5 minutes with a 0% incline. During the test, the treadmill was set to a fixed incline of 0%. Mice ran at a speed of 10 m / min for 5 minutes, then the acceleration was set to 1 m / min until exhaustion. The standard for exhaustion was that the animal could not run on the treadmill for 10 seconds under mechanical stimulation. The distance to exhaustion and time to exhaustion are as follows: Figure 7 As shown in B and C, compared with the WT+PBS group, the exhaustion distance and exhaustion time were decreased in the mdx+PBS group (P values ​​were P<0.0001 and P<0.0001, respectively). However, the exhaustion time and exhaustion distance of mdx mice delivered with Utro-H3-R22 were not significantly prolonged (P>0.05), which was basically consistent with the changes in mice injected with MyoAAV 2A-Utro-H3 / H4.

[0084] 6. Effects of Utro-H3-R22 on the muscle strength of the extensor digitorum longus (EDL) in mdx mice

[0085] Myasthenia gravis is a major symptom in DMD patients and DMD model mice. This invention uses the decrease in relative force after eccentric contraction of the extensor digitorum longus (EDL) muscle to assess the effect of Utro-H3-R22 on muscle strength in mdx mice. The specific method is as follows: Mice are placed supine on a dissecting board under isoflurane anesthesia, and their body temperature is maintained at 37°C. The skin of the legs is peeled off to expose the hind limb muscles. The exposed muscles are moistened with buffer (100mM NaCl, 4.7mM KCl, 3.4mM CaCl2, 1.2mM KH2P4, 1.2mM MgSO4, 25mM HEPES and 5.5mM d-glucose). After the tibialis anterior muscle is dissected, the EDL is peeled off the body with sutures and immersed between two parallel platinum electrodes in an oxygenated (95% O2 and 5% CO2) buffer bath. The distal end of the EDL is suspended from the cantilever of the force sensor, and the proximal end is suspended from the cantilever of the slider. The static tension of the EDL was adjusted to 10 mN, and the EDL was allowed to equilibrate in the bath for at least 10 minutes. Based on the determination of the optimal initial muscle length (Lo), after equilibration for 2 minutes, 5 eccentric contraction (ECC) injuries were performed, once every 2 minutes at a frequency of 100 Hz. The relative force decrease after 5 eccentric contractions was calculated. The results are as follows: Figure 7 As shown in Figure D, compared with the WT+PBS group, the relative decrease in the force of 5 ECL ECCs [Fraction of First Contration%] in the mdx+PBS group was significantly lower (P<0.0001). After injection of Utro-H3-R22 provided by this invention, [Fraction of First Contration%] was significantly higher than that in the mdx+PBS group (P<0.01). Delivery of Utro-H3 / H4 could also significantly improve the level of [Fraction of First Contration%] (P<0.05), but the improvement effect was not as obvious as that of Utro-H3-R22. The difference between the two was not statistically significant (P>0.05).

[0086] As can be seen from the above, the Utro-H3-R22 provided by this invention exhibits certain advantages in structure and function, can significantly protect against damage to muscle cells, improve muscle function, and thus achieve the effect of treating DMD.

[0087] The preferred embodiments and examples of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments and examples. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the concept of the present invention.

Claims

1. A mini-dystrophin related protein Utro-H3-R22 having an amino acid sequence as set forth in SEQ ID NO.

1.

2. A gene encoding the mini-dystrophin related protein Utro-H3-R22 according to claim 1.

3. The gene of claim 2, wherein, a nucleotide sequence as set forth in SEQ ID NO.

2.

4. A recombinant vector, characterized in that, comprising a basic vector and a gene according to claim 2 or 3 inserted into the basic vector.

5. The recombinant vector of claim 4, wherein, the basic vector comprises a recombinant adeno-associated viral vector.

6. The recombinant vector of claim 4 or 5, wherein, a nucleotide sequence of a promoter of the basic vector as set forth in SEQ ID NO. 3; and / or, a nucleotide sequence of an RNA structural stability element of the basic vector as set forth in SEQ ID NO.

4.

7. A recombinant virus, characterized in that, comprising (a) a gene according to claim 2 or 3, and, (b) a recombinant vector according to any one of claims 4-6 at least one of them.

8. The recombinant virus of claim 7, wherein, The recombinant vector is transferred into a host cell by a way of triple plasmid co-transfecting the host cell.

9. A product for the treatment of DMD, characterized in that, comprising (a) a mini-dystrophin related protein Utro-H3-R22 according to claim 1, (b) a gene according to claim 2 or 3, (c) a recombinant vector according to any one of claims 4-6, and, (d) a recombinant virus according to claim 7 or 8 at least one of them.

10. Use of the mini-dystrophin related protein Utro-H3-R22 according to claim 1, the gene according to claim 2 or 3, the recombinant vector according to any one of claims 4-6, and the recombinant virus according to claim 7 or 8 in the preparation of a product for treating DMD.

Images