Mouse hepatitis virus antibodies or antigen-binding fragments thereof, and methods of making and using the same

Abstract

The application belongs to the technical field of biology, and particularly relates to a mouse hepatitis virus antibody or antigen-binding fragment thereof, and a preparation method and application thereof. The antibody or antigen-binding fragment thereof can specifically recognize and combine with a mouse hepatitis virus or NSP3 protein thereof, and has good affinity therewith. The antibody or antigen-binding fragment thereof can be used for preparing products for diagnosing, preventing and / or treating mouse hepatitis virus infection or diseases caused by the mouse hepatitis virus, detecting the presence or level of the mouse hepatitis virus or NSP3 protein thereof in a sample, screening drugs for preventing and / or treating mouse hepatitis virus infection or diseases caused by the mouse hepatitis virus, basic research and / or vaccine development.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to mouse hepatitis virus antibodies or their antigen-binding fragments, their preparation methods, and applications. Background Technology

[0002] Mouse hepatitis virus (MHV), a classic viral model for coronavirus research, specifically infects the liver, lungs, and central nervous system of mice, mimicking the pathogenic mechanism of human coronaviruses. Its non-structural protein 3 (NSP3) is a core component of the viral replicase complex, playing a dual crucial role in viral replication and immune escape by mediating polymerase cleavage and inhibiting the host's innate immunity (such as the interferon pathway). Therefore, the development of highly effective antibodies against mouse hepatitis virus is of significant scientific value for elucidating the pathogenic mechanism of coronaviruses, advancing antiviral drug and vaccine development, and diagnosing and treating mouse hepatitis virus infection or diseases caused by it. Summary of the Invention

[0003] The first aspect of the present invention is to provide a mouse hepatitis virus antibody or an antigen-binding fragment thereof.

[0004] A second aspect of the present invention is to provide biomaterials.

[0005] The third aspect of this invention aims to provide a method for preparing the antibody or antigen-binding fragment thereof according to the first aspect of this invention.

[0006] A fourth aspect of the present invention is to provide a coupling agent.

[0007] The fifth aspect of this invention aims to provide a pharmaceutical composition.

[0008] The sixth aspect of this invention aims to provide a diagnostic or therapeutic reagent kit.

[0009] The seventh aspect of this invention aims to provide the use of the antibody or antigen-binding fragment thereof of the first aspect of this invention, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect.

[0010] The object of the eighth aspect of the present invention is to provide a method for preventing and / or treating mouse hepatitis virus infection or diseases caused therefrom.

[0011] The object of the ninth aspect of this invention is to provide a method.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] A first aspect of the present invention provides a mouse hepatitis virus antibody or an antigen-binding fragment thereof, said mouse hepatitis virus antibody or antigen-binding fragment comprising:

[0014] a1) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) with the amino acid sequence shown in SEQ ID NO: 1; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) with the amino acid sequence shown in SEQ ID NO: 2 (antibody NSP3-2E2); or

[0015] a2) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 23; and / or, having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 24; (antibody NSP3-2G3) or

[0016] a3) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 43; and / or, having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 44; (antibody NSP3-2D5) or

[0017] a4) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 65; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 66; (antibody NSP3-2B7) or

[0018] a5) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 75; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 76; (antibody NSP3-2B2) or

[0019] a6) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 94; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 95; (antibody NSP3-2H8) or

[0020] a7) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 116; and / or, having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 117; (antibody NSP3-2H4) or

[0021] a8) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 133; and / or, having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 134; (antibody NSP3-2A7) or

[0022] a9) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 143; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 144; (antibody NSP3-2D2) or

[0023] a10) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 157; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 158; (antibody NSP3-2H2) or

[0024] a11) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 175; and / or having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 176; (antibody NSP3-3H11) or

[0025] a12) having CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) having the amino acid sequence shown in SEQ ID NO: 182; and / or, having CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) having the amino acid sequence shown in SEQ ID NO: 183; (antibody NSP3-4C12) or

[0026] a13) having one or more amino acid substitutions, deletions, or additions compared to CDR-H1, CDR-H2, and CDR-H3 as shown in any one of a1) to a12); and / or having one or more amino acid substitutions, deletions, or additions compared to CDR-L1, CDR-L2, and CDR-L3 as shown in any one of a1) to a12).

[0027] In some implementations, the CDR is defined according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system.

[0028] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment comprises:

[0029] b1) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:3, CDR-H2 having the amino acid sequence shown in SEQ ID NO:4, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:5; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:6, CDR-L2 having the amino acid sequence KVS, and CDR-L3 (antibody NSP3-2E2) having the amino acid sequence shown in SEQ ID NO:7; or

[0030] b2) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:25, CDR-H2 having the amino acid sequence shown in SEQ ID NO:26, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:27; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:28, CDR-L2 having the amino acid sequence KVS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:29; (antibody NSP3-2G3) or

[0031] b3) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:45, CDR-H2 having the amino acid sequence shown in SEQ ID NO:46, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:47; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D5) or

[0032] b4) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:67, CDR-H2 having the amino acid sequence shown in SEQ ID NO:46, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:68; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2B7) or

[0033] b5) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:77, CDR-H2 having the amino acid sequence shown in SEQ ID NO:78, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:79; and / or a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-2B2) or

[0034] b6) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:96, CDR-H2 having the amino acid sequence shown in SEQ ID NO:97, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:98; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:99, CDR-L2 having the amino acid sequence WAS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:100; (antibody NSP3-2H8) or

[0035] b7) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:118, CDR-H2 having the amino acid sequence shown in SEQ ID NO:119, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:120; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:28, CDR-L2 having the amino acid sequence KVS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:121; (antibody NSP3-2H4) or

[0036] b8) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:118, CDR-H2 having the amino acid sequence shown in SEQ ID NO:135, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:136; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2A7) or

[0037] b9) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:145, CDR-H2 having the amino acid sequence shown in SEQ ID NO:146, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:147; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D2) or

[0038] b10) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:77, CDR-H2 having the amino acid sequence shown in SEQ ID NO:159, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:160; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:161, CDR-L2 having the amino acid sequence GTS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:162; (antibody NSP3-2H2) or

[0039] b11) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:77, CDR-H2 having the amino acid sequence shown in SEQ ID NO:159, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:177; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:161, CDR-L2 having the amino acid sequence GTS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:162; (antibody NSP3-3H11) or

[0040] b12) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:118, CDR-H2 having the amino acid sequence shown in SEQ ID NO:119, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:184; and / or VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:48, CDR-L2 having the amino acid sequence RMS, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-4C12) or

[0041] b13) VH including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-H1, CDR-H2 and CDR-H3 as shown in any of b1) to b12); and / or VL including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-L1, CDR-L2 and CDR-L3 as shown in any of b1) to b12);

[0042] The CDR is defined according to the IMGT numbering system.

[0043] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment comprises:

[0044] c1) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:8, CDR-H2 having the amino acid sequence shown in SEQ ID NO:9, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:10; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:11, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:7 (antibody NSP3-2E2); or

[0045] c2) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:30, CDR-H2 having the amino acid sequence shown in SEQ ID NO:31, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:32; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:33, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:29; (antibody NSP3-2G3) or

[0046] c3) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:50, CDR-H2 having the amino acid sequence shown in SEQ ID NO:51, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:52; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D5) or

[0047] c4) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:69, CDR-H2 having the amino acid sequence shown in SEQ ID NO:51, and CDR-H3 having the amino acid sequence FDY; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2B7) or

[0048] c5) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:81, CDR-H2 having the amino acid sequence shown in SEQ ID NO:82, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:83; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:84, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-2B2) or

[0049] c6) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:101, CDR-H2 having the amino acid sequence shown in SEQ ID NO:102, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:103; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:104, CDR-L2 having the amino acid sequence shown in SEQ ID NO:105, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:100; (antibody NSP3-2H8) or

[0050] c7) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:122, CDR-H2 having the amino acid sequence shown in SEQ ID NO:123, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:124; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:33, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:121; (antibody NSP3-2H4) or

[0051] c8) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:122, CDR-H2 having the amino acid sequence shown in SEQ ID NO:137, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:138; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2A7) or

[0052] c9) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:50, CDR-H2 having the amino acid sequence shown in SEQ ID NO:148, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:149; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D2) or

[0053] c10) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO: 81, CDR-H2 having the amino acid sequence shown in SEQ ID NO: 163, and CDR-H3 having the amino acid sequence shown in SEQ ID NO: 164; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO: 165, CDR-L2 having the amino acid sequence shown in SEQ ID NO: 166, and CDR-L3 having the amino acid sequence shown in SEQ ID NO: 162; (antibody NSP3-2H2) or

[0054] c11) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO: 81, CDR-H2 having the amino acid sequence shown in SEQ ID NO: 163, and CDR-H3 having the amino acid sequence shown in SEQ ID NO: 178; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO: 165, CDR-L2 having the amino acid sequence shown in SEQ ID NO: 166, and CDR-L3 having the amino acid sequence shown in SEQ ID NO: 162; (antibody NSP3-3H11) or

[0055] c12) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:122, CDR-H2 having the amino acid sequence shown in SEQ ID NO:123, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:124; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-4C12) or

[0056] c13) VH including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-H1, CDR-H2 and CDR-H3 as shown in any of c1) to c12); and / or VL including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-L1, CDR-L2 and CDR-L3 as shown in any of c1) to c12);

[0057] The CDR is defined according to the Kabat numbering system.

[0058] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment comprises:

[0059] d1) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:13, CDR-H2 having the amino acid sequence shown in SEQ ID NO:14, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:10; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:11, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:7 (antibody NSP3-2E2); or

[0060] d2) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:34, CDR-H2 having the amino acid sequence shown in SEQ ID NO:35, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:32; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:33, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:29; (antibody NSP3-2G3) or

[0061] d3) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:55, CDR-H2 having the amino acid sequence shown in SEQ ID NO:56, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:52; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D5) or

[0062] d4) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:70, CDR-H2 having the amino acid sequence shown in SEQ ID NO:56, and CDR-H3 having the amino acid sequence FDY; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2B7) or

[0063] d5) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:85, CDR-H2 having the amino acid sequence shown in SEQ ID NO:86, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:83; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:84, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-2B2) or

[0064] d6) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:106, CDR-H2 having the amino acid sequence shown in SEQ ID NO:107, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:103; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:104, CDR-L2 having the amino acid sequence shown in SEQ ID NO:105, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:100; (antibody NSP3-2H8) or

[0065] d7) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:125, CDR-H2 having the amino acid sequence shown in SEQ ID NO:126, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:124; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:33, CDR-L2 having the amino acid sequence shown in SEQ ID NO:12, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:121; (antibody NSP3-2H4) or

[0066] d8) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:125, CDR-H2 having the amino acid sequence shown in SEQ ID NO:126, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:138; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2A7) or

[0067] d9) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:150, CDR-H2 having the amino acid sequence shown in SEQ ID NO:151, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:149; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:49; (antibody NSP3-2D2) or

[0068] d10) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:85, CDR-H2 having the amino acid sequence shown in SEQ ID NO:167, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:164; and / or VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:165, CDR-L2 having the amino acid sequence shown in SEQ ID NO:166, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:162; (antibody NSP3-2H2) or

[0069] d11) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:85, CDR-H2 having the amino acid sequence shown in SEQ ID NO:167, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:178; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:165, CDR-L2 having the amino acid sequence shown in SEQ ID NO:166, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:162; (antibody NSP3-3H11) or

[0070] d12) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:125, CDR-H2 having the amino acid sequence shown in SEQ ID NO:126, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:124; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:53, CDR-L2 having the amino acid sequence shown in SEQ ID NO:54, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:80; (antibody NSP3-4C12) or

[0071] d13) VH including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-H1, CDR-H2 and CDR-H3 as shown in any of d1) to d12); and / or VL including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-L1, CDR-L2 and CDR-L3 as shown in any of d1) to d12);

[0072] The CDR is defined according to the Chothia numbering system.

[0073] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment comprises:

[0074] e1) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:15, CDR-H2 having the amino acid sequence shown in SEQ ID NO:16, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:17; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:18, CDR-L2 having the amino acid sequence shown in SEQ ID NO:19, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:20 (antibody NSP3-2E2); or

[0075] e2) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:36, CDR-H2 having the amino acid sequence shown in SEQ ID NO:37, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:38; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:39, CDR-L2 having the amino acid sequence shown in SEQ ID NO:19, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:40; (antibody NSP3-2G3) or

[0076] e3) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:57, CDR-H2 having the amino acid sequence shown in SEQ ID NO:58, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:59; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:60, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:62; (antibody NSP3-2D5) or

[0077] e4) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:71, CDR-H2 having the amino acid sequence shown in SEQ ID NO:58, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:72; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:60, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:62; (antibody NSP3-2B7) or

[0078] e5) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:87, CDR-H2 having the amino acid sequence shown in SEQ ID NO:88, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:89; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:90, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:91; (antibody NSP3-2B2) or

[0079] e6) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:108, CDR-H2 having the amino acid sequence shown in SEQ ID NO:109, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:110; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:111, CDR-L2 having the amino acid sequence shown in SEQ ID NO:112, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:113; (antibody NSP3-2H8) or

[0080] e7) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:127, CDR-H2 having the amino acid sequence shown in SEQ ID NO:128, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:129; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:39, CDR-L2 having the amino acid sequence shown in SEQ ID NO:19, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:130; (antibody NSP3-2H4) or

[0081] e8) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:127, CDR-H2 having the amino acid sequence shown in SEQ ID NO:139, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:140; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:60, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:62; (antibody NSP3-2A7) or

[0082] e9) A VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:152, CDR-H2 having the amino acid sequence shown in SEQ ID NO:153, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:154; and / or, a VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:60, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:62; (antibody NSP3-2D2) or

[0083] e10) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:87, CDR-H2 having the amino acid sequence shown in SEQ ID NO:168, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:169; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:170, CDR-L2 having the amino acid sequence shown in SEQ ID NO:171, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:172; (antibody NSP3-2H2) or

[0084] e11) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO: 87, CDR-H2 having the amino acid sequence shown in SEQ ID NO: 168, and CDR-H3 having the amino acid sequence shown in SEQ ID NO: 179; and / or, VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO: 170, CDR-L2 having the amino acid sequence shown in SEQ ID NO: 171, and CDR-L3 having the amino acid sequence shown in SEQ ID NO: 172; (antibody NSP3-3H11) or

[0085] e12) VH comprising the following three CDRs: CDR-H1 having the amino acid sequence shown in SEQ ID NO:127, CDR-H2 having the amino acid sequence shown in SEQ ID NO:128, and CDR-H3 having the amino acid sequence shown in SEQ ID NO:185; and / or VL comprising the following three CDRs: CDR-L1 having the amino acid sequence shown in SEQ ID NO:60, CDR-L2 having the amino acid sequence shown in SEQ ID NO:61, and CDR-L3 having the amino acid sequence shown in SEQ ID NO:91; (antibody NSP3-4C12) or

[0086] e13) VH including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-H1, CDR-H2 and CDR-H3 as shown in any of e1) to e12); and / or VL including the following three CDRs: having one or more amino acid substitutions, deletions or additions compared to CDR-L1, CDR-L2 and CDR-L3 as shown in any of e1) to e12);

[0087] The CDR is defined according to the Contact numbering system.

[0088] Those skilled in the art should understand that the above-mentioned amino acid substitutions are conservative substitutions.

[0089] In some embodiments, the heavy chain variable region of the mouse hepatitis virus antibody or its antigen-binding fragment further includes the framework region of the heavy chain variable region.

[0090] In some embodiments, the framework region of the heavy chain variable region includes the framework region of the heavy chain variable region of immunoglobulins derived from mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese, or a mutant thereof; further, it includes the framework region of the heavy chain variable region of mouse immunoglobulins, or a mutant thereof.

[0091] In some embodiments, the light chain variable region of the mouse hepatitis virus antibody or its antigen-binding fragment further includes a framework region of the light chain variable region.

[0092] In some embodiments, the framework region of the light chain variable region includes the framework region of the light chain variable region of immunoglobulins derived from mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese, or a mutant thereof; further, it includes the framework region of the light chain variable region of mouse immunoglobulins, or a mutant thereof.

[0093] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment comprises:

[0094] g1) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:1, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:2, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2E2) or

[0095] g2) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:23, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:24, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2G3) or

[0096] g3) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:43, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:44, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2D5) or

[0097] g4) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:65, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:66, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2B7) or

[0098] g5) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:75, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:76, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2B2) or

[0099] g6) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:94, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:95, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2H8) or

[0100] g7) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:116, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:117, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2H4) or

[0101] g8) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:133, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:134, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2A7) or

[0102] g9) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:143, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:144, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2D2) or

[0103] g10) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:157, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:158, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-2H2) or

[0104] g11) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:175, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:176, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-3H11) or

[0105] g12) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO:182, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO:183, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; (antibody NSP3-4C12).

[0106] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment further includes a heavy chain constant region and / or a light chain constant region.

[0107] In some embodiments, the heavy chain constant region includes at least a portion of the heavy chain constant region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese; and further includes at least a portion of the heavy chain constant region or a mutant thereof derived from human immunoglobulins.

[0108] In some embodiments, the light chain constant region includes at least a portion of the light chain constant region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese; and further includes the light chain constant region or a mutant thereof derived from human immunoglobulins.

[0109] In some embodiments, the heavy chain constant region includes a heavy chain constant region derived from IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM immunoglobulin; further, it includes a heavy chain constant region derived from IgG1 immunoglobulin.

[0110] In some embodiments, the light chain constant region includes light chain constant regions derived from κ and λ immunoglobulins; further, it includes light chain constant regions derived from κ immunoglobulins.

[0111] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment is a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody; more specifically, it is a chimeric antibody.

[0112] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment may include, but is not limited to, monoclonal antibodies, bispecific antibodies, multispecific antibodies, nanobodies, Fab fragments, Fab' fragments, Fab'-SH fragments, F(ab')2 fragments, Fv fragments, single-chain Fv (scFv), dsFv, or Fd fragments.

[0113] In some embodiments, the mouse hepatitis virus antibody or its antigen-binding fragment specifically binds to the NSP3 protein (preferably the NSP3 protein of mouse hepatitis virus).

[0114] A second aspect of the invention provides a biological material comprising any one of n1)-n9):

[0115] n1) A nucleic acid molecule encoding an antibody or an antigen-binding fragment thereof of the first aspect of the present invention;

[0116] n2) contains an expression cassette containing the nucleic acid molecule described in n1);

[0117] n3) A carrier containing the nucleic acid molecule described in n1);

[0118] n4) A carrier containing the expression box described in n2);

[0119] n5) A cell containing the nucleic acid molecules described in n1);

[0120] n6) Cells containing the expression cassette described in n2);

[0121] n7) Cells containing the carrier described in n3);

[0122] n8) contains cells containing the carrier described in n4);

[0123] n9) Cells containing the antibody or antigen-binding fragment thereof of the first aspect of the present invention;

[0124] None of the cells described in n5)-n9) contain reproductive material.

[0125] Those skilled in the art will understand that nucleotides in nucleic acid molecules can be substituted based on codon degeneracy. In some embodiments, the nucleotide sequence of the nucleic acid molecule is codon-optimized.

[0126] In some embodiments, the nucleic acid molecule encoding the antibody or antigen-binding fragment thereof of the first aspect of the present invention comprises a nucleic acid molecule encoding the heavy chain variable region of the antibody or antigen-binding fragment thereof of the first aspect of the present invention and a nucleic acid molecule encoding the light chain variable region of the antibody or antigen-binding fragment thereof of the first aspect of the present invention.

[0127] In some embodiments, the nucleic acid molecule encoding the heavy chain variable region of the antibody or its antigen-binding fragment of the first aspect of the invention comprises: SEQ ID NO: 21, SEQ ID NO: 41, SEQ ID NO: 63, SEQ ID NO: 73, SEQ ID NO: 92, SEQ ID NO: 114, SEQ ID NO: 131, SEQ ID NO: 141, SEQ ID NO: 155, SEQ ID NO: 173, SEQ ID NO: 180, SEQ ID NO: 186, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0128] In some embodiments, the nucleic acid molecule encoding the light chain variable region of the antibody or its antigen-binding fragment of the first aspect of the invention comprises: SEQ ID NO: 22, SEQ ID NO: 42, SEQ ID NO: 64, SEQ ID NO: 74, SEQ ID NO: 93, SEQ ID NO: 115, SEQ ID NO: 132, SEQ ID NO: 142, SEQ ID NO: 156, SEQ ID NO: 174, SEQ ID NO: 181, SEQ ID NO: 187, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0129] In some embodiments, any of the vectors n3)-n4) can be expression vectors. In some embodiments, the expression vector may include eukaryotic expression vectors and / or prokaryotic expression vectors. In some embodiments, the eukaryotic expression vector includes, for example, but not limited to, yeast expression vectors, mammalian expression vectors, and insect expression vectors. For example, the expression vector may include, but is not limited to, plasmids, retroviral vectors, lentiviral vectors, bacteriophage vectors, adenovirus vectors, adeno-associated vectors, or herpes simplex vectors.

[0130] In some embodiments, the carrier may be selected from nanoparticles, liposomes, exogenous bodies, microbubbles, or gene guns.

[0131] In some embodiments, any of the cells (n5)-n9) can be host cells conventionally used in the art, as long as the expression vector can stably express the carried nucleic acid molecule as the antibody or its antigen-binding fragment described above. In some embodiments, the host cell can be a prokaryotic cell and / or a eukaryotic cell. The prokaryotic cell may include, for example, *Escherichia coli*, and the eukaryotic cell may include, for example, CHO cells, HEK293 cells, BHK cells, NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, HeLa cells, Vero cells, Expi293 cells, hybridoma cells, yeast cells, and insect cells.

[0132] In some embodiments, any of the cells (n5)-n9) can be immune cells. In some embodiments, the immune cells may include, but are not limited to, T cells, NK cells, DC cells, and macrophages.

[0133] A third aspect of the present invention provides a method for preparing an antibody or antigen-binding fragment thereof according to the first aspect of the present invention, obtained by culturing the cells of the second aspect of the present invention.

[0134] A fourth aspect of the invention provides a conjugate comprising an antibody or an antigen-binding fragment thereof from the first aspect of the invention; and a conjugation portion.

[0135] In some implementations, the coupling portion may include, but is not limited to, a detectable marker or a therapeutic agent.

[0136] In some embodiments, the detectable marker can be any substance detectable by means of fluorescence, spectroscopy, photochemistry, biochemistry, immunology, electricity, optics, chemistry, etc. Such markers are well known in the art, and examples include, but are not limited to, enzymes (e.g., horseradish peroxidase, alkaline phosphatase, β-galactosidase, urease, glucose oxidase, etc.), radionuclides (e.g., 3H, 125I, 35S, 14C, or 32P), fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), fluorescein, tetramethylrhodamine isothiocyanate (TRITC), phycoerythrin (PE), Texas red, rhodamine, quantum dots, or cyanine dye derivatives (e.g., Cy7, Alexa 750)), acridine esters, magnetic beads, calorimetric markers such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) microbeads, and biotin for binding avidin (e.g., streptavidin) modified with the above markers. In some embodiments, such markers are suitable for immunological assays (e.g., enzyme-linked immunosorbent assay, radioimmunoassay, fluorescence immunoassay, chemiluminescence immunoassay, etc.). In some embodiments, the detectable marker is selected from radioactive isotopes, fluorescent substances, luminescent substances, colored substances, or enzymes. In some embodiments, the detectable markers described above can be linked to the antibodies or antigen-binding fragments of the present invention using linkers of different lengths to reduce potential steric hindrance.

[0137] In some embodiments, the detectable marker may include, but is not limited to, enzymes (e.g., horseradish peroxidase), radionuclides, fluorescent dyes, luminescent substances (e.g., chemiluminescent substances), colored substances, biotin, etc.

[0138] In some embodiments, the therapeutic agent may include, for example, but not limited to, drugs for the prevention and / or treatment of mouse hepatitis virus infection or diseases caused by it.

[0139] In some embodiments, the coupling portion is selected from substances that can improve the biological properties of the antibody (e.g., increase serum half-life), such as chemical groups, such as polyethylene glycol (PEG), methyl, ethyl, or glycosyl groups.

[0140] A fifth aspect of the invention provides a pharmaceutical composition comprising: an antibody or antigen-binding fragment thereof from the first aspect of the invention, a biological material from the second aspect or a conjugate from the fourth aspect; and a pharmaceutically acceptable carrier.

[0141] In some embodiments, the pharmaceutical composition may also include additional pharmaceutically active agents.

[0142] In some embodiments, the additional pharmaceutically active agent may be a biologically active drug, such as a drug capable of preventing and / or treating mouse hepatitis virus infection or the disease it causes.

[0143] In some embodiments, the antibody or its antigen-binding fragment is provided as a separate component or as a mixed component with the additional pharmaceutically active agent.

[0144] In some embodiments, the pharmaceutical composition can be administered via, for example, parenteral, subcutaneous, sublingual, rectal, nasal, intravenous, intramuscular, oral, ocular, or topical routes.

[0145] In some embodiments, the pharmaceutical composition is in the form of, for example, an aqueous solution, suspension, powder, tablet, capsule, granule, powder, pill, disintegrant, syrup, spray, gel, emulsion, injection, elixir, lozenge, suppository, etc.

[0146] A sixth aspect of the present invention provides a diagnostic or therapeutic kit comprising: an antibody or antigen-binding fragment thereof of the first aspect of the present invention, a biological material of the second aspect, a conjugate of the fourth aspect, or a pharmaceutical composition of the fifth aspect.

[0147] In some embodiments, the kit may also include instructions and / or a drug delivery device.

[0148] In some embodiments, the kit can be used to diagnose mouse hepatitis virus infection or disease caused by it, detect the presence or level of mouse hepatitis virus or its NSP3 protein in a sample, screen drugs, conduct basic research on coronaviruses (e.g., revealing the biological characteristics of MHV and its interaction with the host immune response) and / or develop vaccines (as an important component of vaccine development to improve the immunogenicity of vaccines), and the drugs are used to prevent and / or treat mouse hepatitis virus infection or disease caused by it.

[0149] In some embodiments, the kit can be used to prevent and / or treat mouse hepatitis virus infection or diseases caused by it.

[0150] A seventh aspect of the invention provides the use of the antibody or antigen-binding fragment thereof of the first aspect, the biological material of the second aspect, the conjugate of the fourth aspect, or the pharmaceutical composition of the fifth aspect in any one of c1)-c8):

[0151] c1) Prepare products for diagnosing mouse hepatitis virus infection or diseases caused by it;

[0152] c2) Prepare products for the prevention and / or treatment of mouse hepatitis virus infection or diseases caused by it;

[0153] c3) Prepare products for detecting the presence or level of mouse hepatitis virus or its NSP3 protein in samples;

[0154] c4) Detect the presence or level of mouse hepatitis virus or its NSP3 protein;

[0155] c5) Prepare products for drug screening, wherein the drugs are used to prevent and / or treat mouse hepatitis virus infection or diseases caused by it;

[0156] c6) Drug screening, wherein the drug is used to prevent and / or treat mouse hepatitis virus infection or the disease caused therefrom;

[0157] c7) Basic research on coronaviruses (e.g., revealing the biological characteristics of MHV and its interaction with the host immune response) and / or vaccine development (as an important component of vaccine development to improve the immunogenicity of vaccines);

[0158] c8) Prepare products for basic research on coronaviruses (e.g., revealing the biological characteristics of MHV and its interaction with the host immune response) and / or vaccine development (as an important component of vaccine development to improve the immunogenicity of vaccines).

[0159] In some implementations, the applications described in c4), c6), and c7) do not involve the diagnosis or treatment of diseases.

[0160] In some embodiments, the sample is selected from at least one of the body fluids, tissues, cells, and excretions of the subject.

[0161] In some embodiments, the body fluid includes at least one of blood and lymph.

[0162] In some embodiments, the blood includes at least one of serum, plasma, dried blood spots, and whole blood.

[0163] In some embodiments, the excrement includes at least one of urine, feces, and tears.

[0164] In some implementations, the test subject includes mammals, such as rodents (e.g., rats, mice, guinea pigs).

[0165] In some implementations, the test subject includes mice.

[0166] In some embodiments, the product is a pharmaceutical product, a reagent, or a reagent kit.

[0167] In some embodiments, the coronavirus includes viruses of the Orthocoronavirus subfamily.

[0168] In some embodiments, the viruses of the Orthocoronavirus subfamily include viruses of the genus α-coronavirus, β-coronavirus, γ-coronavirus, and / or δ-coronavirus.

[0169] In some embodiments, the coronavirus includes one or more of the following: coronaviruses that cause upper respiratory tract infections, coronaviruses that cause lower respiratory tract infections, coronaviruses that cause gastrointestinal infections, and coronaviruses that cause acute respiratory syndrome; more specifically, coronaviruses that cause upper respiratory tract infections.

[0170] In some embodiments, the coronaviruses that cause upper respiratory tract infections include human coronaviruses (e.g., HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1) and / or mouse hepatitis viruses (e.g., MHV1, MHV2 [MHV(Pr)], MHV3, MHV4 (JHM), MHV-A59, MHVS, MHVZ, and MHVU).

[0171] In some embodiments, the coronaviruses that cause lower respiratory tract infections include avian infectious bronchitis virus.

[0172] In some embodiments, the coronavirus that causes gastrointestinal infection includes at least one of porcine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, porcine type D coronavirus, and feline infectious peritonitis virus.

[0173] In some embodiments, the coronavirus that causes acute respiratory syndrome includes at least one of SARS-related coronaviruses and Middle East Respiratory Syndrome coronaviruses.

[0174] In some implementations, the SARS-related coronavirus includes at least one of SARS-CoV-1 and SARS-CoV-2.

[0175] In this invention, the diseases caused by mouse hepatitis virus infection include hepatitis, encephalitis, and enteritis.

[0176] An eighth aspect of the invention provides a method for preventing and / or treating mouse hepatitis virus infection or diseases caused therefrom, the method comprising administering to a subject in need an effective amount of an antibody or antigen-binding fragment of the first aspect of the invention, a biological material of the second aspect, a conjugate of the fourth aspect, or a pharmaceutical composition of the fifth aspect.

[0177] A ninth aspect of the present invention provides a method comprising contacting a sample with an antibody or antigen-binding fragment of the first aspect of the present invention, wherein the formation of the complex is detected, under conditions that allow the antibody or antigen-binding fragment thereof of the first aspect of the present invention to form a complex with NSP3.

[0178] The method is used for any one of f1)-f3):

[0179] f1) Diagnosing mouse hepatitis virus infection or the disease it causes;

[0180] f2) Detect the presence or level of mouse hepatitis virus or its NSP3 protein in the sample;

[0181] f3) Screening for drugs used to prevent and / or treat mouse hepatitis virus infection or diseases caused by it.

[0182] In some embodiments, the sample is the sample of the seventh aspect of the present invention.

[0183] The beneficial effects of this invention are:

[0184] This invention provides a mouse hepatitis virus antibody or its antigen-binding fragment, which can specifically recognize and bind to mouse hepatitis virus or its NSP3 protein and has good affinity for it. It can be used to prepare products for the diagnosis, prevention and / or treatment of mouse hepatitis virus infection or diseases caused by it, detection of the presence or level of mouse hepatitis virus or its NSP3 protein in samples, screening for drugs for the prevention and / or treatment of mouse hepatitis virus infection or diseases caused by it, basic research and / or vaccine development. Attached Figure Description

[0185] Figure 1 The diagram shows the roadmap for constructing Fab library fragments.

[0186] Figure 2 Electrophoresis diagram of the amplified products of the V region gene of the antibody heavy chain / Fab region gene of the light chain is shown.

[0187] Figure 3 The electrophoresis diagram of the MaxLinkD fragment amplification product is shown.

[0188] Figure 4The image shows the electrophoresis diagram of the first Fab overlap extension PCR fragment.

[0189] Figure 5 The image shows the electrophoresis diagram of the second Fab overlap extension PCR fragment.

[0190] Figure 6 The pFabHis-Display plasmid map is shown.

[0191] Figure 7 The electrophoresis diagram of the linear vector prepared by double digestion of pFabHis-Display plasmid is shown.

[0192] Figure 8 The image shows a colony PCR electrophoresis pattern.

[0193] Figure 9 The diagrams of the IgG1 and IgK vectors are shown.

[0194] Figure 10 The purified antibody was shown as an SDS-PAGE electrophoresis image.

[0195] Figure 11 The antibody affinity test results are shown.

[0196] Figure 12 The results of immunofluorescence detection are shown.

[0197] Figure 13 A flowchart illustrating the screening and efficacy verification of mouse hepatitis virus NSP3 antibodies is shown. Detailed Implementation

[0198] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0199] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0200] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0201] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0202] As used in this article, "antibody" refers to a globulin produced by the immune system in response to antigen stimulation, resulting from the proliferation and differentiation of B lymphocytes into plasma cells. Antibodies specifically bind to corresponding antigens and mediate immune effects. They are primarily found in serum and body fluids and are important immune molecules mediating humoral immunity. The term "antibody" can encompass various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific, trispecific, or tetraspecific antibodies), single-chain molecules, and antigen-binding fragments. The chemical basis of antibodies is immunoglobulin (Ig).

[0203] As used herein, the term "monoclonal antibody" refers to antibodies derived from a substantially homogeneous group of antibodies, meaning that, apart from possible trace amounts of variant antibodies (e.g., containing naturally occurring mutations or generated during the production of the monoclonal antibody formulation, typically present in small quantities), the individual antibodies within the group are identical and / or bind to the same epitopes. Unlike polyclonal antibody formulations, which typically comprise different antibodies targeting different antigenic determinants (epitaxes), each monoclonal antibody in a monoclonal antibody formulation targets a single determinant on the antigen.

[0204] As used herein, the term "multispecific antibody" is used in its broadest sense to encompass antibodies exhibiting multi-epitope specificity. These multispecific antibodies include, but are not limited to: antibodies comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH-VL unit exhibits multi-epitope specificity; antibodies having two or more VL and VH regions, each VH-VL unit binding to a different target or a different epitope of the same target; antibodies having two or more single variable regions, each single variable region binding to a different target or a different epitope of the same target; full-length antibodies, antibody fragments, bispecific antibodies, and trispecific antibodies, antibody fragments covalently or non-covalently linked, etc.

[0205] The terms “full-length antibody” and “intact antibody” used herein are used interchangeably to refer to antibodies that are structurally similar to natural antibodies. “Natural antibody” refers to a naturally occurring immunoglobulin molecule. For example, natural IgG antibodies are heterotetrameric glycoproteins of approximately 150,000 Daltons, composed of two light chains and two heavy chains linked by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a variable region (VH) (also called a variable heavy chain domain or heavy chain variable domain) and three constant domains (CH1, CH2, and CH3) (also called heavy chain constant regions, CH). From the N-terminus to the C-terminus, each light chain has a variable region (VL) (also called a variable light chain domain or light chain variable domain) and a light chain constant domain (CL) (also called light chain constant region). The heavy chain of an antibody can be one of five types: α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), and can be further subdivided into subtypes such as γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chain of an antibody, based on the amino acid sequence of its constant domain, can be one of two types: the κ (kappa) light chain and the λ (lambda) light chain.

[0206] Within the light and heavy chains, variable and constant regions are linked by a "J" region containing approximately 12 or more amino acid residues, and the heavy chain also contains a "D" region containing approximately 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain, CL. The constant region of an antibody mediates the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0207] The term "Fd fragment" as used herein refers to an antibody fragment consisting of VH and CH1 domains. The term "dAb fragment" as used herein refers to an antibody fragment consisting of a VH domain (Ward et al., Nature 341:544546 (1989)). The term "Fab fragment" as used herein refers to an antibody fragment consisting of VL, VH, CL, and CH1 domains. The term "F(ab')2 fragment" as used herein refers to an antibody fragment containing two Fab fragments linked by disulfide bridges on the hinge region. The term "Fab' fragment" as used herein refers to the fragment obtained by reducing the disulfide bonds connecting the two heavy chain fragments in the F(ab')2 fragment, consisting of a complete light and heavy chain Fd fragment (composed of VH and CH1 domains). The term "Fab'-SH" as used herein refers to a Fab fragment containing free thiol groups.

[0208] As used in this article, the term "Fv fragment" refers to an antibody fragment consisting of the VL and VH domains of a single arm of the antibody. The Fv fragment is generally considered to be the smallest antibody fragment capable of forming a complete antigen-binding site. It is generally believed that six CDRs confer antigen-binding specificity to the antibody. However, even a variable region (such as the Fd fragment, which contains only three antigen-specific CDRs) can recognize and bind to the antigen, although its affinity may be lower than that of a complete binding site.

[0209] As used herein, the term "scFv" refers to a single polypeptide chain containing VL and VH domains linked by a linker. In some cases, a disulfide bond may also exist between the VH and VL domains of the scFv.

[0210] As used herein, the term "variable region" or "variable domain" refers to the domain of the antibody heavy or light chain involved in the binding of the antigen-binding molecule to the antigen. The variable regions (VH and VL) of the heavy and light chains of natural antibodies typically have similar structures, with each domain containing four conserved framework regions (FR1-4) and three hypervariable regions (HVR1-3), arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. A single VH or VL domain is sufficient to confer antigen-binding specificity. The three HVRs within the VH and VL together constitute the antigen-binding site of Ig, which can bind complementary to the corresponding antigenic epitope; therefore, the HVRs are also called complementarity-determining regions (CDRs), denoted as CDR1, CDR2, and CDR3, respectively. The VH or VL chain of an antibody may further contain all or part of the constant regions of the heavy or light chain.

[0211] The CDR of the antibody or antigen-binding fragment of the present invention can be determined according to various numbering systems known in the art. In some embodiments, the CDR contained in the antibody or antigen-binding fragment of the present invention is preferably determined by the IMGT, Kabat, Contact, Chothia, or AbM numbering system.

[0212] As used in this paper, the term "variable" refers to the fact that certain segments of the variable region are generally different in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed throughout the variable region, but is concentrated in three segments called hypervariable regions (HVRs) within the variable regions of the light and heavy chains. The relatively highly conserved portions of the variable region are called framework regions (FRs). The variable regions of the native heavy and light chains each contain four FRs, mostly in a β-sheet configuration, linked by three HVRs that form loops and, in some cases, form part of a β-sheet structure. The HVRs in each chain are tightly held together by the FRs and, together with the HVRs of other chains, contribute to the formation of the antibody's antigen-binding site. Constant regions do not directly participate in antibody-antigen binding but have other effector functions, such as participating in antibody-dependent cytotoxicity.

[0213] Antibody "classes" refer to the types of constant structural domains or constant regions possessed by the antibody's heavy chain. Based on differences in heavy chain structure and antigenicity, they can be classified into five classes: μ chain, γ chain, α chain, δ chain, and ε chain. Immunoglobulins composed of different heavy and light chains are respectively called IgA, IgD, IgE, IgG, and IgM. Even within the same class of Ig, the amino acid composition of the hinge region and the number and position of disulfide bonds in the heavy chain differ, thus allowing for further subclassing of the same class of Ig. For example, human IgG can be divided into IgG1–IgG4; IgA can be divided into IgA1 and IgA2. Based on differences in light chain structure and antigenicity, immunoglobulin (Ig) light chains are divided into κ (kappa) chains and λ (lambda) chains, thus classifying Ig into two types: κ type and λ type.

[0214] The "sequence identity percentage" or "identity percentage" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by sequences within a comparison window, taking into account additions or deletions (i.e., vacancies) that must be introduced for optimal alignment of the two sequences. A matching position is any location where the same nucleotide or amino acid is present in both the target and reference sequences. Vacancies are not nucleotides or amino acids and are not counted in the target sequence. Similarly, vacancies in the reference sequence are not counted because nucleotides or amino acids from the target sequence are included, but those from the reference sequence are excluded.

[0215] The percentage of sequence identity can be calculated as follows: determine the number of positions in both sequences where the same amino acid residue or nucleic acid base appears (the number of matching positions), divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Sequence comparison and determination of the percentage of sequence identity between two sequences can be accomplished using software that is readily available online and downloadable. Suitable software programs are available from various sources for protein and nucleotide sequence alignment. A suitable program for determining the percentage of sequence identity is bl2seq, which is part of the BLAST program suite available from the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparing two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available from the European Institute of Bioinformatics (EBI) at www.ebi.ac.uk / Tools / psa.

[0216] As used herein, the term "conservative substitution" refers to an amino acid substitution that does not adversely affect or alter the intended properties of a protein / peptide containing an amino acid sequence. For example, conservative substitutions can be introduced using standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitutions of amino acid residues with amino acid residues having similar side chains, such as substitutions with residues that are physically or functionally similar to the corresponding amino acid residues (e.g., having similar size, shape, charge, chemical properties, including the ability to form covalent or hydrogen bonds). Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, and tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, and methionine), β-branched side chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). Therefore, it is preferable to replace the corresponding amino acid residue with another amino acid residue from the same side chain family. Methods for identifying conserved amino acid substitutions are well known in the art (see, for example, Brummell et al., Biochem. 32:1180-1187 (1993); Kobayashi et al., Protein Eng. 12(10):879-884 (1999); and Burks et al., Proc. Natl Acad. Set USA 94:412-417 (1997), which are incorporated herein by reference).

[0217] The following embodiments and accompanying drawings are provided to aid in understanding the present invention. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the invention. The reagents and / or kits used in the following embodiments are commercially available or can be synthesized by known methods.

[0218] It should be noted that, unless specific conditions are specified in the examples, experimental conditions should be performed according to standard conditions, manufacturer recommendations, or publicly reported experimental conditions. Reagents or instruments whose manufacturers are not specified are all commercially available, standard products. For reagents whose manufacturers are specified, similar products from other manufacturers are substitutes.

[0219] Unless otherwise specified, the quantitative experiments in the following examples were all repeated three times, and the results were averaged.

[0220] Example: Screening and efficacy verification of mouse hepatitis virus NSP3 antibodies.

[0221] The flowchart for screening and efficacy validation of mouse hepatitis virus NSP3 antibodies is as follows: Figure 13 As shown, the details are as follows:

[0222] (1) Preparation of NSP3 antigen

[0223] 1.1 Plasmid construction and transformation: The protein encoding NSP3 (amino acid sequence of amino acid position 833-1316 of accession number NP_045299.2, with 6 His tags at the C-terminus) was inserted into the pET28a vector. 1 μL (0.5 μg / μL) of the successfully constructed plasmid was added to 100 μL of BL21(DE3) (ThermoFisher EC0114) competent cells. After incubation on ice for 30 min, the cells were heat-shocked at 42℃ for 90 s. 500 μL of antibiotic-free LB medium was added, and the cells were incubated on a shaker at 37℃ for 1 h. The plating was then plated, dried, and incubated upside down in a 37℃ oven.

[0224] 1.2 Expanded culture: Pick single colonies from the plate and transfer them to 3 mL of LB-A medium (the volume ratio of ampicillin to LB medium is 1:1000). Incubate overnight at 37°C. The next day, transfer 3 mL of the bacterial culture to 1 L of LB-A medium and continue to incubate at 37°C.

[0225] 1.3 Induction of expression: After the OD value of the bacterial culture reaches 0.6-0.8, add IPTG at a ratio of 1:1000 (final concentration of 1 mM IPTG) and induce overnight at 16°C.

[0226] 1.4 Protein purification: The bacterial culture was centrifuged at 8000 rpm for 10 min, the precipitate was collected and pretreated, then bound to Ni-beads, and impurities were washed away with a low concentration of imidazole gradient. The target protein was then eluted with 250 mM imidazole. The collected NSP3 protein was concentrated using an ultrafiltration tube and replaced with PBS. Finally, the sample was identified by SDS-PAGE.

[0227] 1.5 Antigen preservation: The purified NSP3 protein was aliquoted to a concentration of approximately 1 mg / mL and stored at -80°C to ensure the stability and activity of the protein.

[0228] (2) Immunization of BALB / C mice

[0229] 2.1 Mouse preparation: Prepare 6 male 7-8 week old BALB / C mice.

[0230] 2.2 Antigen Preparation and Immunization: MHV-A59 (ATCC, VR-764) was prepared and immunized. TM17cl-1 cell lines were infected with mouse hepatitis β coronavirus. After 48 hours, the supernatant was collected by centrifugation and the virus was concentrated to a density of approximately 10^6. 6 Titration. Six male mice were selected, and 5 x 10^6 drops were administered via nasal drops. 4 Mice were immunized with MHV virus particles, with immunizations performed every 7 days for a total of 4 immunizations.

[0231] 2.3 Observation and Recording: Throughout the immunization process, the appearance of mice was monitored and mortality was recorded to assess the impact of MHV virus particle immunization on mouse health.

[0232] 2.4 Blood sample collection: Blood samples were collected from the orbital cavity of mice on days 24 and 31 after immunization. After centrifugation at 4000 rpm for 10 minutes at 4°C, the supernatant was collected and stored at -80°C for subsequent serological titer determination (see “(3) Mouse serological titer determination” for the method).

[0233] 2.5 Spleen collection: When the mouse serum antibody titer reached 10... 5 -10 6 Subsequently, the animals were euthanized using cervical dislocation, and the spleen tissue was immediately and aseptically harvested and placed in pre-cooled sterile PBS solution. The spleen tissue was thoroughly minced using sterile scissors and a grinder, and then a single-cell suspension was prepared by passing it through a cell filter. Lymphocytes were separated using Ficoll density gradient centrifugation, and immune cells from the white membrane layer were collected for subsequent RNA extraction and cDNA transcription.

[0234] (3) Serological titer identification in mice

[0235] 3.1 Antigen Coating: NSP3 antigen was coated onto the ELISA plate at a concentration of 100 ng / well, while the control group was coated with PBS. The coated ELISA plates were incubated overnight at 4°C to ensure sufficient antigen adsorption.

[0236] 3.2 Washing and Blocking: After coating with antigen, the wells of the ELISA plate were washed three times with 0.05% PBST to remove unadsorbed antigen. Then, 5% PBSM blocking buffer was added, and the plate was incubated at 37°C for 1 hour to reduce non-specific binding.

[0237] 3.3 Washing again: After sealing, wash the wells of the microplate three times with 0.05% PBST to prepare for the next experiment.

[0238] 3.4 Serum Dilution and Incubation: Serum from mice on days 24 and 31 after immunization (as described in "2.4 Blood Sample Collection") was diluted according to a concentration gradient (10⁻⁶ oz / mL). -2 10 -3 10 -4 10 -5 10-6 Dilute the sample by adding 100 μL to each well. Dilute the serum from the control group mice in the same proportion. Incubate the ELISA plate at 37°C for 1 hour to allow the antibodies to bind fully to the antigens.

[0239] 3.5 Washing and Secondary Antibody Incubation: After incubation, wash the wells of the ELISA plate five times with 0.05% PBST for 5 minutes each time. Then, add Goat anti-mouse HRP secondary antibody (Abcam, ab97625) diluted to 1:10000 and incubate at 37°C for 1 hour.

[0240] 3.6 Colorimetric Reaction: After incubation, wash the wells of the ELISA plate five times with 0.05% PBST for 5 minutes each time to ensure removal of unbound secondary antibody. After patting the plate dry, add 100 μL of TMB substrate solution (Beyotime, P0209) to initiate the colorimetric reaction. After the reaction has continued for approximately 15 minutes, add 50 μL of ELISA stop solution to stop the colorimetric process.

[0241] 3.7 OD value determination: The OD value of each well was measured at a wavelength of 450 nm using an ELISA reader to assess the antibody titer in mouse serum, and the data was analyzed and the results were compiled.

[0242] (4) RNA extraction

[0243] 4.1 Using a micro RNA extraction kit (omega BIO-TEK, Cat#R6831-01), at a rate of 1 x 10^6... 5 ~1x10 6 Add 350uL of cell lysis buffer to each cell and add the cell lysis buffer to the cell pellet collected in “2.5 Spleen Collection”.

[0244] 4.2 Lyse on ice for 30 min, gently mixing every 5 min to ensure complete cell lysis. Then, centrifuge at 12000 rpm for 5 min at 4°C. Carefully aspirate the supernatant and add an equal volume of 70% ethanol, mixing thoroughly by inverting the container.

[0245] 4.3 Add the processed supernatant to the RNA recovery column and let it stand at room temperature for 3-5 minutes to allow the RNA to be fully adsorbed onto the RNA column.

[0246] 4.4 Next, centrifuge at 12000 rpm for 1 min and discard the filtrate. Dissolve the RNA in DEPC water preheated to 37°C and centrifuge again to obtain 30-50 μL of RNA. Measure the concentration using a Nanodrop 2000; the concentration is approximately 1000 ng / μL. The RNA can be used for reverse transcription to generate cDNA or stored at -80°C for subsequent experiments.

[0247] (5) cDNA synthesis

[0248] SuperScript II reverse transcriptase kit (Invitrogen) TM (Cat#18064014) 4 μg of RNA was reverse transcribed into cDNA as follows: Prepare reaction component 1 according to reaction system 1 in Table 1, mix thoroughly, and incubate at 65°C for 5 min, then immediately place on ice for 2 min. Then prepare reaction component 2 according to reaction system 2 in Table 2, mix thoroughly, incubate at 25°C for 10 min, then incubate at 42°C for 50 min; finally, terminate the reaction at 70°C for 15 min. After the reaction, store at 4°C. The synthesized cDNA can be stored at -20°C for subsequent experiments.

[0249] Table 1 Reverse transcription reaction system 1

[0250] Oligo(dT) 1 dNTP Mix 1 RNA 8 Total 10

[0251] Table 2 Reverse transcription reaction system 2

[0252]

[0253]

[0254] (6) Construction of Fab phage display library

[0255] Fab library fragment construction roadmap as follows Figure 1 The details are shown in 6.1-6.3 below:

[0256] 6.1 Primer Design and PCR Amplification: Specific primers were designed, and nested PCR was performed in two rounds (PCR reaction system and reaction program are shown in Tables 3 and 4, respectively) to amplify the V region gene (VH, approximately 400 bp) of mouse IgG1 and IgG2A / IgG2B antibody heavy chains and the Fab region gene (Fab-K, approximately 660 bp) of the kappa light chain (electrophoresis images of the amplification products are shown in Tables 3 and 4, respectively). Figure 2 (As shown).

[0257] Table 3. PCR reaction system for antibody heavy and light chain Fab region gene amplification.

[0258] 2x PhantaMaxMasterMix (Vazyme) 25 cDNA template 5 PrimerF (10µM) 1.5 PrimerR (10µM) 1.5 DEPCWater 20 Total 50

[0259] Note: Primer F:

[0260] MVH-1: G CCG GCC ATG GCCGAG GTR MAG CTT CAG GAG TCA GGA C, SEQ ID NO: 188;

[0261] MVH-2: G CCG GCC ATG GCCGAG GTS CAG CTK CAG CAG TCA GGA C, SEQ ID NO: 189;

[0262] MVH-3: G CCG GCC ATG GCCCAG GTG CAG CTG AAG SAS TCA GG, SEQ ID NO: 190;

[0263] MVK-1: TTGGCTGCACAACCAGCAATGGCAGAC ATT GTT CTC ACC CAG TCT CC, SEQ IDNO: 191;

[0264] MVK-2: TTGGCTGCACAACCAGCAATGGCAGAC ATT GTG CTS ACC CAG TCT CC, SEQ IDNO: 192;

[0265] MVK-3: TTGGCTGCACAACCAGCAATGGCAGAC ATT GTG ATG ACT CAG TCT CC, SEQ IDNO: 193;

[0266] Primer R:

[0267] mJH: CAGGGGCCAGTGGATAGAC, SEQ ID NO: 194;

[0268] MCK1:AGTGGATCCACACTCATTCCTGTTGAAGCTCTTGAC, SEQ ID NO:195.

[0269] Table 4. PCR reaction procedure for antibody heavy light chain Fab region gene amplification.

[0270]

[0271] 6.2 Preparation of MaxLinkD Fragment (MaxLinkD): Primers were designed to prepare the MaxLinkD fragment (containing the mouse IgG1 CH1 sequence, approximately 400 bp) linking the heavy and light chains (PCR reaction system and reaction procedure are shown in Tables 5 and 6, respectively; an electrophoresis image of one MaxLinkD fragment amplification product is shown in the figure). Figure 3 (As shown).

[0272] Table 5 MaxLinkD fragment PCR reaction system

[0273] 2xTakaraPrimeSTARMix 25 MaxLinkD template (synthesized sequence, Guangzhou Ruibo) 1~5ng Link.Forw (10uM) 1.5 Link.Back (10uM) 1.5 DEPCWater x Total 50

[0274] Note: Link.Forw: TGCCATGCTGGTTGTGCAG, SEQ ID NO: 197;

[0275] Link.Back:GTCTATCCACTGGCCCCTG, SEQ ID NO: 198;

[0276] MaxLinkD template: GTCTATCCACTGGCCCCTGTGTGTGGAGGTACAACTGGCTCCTCGGTGACTCT AGGATGCCTGGTCAAGGGTTATTTCCCTGAGCCAGTGACCTTGACCTGGAACTCTGGATCCCTGTCCAGTGGTGTGCACACCTTCCCAGCTTCCTGCAGTCTGGCCTCTACACCCTCAGCAGCTCAGTGACTGTAACCTCGAACACCTGGCCCAGCCAGACCATCACCTGCAATGTGG CCCACCCGGCAAGCAGCACCAAAGTGGACAAGAAAATTGTGCCCAGGGATTGTTGAGTCGACAGCTTGAATTCTAAACTAGTCGAAGGCGCGCCAAGGAGACAGTCATAATGAAATACCTATTGCCTACGGCAGCCGCTGGATTATTATTGGCTGCACAACCAGCAATGGCA, SEQ ID NO: 196.

[0277] Table 6 MaxLinkD fragment PCR reaction procedure

[0278]

[0279] 6.3 Gel Recovery and Library Construction: The antibody gene fragment obtained in "6.1 Primer Design and PCR Amplification" and the MaxLinkD fragment obtained in "6.2 Preparation of MaxLinkD Fragment" were respectively digested and recovered from gels. VH, MaxLinkD, and Fab-K were ligated using overlap extension PCR. Through two-step PCR and gel recovery, a Fab library fragment (Full-Length, approximately 1500 bp) of the antibody was obtained, with a concentration of approximately 130 ng / μL. (The reaction system and procedure for the first overlap extension PCR are shown in Tables 7 and 8; one of the reaction products is shown in the electrophoresis image.) Figure 4As shown; the reaction system and procedure for the second overlap extension PCR are shown in Tables 9 and 10, and the electrophoresis diagram of one of the reaction products is shown in the figure. Figure 5 (As shown).

[0280] Table 7. First overlap extension PCR reaction system

[0281]

[0282]

[0283] Table 8. Procedure for the first overlap extension PCR reaction.

[0284]

[0285] Table 9. Second overlap extension PCR reaction system

[0286] 2xTakaraPrimeSTARMix 25 Tag.Back (10uM) 1.3 Tag.For(10uM) 1.3 First overlap extension PCR product 2 DEPCWater 20.4 Total 50

[0287] Note: Tag.Back:attactcgcGGCCCAGCCGGCCATGGCCsanG, SEQ ID NO: 199;

[0288] Tag.For: ACCGCCACCACTAGTGGATCCACACTCATTCCTGTTGAAGC, SEQ ID NO: 200.

[0289] Table 10. Procedure for the second overlap extension PCR reaction.

[0290]

[0291] 6.4 Enzyme digestion of phage vector: The phage vector pFabHis-Display was double-digested with NcoI and BamHI restriction endonucleases (P6787, Miaoling plasmid; pFabHis-Display plasmid map as shown). Figure 6 As shown, the electrophoresis diagram of the linear vector prepared by double enzyme digestion is as follows. Figure 7 (As shown). Subsequently, the electrophoretic gel was recovered to prepare a linear support (pFab-Display NcoI / BamHI-cut, 3829bp) with a concentration of approximately 100 ng / uL.

[0292] 6.5 Homologous Recombination Reaction: Using homologous recombination technology, the linear vector pFab-Display NcoI / BamHI-cut obtained from "6.4 Phage Vector Digestion" was mixed with the Fab library fragment Full-Length obtained from "6.3 Gel Recovery and Library Construction" at a molar ratio of 1:4, with a total DNA volume of 1.25 μg. Homologous recombination was performed using 2×SeamLess Mix (Biomed, Cat#CL117-01) at 50℃ for 30 min. Finally, the ligation product was recovered using a standard PCR product recovery kit (Tiangen, Cat#DP204), and the concentration was measured to be approximately 50 ng / μL.

[0293] (7) Phage display and screening

[0294] 7.1 Dilute the above homologous recombination ligation products with sterile water to 40 ng / uL, and electroporate 5 uL of ligation product per competent cell to a total of 4 TG1 competent cells.

[0295] 7.2 Before electroporation, prepare 10 mL of SOC medium (preheated to 37°C) and 8 150 mm agar plates. 2 2YT-GA plates (containing 2% glucose and 100ug / mL ampicillin) and 4 90mm agar plates. 2 2YT-GA plates were used. Simultaneously, 0.1 cm electroporation cups and ligation products were pre-cooled on ice, and four TG1 competent cells were thawed on ice.

[0296] 7.3 Transfer TG1 competent cells to an electroporation cuvette, add 5 μL of ligation product and electroporate. Electroporation parameters are set as follows: voltage 1.8 kV, pulse duration 10 μF, and impedance 600 Ω.

[0297] 7.4 After electroporation, TG1 competent cells were transferred to SOC medium and incubated at 37°C and 250 rpm for 1 hour. Subsequently, the cells were centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the cell pellet was resuspended in 1 mL of medium. 1 μL of the bacterial culture was serially diluted 10-fold to 10⁻⁶. -1 10 -2 10 -3 10 -4 10 -5 and 10 -6 10 -3 10 -4 10 -5 and 10 -6 Take 100 μL of each grade of bacterial suspension and spread it to a depth of 90 mm. 2The volume was determined on 2YT-GA plates. 1 mL of culture medium was added to the remaining bacterial culture, and then 250 μL was spread onto plates up to 150 mm thick. 2 2YT-GA plates. Place the plates in an incubator at 37°C and incubate upside down overnight.

[0298] 7.5 Day 2, from 90mm 2 Twenty-four colonies were picked from a 2YT-GA plate, transferred to 2YT-A medium, and cultured. Colony PCR was then performed to detect the empty vector rate of this library construction (e.g., ...). Figure 8 (As shown), next-generation sequencing was used to detect sequence diversity, ultimately yielding an actual library volume of 1.76 x 10⁻⁶. 8 A library of mice exhibiting anti-Fab phage.

[0299] 7.6 Collect 150 mm of 2YT-A medium. 2 All colonies on the 2YT-GA plate were measured, and OD was measured. 600 value.

[0300] 7.7 Add 5 OD of bacterial culture to 50 mL of 2YT-GA medium and incubate at 37℃ and 250 rpm until OD reaches 0.5. 600 ≈0.6. Then, add approximately 6 x 10⁻⁶. 11 PFU M13K07 helper phage particles (bacteria to helper phage particles ratio of 1:10 to 1:20) were incubated at 37°C and 250 rpm for 30 min and then transferred to 50 mL centrifuge tubes.

[0301] 7.8 After centrifugation at 4000 rpm for 10 min, the supernatant was removed, and the cells were resuspended in 50 mL of 2YT-Amp-Kan-IPTG (Amp 100 ug / mL, Kan 50 ug / mL, 1 mM IPTG) medium in a 250 mL culture flask and expressed overnight at 28 °C and 250 rpm.

[0302] 7.9 On day 3, the expressed phage particles were collected using PEG / NaCl precipitation technology, and 1 μL was serially diluted and used to infect TG1 cells to detect their titer.

[0303] Panning: Following solid-phase panning techniques, the amplified phage particles underwent three rounds of panning. The NSP3 protein concentration used in each round was set to 15 μg / mL, 7.5 μg / mL, and 3 μg / mL, respectively. The amount of phage particles added in each round was approximately 1 x 10⁻⁶. 12 pfu.

[0304] 7.10 During the screening process, NSP3 protein was diluted to the screening concentration using coating buffer and added to the microplate at 100 μL / well (10 wells per round of coating, with one negative control well containing PBS). The plate was then incubated overnight at 4°C to ensure adequate binding.

[0305] On the second day of July 11th, the mixture was sealed with 5% PBSM (skimmed milk powder) for 1 hour, containing approximately 1 x 10⁻⁶ ppm. 12 Pfu phage was diluted to 1.2 mL with PBSM and added to an ELISA plate at a rate of 100 μL / well. The plate was incubated at 37 °C for 1 h to specifically capture the phage.

[0306] 7.12 After incubation, discard the unbound phage liquid and wash with 0.05% PBST (10 washes in the first round, 15 washes in the second round, and 20 washes in the third round). After drying, add 100 μL of 0.2 M glycine (pH 2.5) elution buffer to each well, shake for 10 min, collect the elution buffer into a 2 mL centrifuge tube, and immediately add 1 M Tris-HCl (pH 9.0) for neutralization.

[0307] 7.13 Meanwhile, prepare OD 600 ≈0.6% fresh TG1 cells. Take 10 μL of elution buffer and perform 10-fold serial dilutions to infect TG1 cells. Take 5 μL of bacterial culture for each dilution and add it to a 2YT-GA plate to detect the elution titer.

[0308] 7.14 In addition, 900 μL of elution buffer was used to inoculate 2 mL of TG1 cells and spread to a depth of 150 mm. 2 Place the 2YT-GA plates on an incubator at 37°C and invert them overnight.

[0309] On July 15, the phage amplification steps (July 7-14) were repeated to carry out the next round of phage amplification and expression.

[0310] (8) Identification of positive clones and sequence extraction

[0311] 8.1 The second and third rounds of elution buffer were serially diluted and used to inoculate TG1 cells, which were then plated onto 2YT-GA plates. The next day, single clones were selected from the plates and transferred to 250 μL of 2YT-A medium (using a 96-well deep-well plate). After incubation at 37°C and 250 rpm for 5 hours, 50 μL of the bacterial culture was collected and stored for subsequent experiments.

[0312] 8.2 Add approximately 3 x 10 to 200 μL of bacterial culture. 9 PFU's M13K07 helper phage was incubated at 37°C and 250 rpm for 30 min to promote the adsorption and infection of the helper phage.

[0313] 8.3 Subsequently, antibiotics (kanamycin) were added to the bacterial culture to a final concentration of 50 μg / mL, and IPTG was added to a final concentration of 1 mM. The culture flasks were then incubated overnight at 28°C and 250 rpm to express the recombinant phage.

[0314] 8.4 On the third day, the supernatant of the expressed phage was collected by centrifugation at 3700 rpm for 10 min, and single clones were identified by ELISA.

[0315] 8.5 Selecting OD from the experimental group 450 For samples with an OD value greater than 1.0, the negative control's OD value should also be confirmed. 450 A negative result was used to ensure that the selected phages could specifically bind to the NSP3 protein. Subsequently, next-generation sequencing was used for sequencing and antibody sequence analysis. The amino acid / nucleotide sequences and CDRs of the heavy chain variable regions and light chain variable regions of the antibodies that specifically bind to the NSP3 protein (NSP3-2E2(2E2), NSP3-2G3(2G3), NSP3-2D5(2D5), NSP3-2B7(2B7), NSP3-2B2(2B2), NSP3-2H8(2H8), NSP3-2H4(2H4), NSP3-2A7(2A7), NSP3-2D2(2D2), NSP3-2H2(2H2), NSP3-3H11(3H11), NSP3-4C12(4C12)) are shown in Tables 11-22.

[0316] Table 11. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2E2 antibody.

[0317]

[0318]

[0319] Table 12. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2G3 antibody.

[0320]

[0321]

[0322] Table 13. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2D5 antibody.

[0323]

[0324]

[0325]

[0326] Table 14. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2B7 antibody.

[0327]

[0328]

[0329] Table 15. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2B2 antibody.

[0330]

[0331]

[0332] Table 16. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2H8 antibody.

[0333]

[0334]

[0335] Table 17. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2H4 antibody.

[0336]

[0337]

[0338] Table 18. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2A7 antibody.

[0339]

[0340]

[0341] Table 19. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2D2 antibody.

[0342]

[0343]

[0344] Table 20. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-2H2 antibody.

[0345]

[0346]

[0347]

[0348] Table 21. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-3H11 antibody.

[0349]

[0350]

[0351] Table 22. Amino acid / nucleotide sequences of the variable region and CDR of the NSP3-4C12 antibody.

[0352]

[0353]

[0354] (9) Subcloning of positive antibody sequences into human IgG1 / IgK expression vector

[0355] 9.1 Design specific primers and use PCR and homologous recombination techniques to subclone the genes encoding the heavy chain variable regions and light chain variable regions of positive antibodies (NSP3-2E2, NSP3-2G3, NSP3-2D5, NSP3-2B7, NSP3-2B2, NSP3-2H8, NSP3-2H4, NSP3-2A7, NSP3-2D2, NSP3-2H2, NSP3-3H11, NSP3-4C12) into mammalian cell expression vectors (IgG1 vector, IgK vector: original source: pCMV-GFP, Plasmid#11153, addgene), respectively, to obtain antibody heavy chain plasmids and antibody light chain plasmids (e.g., ...). Figure 9 ).

[0356] 9.2 In antibody backbone construction, the antibody targeting NSP3 protein utilizes the constant region of human IgG1 and the constant region of the kappa light chain, such as... Figure 9 As shown.

[0357] 9.3 After the recombinant plasmid was confirmed to be correct by sequencing, the plasmid was prepared using the Tiangen endotoxin-free plasmid extraction kit (Tiangen Biochemistry, Cat#DP118-02) to ensure the efficiency and safety of subsequent experiments.

[0358] (10) Expression and purification of antibodies in HEK293F cells

[0359] 10.1 HEK 293F cells were removed from the liquid nitrogen container and rapidly revived in a 37°C water bath. Subsequently, the revived cells were transferred to 10 mL of OPM-293CD05 medium preheated to 37°C, centrifuged at 200 x g for 5 min, and the supernatant was discarded. Cells were resuspended and counted at a ratio of 0.5 x 10⁻⁶ cells / mL. 6The cells were seeded into shake flasks at a density of cells / mL and cultured at 37°C, 130 rpm, and 8% CO2.

[0360] 10.2 Within 3 to 4 days after resuscitation, perform cell dilution passages, with each passage seeding density of 0.3–0.5 x 10⁻⁶ cells. 6 cells / mL. After three passages, the cell viability recovers to over 95%, and transient expression experiments can be performed.

[0361] 10.3 One day before transfection (D-1), based on the cell count results, take an appropriate amount of cell suspension, centrifuge at 200x g for 5 min, discard the supernatant, and resuspend the cell pellet in fresh culture medium to 0.8x 10⁻⁶. 6 cells / mL, continue culturing.

[0362] 10.4 On the day of transfection (D0), according to the volume of the cell suspension, prepare a DNA-PEI suspension using PBS. After incubating at room temperature for 5-10 min, add the suspension dropwise to the cell lysate (transfection system is shown in Table 23), mix gently, and then express the DNA at 37℃, 130 rpm, and 8% CO2.

[0363] Table 23 Transfection system (taking 40 mL cell suspension as an example)

[0364]

[0365] 10.5 On day 5 after transfection (D5), the cell suspension was centrifuged at 4000 rpm for 20 min, and the supernatant was collected for subsequent purification.

[0366] 10.6 The collected supernatant was purified by gravity column chromatography using Protein A affinity chromatography media. During this process, the antibody was captured by Protein A and washed with PBS to remove non-specifically bound impurities. Subsequently, the bound antibody was eluted with 0.1 M glycine elution buffer at pH 3.4 and immediately neutralized with 1 M Tris-HCl buffer at pH 8.5 to prevent antibody denaturation at low pH.

[0367] 10.7 Purified antibody was obtained through An ultrafiltration filter (MWCO = 50 kDa) was used to replace the glycine buffer with PBS. Antibody concentrations were then measured using Nanodrop and identified by SDS-PAGE electrophoresis (e.g., ...). Figure 10 (As shown). Electrophoresis results showed that the heavy chain of the antibody after reduction was approximately 50 kDa, and the light chain was approximately 25 kDa, consistent with the expected results, verifying the successful expression and purification of the antibody.

[0368] (11) ELISA detection of antigen-antibody binding affinity

[0369] 11.1 Dilute the NSP3 protein obtained in “(1) NSP3 antigen preparation” to 1ug / mL with coating buffer, add it to a 96-well microplate at a ratio of 100uL / well, and incubate overnight at 4°C to ensure that the protein is fully bound.

[0370] 11.2 On the second day, after discarding the coating solution, the plate was washed three times with 0.05% PBST, and then 200 μL of 5% PBSM was added to each well. The plate was then blocked at 37°C for 1 hour to reduce nonspecific binding.

[0371] 11.3 After discarding the blocking solution and washing again, add 100 μL of serially diluted antibody obtained from "(10) HEK293F cell expression antibody and purification" to each well and incubate at 37°C for 1 h. Then discard the sample and wash with PBST five times to remove unbound antibody. Next, add 100 μL of detection secondary antibody anti-human IgG Fc (HRP, 1:5000 diluted in 1% PBSM) to each well and incubate at 37°C for 1 h.

[0372] 11.4 After incubation, discard the secondary antibody and wash five times with PBST. Then, add 100 μL of TMB chromogenic solution to each well and incubate at room temperature in the dark for approximately 15 minutes. Finally, add 50 μL of stop solution and read the OD using a microplate reader. 450 value.

[0373] 11.5 Four-parameter nonlinear regression analysis was performed on the experimental data using GraphPad Prism 8 software to calculate the antibody affinity. The results showed that the affinity between the NSP3 antigen and antibody (dissociation constant, K0) was... D The range is 10 -10 Up to 10 -12 Between M and M. These results demonstrate that high-affinity antibodies with good binding properties were successfully screened using Fab phage display technology, laying a solid foundation for subsequent applications (such as...). Figure 11 ).

[0374] (12) Immunofluorescence detection

[0375] 12.1 Cell Preparation: 17CL-1 cells were cultured in confocal microscope dishes until the cell density reached approximately 60%. Subsequently, they were infected with MHV-A59 (ATCC, VR-764). TM The virus strain was used, and the infection dose (MOI) reached 1. Cell samples were collected 24 hours after infection.

[0376] 12.2 Cell fixation: Remove the culture medium from the confocal dish and wash once with PBS to remove residual culture medium. Then fix the cells with 4% paraformaldehyde for 10 min to maintain cell morphology and fix intracellular proteins.

[0377] 12.3 Cell permeabilization: Wash three times with PBS for 5 min each time to remove paraformaldehyde fixative. Then, permeabilize with 0.1% Triton X-100 for 5-10 min to enhance antibody entry into cells.

[0378] 12.4 Cell blocking: Add 2.5% BSA blocking solution and incubate at room temperature for 1 hour to reduce non-specific binding, thereby improving the specificity and sensitivity of subsequent experiments.

[0379] 12.5 Primary antibody incubation: The antibodies (2A7, 2B7, 2D5, 2H4, 2B2, 2D2, 2H8, 3H11, 2E2, 2H2, 4C12, 2G3) obtained from “(10) HEK293F cell expression and purification” were diluted to 1:100, with a concentration of approximately 1 mg / mL. 200 μL of the diluted antibody solution was added to each sample, and the mixture was incubated overnight at 4°C to improve the specificity of antibody binding to the target protein.

[0380] 12.6 PBS washing: Wash the confocal dish with PBS 3-5 times, 5 minutes each time, to remove unbound primary antibody and ensure signal specificity.

[0381] 12.7 Secondary antibody incubation: Add Alexa Fluor 488 fluorescent secondary antibody (A-11001, ThermoFisher), dilute it to 1:500, and incubate at room temperature in the dark for 1 hour to facilitate efficient recognition of the primary antibody.

[0382] 12.8 Wash again: Wash the confocal dish 5 times with PBS for 5 minutes each time to remove unbound secondary antibody and reduce background signal.

[0383] 13.9 Observation under a fluorescence microscope: Experimental results were observed using a fluorescence microscope. Positive signals were detected using antibodies with different clone numbers (2A7, 2B7, 2D5, 2H4, 2B2, 2D2, 2H8, 3H11, 2E2, 2H2, 4C12, 2G3). Three different fields of view were selected for each antibody to clearly show the localization and distribution of viral particles within the cells (e.g., ...). Figure 12 This demonstrates that the screened NSP3 antibody is effective for immunofluorescence detection.

[0384] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A mouse hepatitis virus antibody or its antigen-binding fragment, wherein the mouse hepatitis virus antibody or its antigen-binding fragment comprises: a1) CDR-H1, CDR-H2, and CDR-H3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 116; and CDR-L1, CDR-L2, and CDR-L3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 117; or a2) having CDR-H1, CDR-H2 and CDR-H3 included in the heavy chain variable region (VH) of the amino acid sequence shown in SEQ ID NO: 182; and having CDR-L1, CDR-L2 and CDR-L3 included in the light chain variable region (VL) of the amino acid sequence shown in SEQ ID NO: 183; The CDR is defined according to the Kabat, Chothia, IMGT, Contact, or AbM numbering system.

2. The antibody or its antigen-binding fragment according to claim 1, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: b1) A VH comprising the following three CDRs: CDR-H1 with the amino acid sequence shown in SEQ ID NO: 118, CDR-H2 with the amino acid sequence shown in SEQ ID NO: 119, and CDR-H3 with the amino acid sequence shown in SEQ ID NO: 120; and / or a VL comprising the following three CDRs: CDR-L1 with the amino acid sequence shown in SEQ ID NO: 28, CDR-L2 with the amino acid sequence KVS, and CDR-L3 with the amino acid sequence shown in SEQ ID NO: 121; or b2) A VH comprising the following three CDRs: CDR-H1 with the amino acid sequence shown in SEQ ID NO: 118, CDR-H2 with the amino acid sequence shown in SEQ ID NO: 119, and CDR-H3 with the amino acid sequence shown in SEQ ID NO: 184; and / or a VL comprising the following three CDRs: CDR-L1 with the amino acid sequence shown in SEQ ID NO: 48, CDR-L2 with the amino acid sequence being RMS, and CDR-L3 with the amino acid sequence shown in SEQ ID NO: 80, wherein the CDRs are defined according to the IMGT numbering system; or The mouse hepatitis virus antibody or its antigen-binding fragment includes: c1) A VH comprising the following three CDRs: CDR-H1 of the amino acid sequence shown in SEQ ID NO: 122, CDR-H2 of the amino acid sequence shown in SEQ ID NO: 123, and CDR-H3 of the amino acid sequence shown in SEQ ID NO: 124; and / or a VL comprising the following three CDRs: CDR-L1 of the amino acid sequence shown in SEQ ID NO: 33, CDR-L2 of the amino acid sequence shown in SEQ ID NO: 12, and CDR-L3 of the amino acid sequence shown in SEQ ID NO: 121; or c2) A VH comprising the following three CDRs: CDR-H1 of the amino acid sequence shown in SEQ ID NO: 122, CDR-H2 of the amino acid sequence shown in SEQ ID NO: 123, and CDR-H3 of the amino acid sequence shown in SEQ ID NO: 124; and / or a VL comprising the following three CDRs: CDR-L1 of the amino acid sequence shown in SEQ ID NO: 53, CDR-L2 of the amino acid sequence shown in SEQ ID NO: 54, and CDR-L3 of the amino acid sequence shown in SEQ ID NO: 80, wherein the CDRs are defined according to the Kabat numbering system; or The mouse hepatitis virus antibody or its antigen-binding fragment includes: d1) A VH comprising the following three CDRs: CDR-H1 with the amino acid sequence shown in SEQ ID NO: 125, CDR-H2 with the amino acid sequence shown in SEQ ID NO: 126, and CDR-H3 with the amino acid sequence shown in SEQ ID NO: 124; and / or a VL comprising the following three CDRs: CDR-L1 with the amino acid sequence shown in SEQ ID NO: 33, CDR-L2 with the amino acid sequence shown in SEQ ID NO: 12, and CDR-L3 with the amino acid sequence shown in SEQ ID NO: 121; or d2) A VH comprising the following three CDRs: CDR-H1 of the amino acid sequence shown in SEQ ID NO: 125, CDR-H2 of the amino acid sequence shown in SEQ ID NO: 126, and CDR-H3 of the amino acid sequence shown in SEQ ID NO: 124; and / or a VL comprising the following three CDRs: CDR-L1 of the amino acid sequence shown in SEQ ID NO: 53, CDR-L2 of the amino acid sequence shown in SEQ ID NO: 54, and CDR-L3 of the amino acid sequence shown in SEQ ID NO: 80, wherein the CDRs are defined according to the Chothia numbering system; or The mouse hepatitis virus antibody or its antigen-binding fragment includes: e1) A VH comprising the following three CDRs: CDR-H1 of the amino acid sequence shown in SEQ ID NO: 127, CDR-H2 of the amino acid sequence shown in SEQ ID NO: 128, and CDR-H3 of the amino acid sequence shown in SEQ ID NO: 129; and / or a VL comprising the following three CDRs: CDR-L1 of the amino acid sequence shown in SEQ ID NO: 39, CDR-L2 of the amino acid sequence shown in SEQ ID NO: 19, and CDR-L3 of the amino acid sequence shown in SEQ ID NO: 130; or e2) A VH comprising the following three CDRs: CDR-H1 with the amino acid sequence shown in SEQ ID NO: 127, CDR-H2 with the amino acid sequence shown in SEQ ID NO: 128, and CDR-H3 with the amino acid sequence shown in SEQ ID NO: 185; and / or a VL comprising the following three CDRs: CDR-L1 with the amino acid sequence shown in SEQ ID NO: 60, CDR-L2 with the amino acid sequence shown in SEQ ID NO: 61, and CDR-L3 with the amino acid sequence shown in SEQ ID NO: 91, wherein the CDRs are defined according to the Contact numbering system.

3. The antibody or antigen-binding fragment thereof according to any one of claims 1-2, characterized in that, The heavy chain variable region of the mouse hepatitis virus antibody or its antigen-binding fragment further includes a framework region of the heavy chain variable region; and / or The light chain variable region of the mouse hepatitis virus antibody or its antigen-binding fragment also includes the framework region of the light chain variable region.

4. The antibody or its antigen-binding fragment according to claim 3, characterized in that, The framework region of the heavy chain variable region includes the framework region of the heavy chain variable region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese; and / or The framework region of the light chain variable region includes the framework region of the light chain variable region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese.

5. The antibody or its antigen-binding fragment according to claim 4, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

6. The antibody or its antigen-binding fragment according to claim 5, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 85% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

7. The antibody or its antigen-binding fragment according to claim 6, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

8. The antibody or its antigen-binding fragment according to claim 7, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 91% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 91% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 91% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 91% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

9. The antibody or its antigen-binding fragment according to claim 8, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 92% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 92% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 92% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 92% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

10. The antibody or its antigen-binding fragment according to claim 9, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 93% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 93% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 93% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 93% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

11. The antibody or its antigen-binding fragment according to claim 10, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 94% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 94% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 94% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 94% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

12. The antibody or its antigen-binding fragment according to claim 11, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

13. The antibody or its antigen-binding fragment according to claim 12, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 96% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

14. The antibody or its antigen-binding fragment according to claim 13, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 97% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

15. The antibody or its antigen-binding fragment according to claim 14, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

16. The antibody or its antigen-binding fragment according to claim 15, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes: g1) Heavy chain variable region (VH), comprising an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), comprising an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), comprising an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:

183.

17. The antibody or antigen-binding fragment thereof according to claim 16, characterized in that, g1) Heavy chain variable region (VH), comprising the amino acid sequence shown in SEQ ID NO: 116; and / or, light chain variable region (VL), comprising the amino acid sequence shown in SEQ ID NO: 117; or g2) Heavy chain variable region (VH), which includes the amino acid sequence shown in SEQ ID NO: 182; and / or, light chain variable region (VL), which includes the amino acid sequence shown in SEQ ID NO:

183.

18. The antibody or antigen-binding fragment thereof according to any one of claims 1-2, 4-17, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment further includes a heavy chain constant region and / or a light chain constant region.

19. The antibody or antigen-binding fragment thereof according to claim 18, characterized in that, The heavy chain constant region includes at least a portion of the heavy chain constant region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese; and / or The light chain constant region includes at least a portion of the light chain constant region or a mutant thereof derived from immunoglobulins of mice, primates, cattle, horses, pigs, sheep, goats, dogs, cats, rabbits, camels, donkeys, deer, minks, chickens, ducks, or geese.

20. The antibody or antigen-binding fragment thereof according to claim 19, characterized in that, The heavy chain constant region includes the heavy chain constant region derived from human immunoglobulins or a mutant thereof; and / or The light chain constant region includes the light chain constant region derived from human immunoglobulins or a mutant thereof; and / or The heavy chain constant region includes heavy chain constant regions derived from IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM immunoglobulins; and / or The light chain constant region includes light chain constant regions derived from κ and λ immunoglobulins.

21. The antibody or antigen-binding fragment thereof according to claim 18, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment is a mouse-derived antibody, a chimeric antibody, or a humanized antibody.

22. The antibody or antigen-binding fragment thereof according to any one of claims 1-2, 4-17, characterized in that, The mouse hepatitis virus antibody or its antigen-binding fragment includes monoclonal antibodies, Fab fragments, Fab' fragments, Fab'-SH fragments, F(ab')2 fragments, Fv fragments, single-chain Fv (scFv) or dsFv; and / or The mouse hepatitis virus antibody or its antigen-binding fragment specifically binds to the NSP3 protein.

23. Biomaterials, including any one of n1)-n9): n1) A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof as described in any one of claims 1-22; n2) An expression cassette containing the nucleic acid molecule described in n1); n3) A carrier containing the nucleic acid molecule described in n1); n4) A carrier containing the expression box described in n2); n5) A cell containing the nucleic acid molecules described in n1); n6) Cells containing the expression cassette described in n2); n7) Cells containing the carrier described in n3); n8) Cells containing the carrier described in n4); n9) Cells comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1-22; None of the cells described in n5)-n9) contain reproductive material; The cells described in n5) and n9) are prokaryotic or eukaryotic cells; The eukaryotic cells are CHO cells, HEK293 cells, BHK cells, PER cells, PER.C6 cells, HeLa cells, Vero cells, Expi293 cells, yeast cells, or insect cells.

24. A method for preparing the antibody or antigen-binding fragment thereof according to any one of claims 1-22, wherein the antibody is obtained by culturing the cells described in claim 23.

25. A conjugate comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1-22; and a conjugation portion; The coupling portion is a detectable marker.

26. The coupling according to claim 25, characterized in that, The detectable markers include enzymes, radionuclides, fluorescent dyes, luminescent substances, colored substances, and / or biotin.

27. A diagnostic kit comprising: The antibody or antigen-binding fragment thereof as described in any one of claims 1-22, or the conjugate as described in any one of claims 25-26.

28. The use of the antibody or antigen-binding fragment thereof according to any one of claims 1-22, the biomaterial according to claim 23, or the conjugate according to any one of claims 25-26 in any one of c1)-c7): c1) Prepare products for diagnosing mouse hepatitis virus infection or diseases caused by it; c2) Prepare products for detecting the presence or level of mouse hepatitis virus or its NSP3 protein in samples; c3) Detect the presence or level of mouse hepatitis virus or its NSP3 protein; c4) Prepare a product for drug screening, said drug for the prevention and / or treatment of mouse hepatitis virus infection or disease caused by it; c5) Drug screening, wherein the drug is used to prevent and / or treat mouse hepatitis virus infection or the disease caused therefrom; c6) Basic research and / or vaccine development targeting coronaviruses; c7) Prepare products for basic research and / or vaccine development against coronaviruses; The applications described in c3), c5), and c6) do not involve the diagnosis or treatment of diseases.

Images