Grass carp elovl5 gene mutant as well as preparation method and application thereof

By targeting exon 3 of the grass carp elovl5 gene with CRISPR/Cas9 technology and microinjecting sgRNA and Cas9 protein, the problems of long cycle, low efficiency and high cost of increasing DHA content in grass carp in existing technologies have been solved, and the specific enrichment of DHA in grass carp tissues has been achieved.

CN120989082APending Publication Date: 2025-11-21INST OF AQUATIC LIFE ACAD SINICA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511251615.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-03
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing technologies for increasing DHA content in important economic fish species such as grass carp suffer from problems such as long cycle time, low efficiency, high cost and limited resources. Furthermore, the applicability and effectiveness of gene function research in grass carp are unclear, and there is a lack of efficient and specific technical means to increase DHA content.

Method used

Using CRISPR/Cas9 technology, a specific sgRNA was designed to target exon 3 of the grass carp elovl5 gene. The sgRNA and Cas9 protein were introduced into grass carp single-cell stage fertilized eggs via microinjection, inducing gene mutation, disrupting the Elovl5 protein encoding, and increasing DHA content.

Benefits of technology

It significantly increases the DHA content in the liver, muscle, and brain tissue of grass carp, while not significantly increasing the content of EPA and DPA, achieving specific enrichment of DHA, which meets the needs of healthy consumption.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989082A_ABST
    Figure CN120989082A_ABST
Patent Text Reader

Abstract

The invention provides a grass carp elovl5 gene mutant as well as a preparation method and application thereof, and relates to a gene engineering technology. Wherein a guide sequence contained in the sgRNA of the targeted grass carp elovl5 gene has a nucleotide sequence as shown in SEQ ID NO. 4. The specific guide sequence contained in the sgRNA can accurately and efficiently target and mediate mutation of the third exon of the grass carp elovl5 gene. The elovl5 gene can significantly improve the DHA content in the liver, muscle and brain tissues of the lovl5 gene. The method has the key advantages that the effect has high selectivity, and the content of EPA and DPA in the liver and the brain cannot be remarkably increased while the DHA is increased, so that specific enrichment of the DHA is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a grass carp elovl5 gene mutant, its preparation method, and its application. Background Technology

[0002] As the core of modern biotechnology, genetic engineering technology aims to precisely modify, alter, or recombine the genetic material of organisms to directionally improve their hereditary traits, thereby meeting specific needs in agriculture, medicine, and industry. In aquaculture, using genetic engineering to cultivate new varieties with superior traits such as rapid growth, strong disease resistance, and high nutritional value has become an important direction for promoting the sustainable development of the industry. Among these efforts, improving the nutritional quality of aquatic products through genetic engineering, particularly enhancing the content of specific nutrients crucial to human health, is currently a hot topic in technological research and has profound significance for optimizing dietary structure and improving national health.

[0003] Currently, to increase the content of beneficial long-chain polyunsaturated fatty acids such as docosahexaenoic acid (DHA) in aquatic animals, existing technologies mainly rely on two approaches: traditional breeding and feed nutrition regulation. Traditional breeding involves screening and hybridizing parents exhibiting specific desirable traits, and through multiple generations of breeding, aims to obtain offspring with stable traits. Feed nutrition regulation involves directly adding functional ingredients rich in DHA, such as fish oil and microalgae powder, to aquatic feed, allowing fish to directly accumulate DHA through ingestion. In addition, in molecular biology research, researchers have conducted preliminary explorations into the functions of key genes in fatty acid synthesis pathways, such as members of the fatty acid elongase (elovl) family. For example, in model organisms such as zebrafish, gene knockout and other techniques have demonstrated that altering the expression of certain elongase genes can affect the composition and content of fatty acids in their bodies.

[0004] However, the aforementioned existing technologies all have significant limitations in practical applications. Traditional selection breeding methods are time-consuming, typically requiring several years or even longer to cultivate varieties with stable traits, and the breeding process is highly uncertain. Because nutritional traits such as DHA content are complex quantitative traits, influenced by multiple gene regulation and environmental factors, relying solely on phenotypic selection for breeding is inefficient and difficult to achieve precise improvement. For feed nutrient regulation, the main drawback is the high cost and dependence on external resources. High-quality fish oil and DHA-rich microalgae are expensive raw materials, and large-scale application significantly increases the cost of aquaculture. Simultaneously, global fish oil resources are becoming increasingly scarce, and relying on external supplementation does not meet the requirements of green and sustainable development in the industry; furthermore, this method does not fundamentally improve the fish's own ability to synthesize or convert DHA.

[0005] In summary, existing technologies face numerous challenges in increasing DHA content in important economic fish species such as grass carp. Traditional breeding techniques suffer from long cycles, low efficiency, and insufficient precision. Methods involving feed additives to increase DHA content are hampered by high costs and limited external resources, hindering large-scale application. While some reports exist on fatty acid synthesis pathway genes at the gene function research level, these studies are largely confined to model organisms. The applicability and specific effects of related technologies in major freshwater farmed fish like grass carp remain unclear. Furthermore, existing research often leads to a general increase in the content of various fatty acids, lacking a precise, efficient, and economical technique for specifically increasing DHA content in grass carp at the gene level.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The present invention aims to provide a grass carp elovl5 gene mutant, its preparation method, and its applications. The sgRNA contains a specific guide sequence that can precisely and efficiently target and mediate mutations in exon 3 of the grass carp elovl5 gene. The elovl5 gene can significantly increase DHA content in its liver, muscle, and brain tissues. Its key advantage lies in the high selectivity of this effect; while increasing DHA, it does not significantly increase the content of EPA and DPA in the liver and brain, thus achieving specific enrichment of DHA.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides an sgRNA targeting the grass carp elovl5 gene, the guide sequence of which has a nucleotide sequence as shown in SEQ ID NO.4.

[0009] In an optional embodiment, the sgRNA targets a site located on exon 3 of the grass carp elovl5 gene; and / or, the nucleotide sequence of the sgRNA targeting the grass carp elovl5 gene is shown in SEQ ID NO.1.

[0010] Secondly, the present invention provides a primer pair for preparing a transcription template of sgRNA as described in the foregoing embodiments, the primer pair comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0011] Thirdly, the present invention provides a method for constructing a grass carp elovl5 gene mutant, comprising: The sgRNA targeting the grass carp elovl5 gene, as described in the aforementioned embodiments, along with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the fertilized eggs of grass carp in the single-cell stage to induce a mutation at the target site of the elovl5 gene, thereby disrupting the encoding of the Elovl5 protein and obtaining a gene-mutated grass carp with increased DHA content.

[0012] In an optional implementation, the steps collectively introduce a single-celled fertilized egg from a grass carp, including: The sgRNA was mixed with Cas9 mRNA and then injected into 1,000 to 2,000 grass carp single-cell stage fertilized eggs via microinjection. After 24 hours of fertilization following injection, some embryos were collected to extract the genome, which was then amplified by PCR and sequenced. Embryo batches whose sequencing results showed overlapping or disordered peaks near the target site were screened out. The selected embryos were raised until they grew into F0 generation grass carp. The tail fins were then cut off for gene testing to screen and obtain the genetically mutated grass carp.

[0013] In an optional implementation, the step involves PCR amplification and sequencing to screen for embryo batches whose sequencing results show overlapping or disordered peaks near the target site, including: Using the obtained grass carp genome as a template, gene detection was performed using primer pairs containing the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6 to identify whether the elovl5 gene has mutated.

[0014] In an optional implementation, the construction method further includes: PCR was performed using the primer pairs described above to prepare an in vitro transcription template for sgRNA. The sgRNA was synthesized by in vitro transcription using the in vitro transcription template.

[0015] Fourthly, the present invention provides a grass carp elovl5 gene mutant, which is constructed by the grass carp elovl5 gene mutant construction method described in any of the foregoing embodiments.

[0016] Fifthly, this invention provides a method for detecting the elovl5 gene in grass carp, comprising: Using the genome of the grass carp to be tested as a template, gene detection was performed using a primer pair containing the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0017] Sixthly, the present invention provides the application of sgRNA targeting the grass carp elovl5 gene as described in the foregoing embodiments as a gene editing tool in the cultivation of grass carp varieties with increased DHA content.

[0018] This invention provides a grass carp elovl5 gene mutant, its preparation method, and its applications. The sgRNA contains a specific guide sequence (SEQ ID NO.4) that can precisely identify and guide gene editing tools to target a specific site on exon 3 of the grass carp elovl5 gene. This high targeting specificity is the basis for its effectiveness, ensuring the accuracy of subsequent gene modification.

[0019] When this sgRNA is applied to gene editing, it exhibits highly efficient mediating ability, effectively inducing mutations in the elovl5 gene at the target site. Experimental results show that the mutation mediated by this sgRNA significantly reduces the expression level of the elovl5 gene in the liver and brain tissue of grass carp, demonstrating its functionality and effectiveness as a gene editing tool.

[0020] The most significant beneficial effect is reflected in its ultimate biological impact. Grass carp obtained using this sgRNA showed a significant upregulation of docosahexaenoic acid (DHA) levels in their liver, muscle, and brain tissues. Notably, this DHA enhancement was highly selective, without simultaneously causing significant changes in the levels of other ω-3 polyunsaturated fatty acids such as EPA and DPA in the liver and brain. This specific enrichment effect on DHA makes the resulting fish more aligned with health-conscious consumer demands and is also more conducive to the subsequent breeding of high-quality new fish varieties. Attached Figure Description

[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1 This is a schematic diagram of the elovl5 gene target site sequence provided in Example 1 of this application, and a peak diagram of sequencing results including the mutation site; Figure 2 The results of single-molecule fluorescence in situ hybridization of the liver and brain tissues of grass carp with the elovl5 gene mutation in Example 5 of this application show that the expression level of elovl5 RNA is significantly downregulated in the mutant tissues. Figure 3This is a bar chart showing the fatty acid composition analysis of the livers of elovl5 mutant and wild-type grass carp in Example 5 of this application; Figure 4 This is a bar chart showing the fatty acid composition analysis of the muscle of elovl5 mutant and wild-type grass carp in Example 5 of this application; Figure 5 This is a bar chart showing the analysis of fatty acid composition of the brain of elovl5 mutant and wild-type grass carp in Example 5 of this application. Detailed Implementation

[0023] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0024] In this embodiment of the application, an sgRNA targeting the grass carp elovl5 gene is provided, the guide sequence of which has a nucleotide sequence as shown in SEQ ID NO.4.

[0025] In some embodiments, the sgRNA targets a site located on exon 3 of the grass carp elovl5 gene.

[0026] In some embodiments, the nucleotide sequence of the sgRNA targeting the grass carp elovl5 gene is shown in SEQ ID NO. 1.

[0027] The nucleotide sequence shown in SEQ ID NO.4 is as follows: 5'-GAGACAGGAGCGTCAGGAAG-3'.

[0028] The above embodiments provide a molecular breeding approach to increase DHA content in grass carp tissues. To achieve this, precise mutation of the elovl5 gene in grass carp is required. The elovl5 gene is a key member of the fatty acid elongase family and plays an important role in DHA biosynthesis. The aforementioned sgRNA is specifically designed based on the CRISPR / Cas9 knockout principle, and its guide sequence, as shown in SEQ ID NO.4, can specifically recognize and bind to a specific target site in the grass carp elovl5 genome sequence. The specific target site is located in exon 3 of the elovl5 gene.

[0029] In the specific implementation process, the sgRNA containing this guide sequence will be used, and its complete nucleotide sequence is shown in SEQ ID NO.1. SEQ ID NO.1: TGTAATACGACTCACTATAGAGACAGGAGCGTCAGGAAGTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT.

[0030] After being mixed with Cas9 mRNA, the sgRNA was injected into grass carp single-cell stage fertilized eggs via microinjection. Once inside the cell, the sgRNA molecule guides the Cas9 protein to precisely locate exon 3 of the elovl5 gene, cleaving it at that site and causing insertion or deletion mutations, ultimately disrupting the coding of the Elovl5 protein. Experimental results showed that the elovl5 gene-mutated grass carp model constructed using this sgRNA significantly upregulated DHA levels in the liver, brain, and muscles. Therefore, the sgRNA is a key tool for precise and effective editing of the grass carp elovl5 gene and is the technological basis for constructing DHA-rich fish models.

[0031] In this embodiment, a primer pair for preparing a transcription template of sgRNA as described in the foregoing embodiments is provided. The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. Specifically: (1) Forward primer SEQ ID NO.2: 5'-TGTAATACGACTCACTATAGAGACAGGAGCGTCAGGAAGGTTTTAGAGCTAGAAAT-3'; (2) Reverse primer SEQ ID NO.3: 5'-AGCACCGACTCGGTGCCACTTTTTC-3'.

[0032] In the specific construction method, the primer pairs described above are the first step in achieving in vitro synthesis of sgRNA. They are used in a polymerase chain reaction (PCR). In this PCR reaction, pMD19T-gRNA can be used as a template, and the DNA sequence can be amplified using the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3.

[0033] The product obtained after amplification and purification via this PCR reaction serves as the gRNA template for in vitro transcription. This template is then transcribed into the final functional sgRNA molecule by T7 transcriptase. Therefore, the primer pair described above is an essential upstream component of the entire technical process, and its specific sequence design is the prerequisite and foundation for successfully preparing the aforementioned functional sgRNA.

[0034] This application provides a method for constructing a grass carp elovl5 gene mutant, including: The sgRNA targeting the grass carp elovl5 gene, as described in the aforementioned embodiments, along with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the fertilized eggs of grass carp in the single-cell stage to induce a mutation at the target site of the elovl5 gene, thereby disrupting the encoding of the Elovl5 protein and obtaining a gene-mutated grass carp with increased DHA content.

[0035] The aim of this method is to increase the DHA content in grass carp tissues at the genetic level through precise gene editing, providing a technical solution and molecular model for breeding new grass carp varieties with superior nutritional traits. The core step of this method is to introduce key gene-editing components into the single-cell stage fertilized eggs of grass carp.

[0036] Specifically, single-cell fertilized eggs can be selected as the target for manipulation, ensuring that gene modification can be integrated into the entire developmental process of grass carp, thereby obtaining globally mutant individuals. The introduced components include: (1) sgRNA containing a specific guide sequence (SEQ ID NO.4) as described above, which is responsible for precisely guiding the gene editing system to the predetermined target site on exon 3 of the elovl5 gene; (2) Cas9 protein or mRNA encoding Cas9 protein, wherein Cas9 protein is a "molecular scissor" that performs gene cutting function. In a specific embodiment, this introduction step can be accomplished by microinjecting a mixture of sgRNA and Cas9 mRNA.

[0037] Once these components enter the fertilized egg, the sgRNA guides the Cas9 protein to cause a double-strand break in the DNA at the target site of the Elovl5 gene. When the cell repairs this break, it produces mutations such as insertions or deletions, which disrupt the original coding frame of the Elovl5 protein, leading to its loss of function.

[0038] By implementing this method, F0 generation grass carp with an effective mutation in the elovl5 gene were obtained. Fatty acid profile analysis of these mutant grass carp showed that the DHA content in their liver, brain, and muscle tissues was significantly upregulated compared to the wild type. This indicates that the construction method successfully achieved the expected technical effect, namely, significantly increasing the DHA content of grass carp by targeting the mutation of the elovl5 gene, thereby constructing a superior fish model with abundant DHA.

[0039] In some embodiments, the steps collectively introduce a single-celled fertilized egg from a grass carp, including: The sgRNA was mixed with Cas9 mRNA and then injected into 1,000 to 2,000 grass carp single-cell stage fertilized eggs via microinjection.

[0040] This step clarifies the specific steps for introducing the gene-editing components. Specifically, the aforementioned sgRNA and Cas9 mRNA can be mixed, and then the mixture can be injected into single-cell stage fertilized eggs of grass carp using a microinjection technique. The claim also provides a preferred range for the number of embryos processed, namely 1000 to 2000. For example, it could be 1000, 1200, 1500, 1800, 2000, etc.

[0041] After 24 hours of culturing the injected fertilized eggs, a portion of the embryos were collected to extract the genome, which was then amplified by PCR and sequenced. Embryo batches with sequencing results showing overlapping or disordered peaks near the target site were screened out.

[0042] This step provides an early screening process. After microinjection, fertilized eggs are cultured in culture water for another 24 hours. Subsequently, some developing embryos are collected and their genomic DNA is extracted. The DNA fragment containing the elovl5 gene target site is amplified using PCR and sequenced. The sequencing results are used to screen embryos, and batches of embryos showing "overlapping peaks" or "random peaks" near the target site are considered successfully edited and selected. This peak pattern is a typical characteristic of heterozygous mutations in the genomic target sequence.

[0043] The selected embryos were raised until they grew into F0 generation grass carp. The tail fins were then cut off for gene testing to screen and obtain the genetically mutated grass carp.

[0044] The above steps define the subsequent rearing and final individual selection procedures. The embryos selected in the previous step are transferred to a rearing system for long-term rearing until they reach F0 generation adult size (approximately 1 year old). Samples are taken from the tail fins of the F0 generation grass carp for further genetic testing (PCR and sequencing), ultimately identifying and obtaining grass carp individuals carrying the stable mutation of the elovl5 gene. This series of detailed steps ensures the operability, reproducibility, and success rate of the entire construction method.

[0045] In some embodiments, the step involves PCR amplification and sequencing to screen for embryo batches whose sequencing results show overlapping or disordered peaks near the target site, including: Using the obtained grass carp genome as a template, gene detection was performed using primer pairs containing the forward primer shown in SEQ ID NO. 5 and the reverse primer shown in SEQ ID NO. 6 to identify whether the elovl5 gene has mutated. The specific primer pairs are as follows: (1) Positive phase primer SEQ ID NO.5: 5'-GGATGGCTTCTGCTGGAC-3'; (2) Reverse primer SEQ ID NO.6: 5'-CGGTTTACCCTCGTTGCT-3'.

[0046] In some implementations, the construction method further includes: PCR was performed using the primer pairs described above to prepare an in vitro transcription template for sgRNA.

[0047] The above describes the first stage, which involves preparing an in vitro transcription template for sgRNA. This step is accomplished using polymerase chain reaction (PCR), employing the primer pair consisting of the forward primer of SEQ ID NO.2 and the reverse primer of SEQ ID NO.3. Using pMD19T-gRNA as a template, PCR amplification with this primer pair yields a specific DNA product. This purified product then serves as the template for the next transcription reaction.

[0048] The sgRNA was synthesized by in vitro transcription using the in vitro transcription template.

[0049] The above describes the second stage, which involves in vitro transcription to synthesize sgRNA. The gRNA template prepared in the previous stage is used in vitro for transcription, along with components such as T7 transcriptase, in a suitable reaction system for in vitro transcription. Through this reaction, the final functional sgRNA molecule is synthesized using DNA as a template.

[0050] In this application embodiment, a grass carp elovl5 gene mutant is provided, which is constructed by the grass carp elovl5 gene mutant construction method described in any of the foregoing embodiments.

[0051] This application provides a method for detecting the elovl5 gene in grass carp, comprising: Using the genome of the grass carp to be tested as a template, gene detection was performed using a primer pair containing the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0052] Specifically, the forward primer sequence of SEQ ID NO.5 and the reverse primer sequence of SEQ ID NO.6 can be used to perform PCR reaction with the grass carp tail fin genome as a template, and the grass carp with the elovl5 gene mutation can be screened by sequencing using SEQ ID NO.5.

[0053] In this application embodiment, an application is provided of sgRNA targeting the grass carp elovl5 gene as described in the foregoing embodiments as a gene editing tool in the cultivation of grass carp varieties with increased DHA content.

[0054] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0055] Example 1 In this embodiment, a method for preparing gRNA is provided.

[0056] Experimental methods: (1) Based on the CRISPR / Cas9 knockout principle, design and synthesize a system containing... elovl5 Two sgRNA sequences containing gene target site sequences, among which... elovl5 Gene target sites such as Figure 1 As shown, preferably, the target sequence of the gRNA is located at... elovl5 The site sequence on exon 3 of the gene is the nucleotide sequence shown in SEQ ID NO.4. SEQ ID NO.4: 5'-GAGACAGGAGCGTCAGGAAGAGG-3'.

[0057] (2) Synthesize PCR primers for constructing the sgRNA template. The synthesized primer sequences include the forward primer sequence as shown in SEQ ID NO.2 and the reverse primer sequence as shown in SEQ ID NO.3. The specific primer sequences are as follows: SEQ ID NO.2: 5'-TGTAATACGACTCACTATAGAGACAGGAGCGTCAGGAAGGTTTTAGAGCTAGAAAT-3'; SEQ ID NO.3: 5'-AGCACCGACTCGGTGCCACTTTTTC-3'.

[0058] (3) Using the primers synthesized in step S2, PCR was performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product was purified and recovered to prepare an in vitro transcription template for gRNA. To obtain the gRNA template, perform PCR amplification using the following reaction system: Table 1. Reaction System

[0059] Prepare a 200 μL PCR system and follow the PCR program as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 30 cycles; 72 ºC for 10 min.

[0060] The PCR product purification and recovery steps are as follows: 1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0061] 2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0062] 3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), let it stand at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0063] 4) Add 600 μL of washing buffer PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0064] 5) Repeat step 4.

[0065] 6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry completely, to prevent residual washing solution from affecting the next step of the experiment.

[0066] 7) Place the adsorption column CB2 into a clean centrifuge tube, and add 30-50 μL of elution buffer EB to the center of the adsorption membrane. Incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution.

[0067] (4) The gRNA in vitro transcription template prepared in step S3 is transcribed in vitro using T7 transcriptase, purified and recovered to obtain gRNA.

[0068] Example 2 In this embodiment, gRNA was obtained by in vitro transcription using T7 RNA transcriptase.

[0069] Experimental methods: Add the components according to the following system and mix well: Table 2. Reaction System

[0070] After reacting at 37 ºC for 1 hour, the synthesized gRNA was purified. The specific steps are as follows: (1) DNase I treatment: Add 2.5 μL 10X buffer and 2 μL DNase I, and react at 37 ºC for 15 min to remove DNA template; (2) Then use SigmaSpin TM Purification was performed using the Sequencing reaction clean-up kit: the purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 s; (3) Twist off the bottom sealing column of the tube, then discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 min; (4) Place the purification column into a new RNase-free EP tube and discard the collection tube; (5) Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 min; (6) Collect the column solution, perform electrophoresis to detect and determine the concentration, and store it in a -80 ºC refrigerator for later use.

[0071] Example 3 In this embodiment, Cas9 mRNA is synthesized.

[0072] Experimental methods: 1. The plasmid containing the full-length Cas9 sequence was linearized by restriction endonuclease NotI, and purified and recovered using the GeneJET PCR Purification Kit for use as a transcription template.

[0073] The purification and recovery steps for PCR products are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0074] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0075] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0076] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0077] (5) Repeat step 4.

[0078] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0079] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μl of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution. Use the Ambion mMessage mMachine in vitro transcription kit to synthesize DNA in vitro. Cas9 mRNA.

[0080] The reaction system is as follows: Table 3. Reaction System

[0081] After the reaction system is prepared, mix it well and incubate it in a water bath at 37 ℃ for 2 hours.

[0082] 2. Purify and recover Cas9 mRNA according to the following steps: (1) Add 1 μL of the DNase provided in the kit to the reaction system, mix well, and incubate in a water bath at 37 °C for 15 minutes; (2) Add 20 μL of 5 M ammonium acetate, mix well, and place on ice for 10 minutes; (3) Centrifuge at 4 ℃ and 12000 rpm for 15 minutes. The white precipitate is mRNA. (4) Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7500 rpm for 5 minutes at 4 ℃; (5) Discard the supernatant, air dry the precipitate, and add 10 μL of enzyme-free water to dissolve the precipitate; (6) Take 0.5 μL of RNA, dilute it 20 times, and test its concentration and purity. Then take 10 μL of the dilution solution for agarose gel electrophoresis to test the degree of degradation.

[0083] Example 4 In this embodiment, the construction and screening of grass carp with elovl5 gene editing were carried out.

[0084] 1. The gRNA and Cas9 mRNA obtained in step S4 are mixed and microinjected into single-cell stage grass carp fertilized eggs, with 1 nL injected into each embryo.

[0085] 2. After the gRNA and Cas9 mRNA are synthesized, prepare the injection sample according to the following system. The injection system is as follows: 3 μL: Table 4. Injection System

[0086] The number of single-celled grass carp fertilized egg embryos injected was 1,000 to 2,000.

[0087] 3. After injection, culture for 24 hours, collect some of the grass carp fertilized eggs from the microinjection stage to obtain embryos, extract the genome, PCR amplify the target sequence containing the target site and sequence it; Perform PCR amplification of the target sequence containing the target site using the following reaction system: Table 5. Injection System

[0088] The PCR program was as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 35 cycles; 72 ºC for 10 min.

[0089] The primer sequences used for target site identification include the forward primer sequence of SEQ ID NO. 5 and the reverse primer sequence of SEQ ID NO. 6: SEQ ID NO.5: 5'-GGATGGCTTCTGCTGGAC-3'; SEQ ID NO.6: 5'-CGGTTTACCCTCGTTGCT-3'; In addition, the primers in SEQ ID NO.5 are also primers used for Sanger DNA sequencing.

[0090] 4. Embryos from injection batches showing disordered peaks near the target site in the sequencing results were introduced into the rearing system. After reaching one year of age, the tail fins were cut, and the embryos were screened again using the above PCR and sequencing methods to detect effective mutant types in grass carp, thus obtaining the desired results. elovl5 Mutant grass carp; Example 5 In this embodiment, elovl5 Functional validation and phenotypic analysis of mutant grass carp.

[0091] Experimental methods: 1. Take elovl5 Liver and brain tissues of genetically mutated and wild-type grass carp were analyzed using single-molecule fluorescence in situ hybridization (SIS) technology. elovl5 Gene expression. For example... Figure 2 As shown, mutant liver and brain elovl5 The expression level of mRNA was significantly lower than that of the wild type. This result indicates that the mRNA prepared in this example targets the expression level of mRNA located in the wild type. elovl5 The gRNA on exon 3 of the gene can effectively target... elovl5 Genes undergo mutation.

[0092] 2. Take elovl5 Fatty acid composition analysis was performed on the livers of mutant and wild-type grass carp. For example... Figure 3 As shown, compared to wild-type grass carp, the grass carp prepared using this embodiment... elovl5 The mutant showed a significantly increased level of DHA (C22:6n-3) in its liver, indicating that the knockout... elovl5 It effectively promoted DHA synthesis in the liver of grass carp. However, the contents of EPA (C20:5n-3) and DPA (C22:5n-3) in the liver did not change, which is inconsistent with the previous conclusion that knocking out elovl5 in other fish species led to an increase in both EPA and DPA.

[0093] 3. Take elovl5 Fatty acid composition analysis was performed on brain tissue from mutant and wild-type grass carp. For example... Figure 5 As shown, compared to wild-type grass carp, the grass carp prepared using this embodiment... elovl5 The mutants had significantly higher levels of DHA in their brains, indicating that the knockout... elovl5 It can effectively increase the DHA content in brain tissue. Consistent with the results in the liver, knocking out elovl5 did not lead to an increase in EPA and DPA in brain tissue.

[0094] 4. Take elovl5 Fatty acid composition analysis was performed on the muscle tissue of mutant and wild-type grass carp. For example... Figure 4 As shown, compared to wild-type grass carp, the grass carp prepared using this embodiment... elovl5 The mutants showed a significant increase in DHA content in their muscles, indicating that the knockout... elovl5 It can effectively increase the DHA content in muscles. Simultaneously, it knocks out… elovl5 This also led to an upregulation of EPA in muscles, while the DPA content remained unchanged.

[0095] In summary, in this embodiment, by knocking out grass carp... elovl5 The gene showed a significant upregulation of DHA levels in liver, brain, and muscle tissue in the F0 generation, providing a new breeding target and method for cultivating grass carp varieties with significantly increased DHA content. Although DHA, EPA, and DPA are all omega-3 polyunsaturated fatty acids, DHA primarily plays a role in neural and visual development, cardiovascular disease treatment, and anti-inflammation. Furthermore, excessive omega-3 polyunsaturated fatty acid levels can lead to immunosuppression, metabolic disorders, and nutritional imbalances. Therefore, compared to existing fish breeding models where elovl5 knockout leads to increased EPA, DPA, and DHA levels, the model constructed in this embodiment... elovl5 The genetically mutated grass carp model is more suitable for breeding high-quality new fish varieties and is also more in line with consumers' health needs.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An sgRNA targeting the grass carp elovl5 gene, characterized in that, It contains a guide sequence having a nucleotide sequence as shown in SEQ ID NO.

4.

2. The sgRNA targeting the grass carp elovl5 gene as described in claim 1, characterized in that, The sgRNA targets a site located in exon 3 of the grass carp elovl5 gene; and / or, The nucleotide sequence of the sgRNA targeting the grass carp elovl5 gene is shown in SEQ ID NO.

1.

3. A primer pair for preparing a transcription template of the sgRNA as described in claim 1, characterized in that, The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

4. A method for constructing a grass carp elovl5 gene mutant, characterized in that, include: The sgRNA targeting the grass carp elovl5 gene as described in claim 1 or 2, together with the Cas9 protein or the mRNA encoding the Cas9 protein, is introduced into the fertilized eggs of grass carp in the single-cell stage to induce a mutation at the target site of the elovl5 gene, thereby disrupting the encoding of the Elovl5 protein and obtaining a gene-mutated grass carp with increased DHA content.

5. The method for constructing the grass carp elovl5 gene mutant as described in claim 4, characterized in that, The steps described above collectively introduce fertilized eggs from the single-cell stage of grass carp, including: The sgRNA was mixed with Cas9 mRNA and then injected into 1,000 to 2,000 grass carp single-cell stage fertilized eggs via microinjection. After 24 hours of fertilization following injection, some embryos were collected to extract the genome, which was then amplified by PCR and sequenced. Embryos whose sequencing results showed overlapping or disordered peaks near the target site were screened out. The selected embryos were raised until they grew into F0 generation grass carp. The tail fins were then cut off for gene testing to screen and obtain the genetically mutated grass carp.

6. The method for constructing the grass carp elovl5 gene mutant as described in claim 5, characterized in that, The steps involve PCR amplification and sequencing to screen for embryo batches whose sequencing results show overlapping or disordered peaks near the target site, including: Using the obtained grass carp genome as a template, gene detection was performed using primer pairs containing the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6 to identify whether the elovl5 gene has mutated.

7. The method for constructing the grass carp elovl5 gene mutant as described in claim 4, characterized in that, The construction method also includes: PCR reaction was performed using the primer pair as described in claim 3 to prepare an in vitro transcription template for sgRNA; The sgRNA was synthesized by in vitro transcription using the in vitro transcription template.

8. A grass carp elovl5 gene mutant, characterized in that, It was constructed using the method for constructing the grass carp elovl5 gene mutant as described in any one of claims 4-7.

9. A method for detecting the elovl5 gene in grass carp, characterized in that, include: Using the genome of the grass carp to be tested as a template, gene detection was performed using a primer pair containing the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.

6.

10. The application of the sgRNA targeting the grass carp elovl5 gene as described in claim 1 as a gene editing tool in the breeding of grass carp varieties with increased DHA content.