A snp molecular marker related to beef cattle girth and application thereof
By detecting the genotype of specific SNP sites in the beef cattle genome and using PCR-RFLP technology and enzyme digestion methods, the problem of long time consumption and high cost in predicting chest girth traits in traditional beef cattle breeding has been solved, achieving early and accurate prediction and efficient breeding.
Patent Information
- Application Number
- CN202511543448.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-10-28
AI Technical Summary
Traditional beef cattle breeding methods are time-consuming, costly, and highly susceptible to environmental factors. They are difficult to accurately predict chest circumference performance in adulthood at an early stage and lack effective SNP markers for beef cattle breeding.
A molecular marker for an SNP located at position 94541673 on chromosome 8 of bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3 is provided. The genotype of the SNP site is detected by PCR-RFLP technology, and the Nco I enzyme digestion product is used for identification. A specific detection method and detection kit are developed.
This technology enables accurate prediction of chest girth traits in beef cattle at an early stage, improving breeding efficiency, shortening the breeding cycle, reducing costs, and enhancing the accuracy and efficiency of breeding selection.
Smart Images

Figure CN121023046B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to beef cattle chest circumference and application thereof. BACKGROUND
[0002] The beef cattle chest circumference trait is one of important indexes for evaluating beef cattle body development and meat production performance. The chest circumference directly reflects the overall skeleton size, volume and potential meat production capacity of beef cattle, and has a high positive correlation with the live weight and carcass weight of beef cattle. Therefore, the chest circumference is usually used as an important selection trait in beef cattle breeding and is widely applied to selection and mating schemes of beef cattle.
[0003] Traditional beef cattle breeding usually relies on phenotype determination, family and offspring testing, but these methods have problems of long time consumption, high cost and great influence of environmental factors, and it is difficult to accurately predict the chest circumference performance at the adult stage in the early stage of cattle growth, so that the breeding efficiency is greatly limited. With the rapid development of genomics and molecular biology technology, the Marker Assisted Selection (MAS) technology is gradually becoming one of important ways to improve the breeding efficiency of beef cattle. As the third generation of molecular markers, single nucleotide polymorphism (SNP) has the characteristics of large quantity, wide distribution and convenient detection, and is suitable for large-scale screening and application in animal populations. At present, through Genome-Wide Association Study (GWAS), SNP sites significantly related to specific economic traits can be effectively mined, so as to be used for molecular marker assisted breeding. Although some SNP markers related to beef cattle economic traits have been developed and applied to breeding practice, functional SNP markers specifically for the chest circumference trait are still relatively lacking, especially effective markers that can accurately predict the adult chest circumference performance in the early stage of cattle population. SUMMARY
[0004] In order to solve the above problems, the present application provides a SNP molecular marker related to beef cattle chest circumference and application thereof. The SNP molecular marker provided by the present application can accurately and efficiently predict the chest circumference trait of beef cattle individuals, and is especially suitable for predicting the chest circumference trait in the early stage (such as the young age) of beef cattle, thereby greatly improving the breeding efficiency and shortening the breeding cycle.
[0005] In order to achieve the above purpose, the present application provides the following technical scheme:
[0006] The application provides a SNP molecular marker related to beef cattle chest circumference, which comprises a SNP site; the SNP site is located on a bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3 chromosome 8, has a C / T polymorphism, and is located at 94541673; and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein Y is C or T.
[0007] The application provides a primer pair for detecting the SNP molecular marker in the above technical solution, which is composed of an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
[0008] The application provides a kit for detecting the SNP molecular marker in the above technical solution, which comprises the primer pair in the above technical solution and Nco I restriction endonuclease.
[0009] Preferably, the kit further comprises one or more reagents of a buffer solution, a dNTP mixture and a DNA polymerase required for PCR reaction.
[0010] The application provides an application of a product for detecting the genotype of the SNP molecular marker in the above technical solution in identifying the beef cattle chest circumference or breeding beef cattle with large chest circumference; the beef cattle with the genotype TT or CT has a larger chest circumference than beef cattle with the genotype CC.
[0011] Preferably, the product comprises the primer pair in the above technical solution or the kit in the above technical solution.
[0012] Preferably, the beef cattle comprises Angus.
[0013] The application provides a method for identifying the beef cattle chest circumference, which comprises the following steps:
[0014] The genomic DNA of the beef cattle to be detected is used as a template, and the primer pair in the above technical solution is used for PCR amplification to obtain an amplification product;
[0015] The amplification product is subjected to enzyme digestion by using Nco I restriction endonuclease, and identification is performed according to the enzyme digestion result;
[0016] If the enzyme digestion product is one band, the genotype of the SNP molecular marker in the beef cattle to be detected is CC;
[0017] If the enzyme digestion product is two bands, the genotype of the SNP molecular marker in the beef cattle to be detected is TT;
[0018] If the enzyme digestion product is three bands, the genotype of the SNP molecular marker in the beef cattle to be tested is CT;
[0019] The beef cattle with the genotype of TT or CT of the SNP molecular marker have a larger chest circumference than the beef cattle with the genotype of CC.
[0020] The application provides a method for selecting beef cattle with a high chest circumference, which comprises the following steps: detecting the genotype of the SNP molecular marker in the beef cattle to be tested by the method, retaining the beef cattle with the genotype of TT and / or CT to breed offspring, and screening the beef cattle with the genotype of TT or CT from the offspring.
[0021] Preferably, the beef cattle comprise Angus cattle.
[0022] Beneficial effects:
[0023] The application provides a SNP molecular marker related to the chest circumference of beef cattle, which comprises a SNP site; the SNP site is located on the 8th chromosome of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, and is located at position 94541673, and has C / T polymorphism. The application finds a SNP site highly related to the chest circumference of beef cattle through GWAS research on a beef cattle population by using a beef cattle promoter breeding chip. The SNP site is located at position 94541673 on the 8th chromosome of the bovine reference genome (GCF_002263795.2_Bos_taurus.ARS-UCD1.3), and has C / T polymorphism. The nucleotide sequence composed of the upstream and downstream can be as shown in SEQ ID NO. 1. The beef cattle with the genotype of TT or CT of the SNP site have a larger chest circumference than the beef cattle with the genotype of CC. The SNP molecular marker provided by the application can accurately and efficiently predict the chest circumference of beef cattle, and is especially suitable for predicting the chest circumference of beef cattle at an early stage (such as a young age), thereby greatly improving the breeding efficiency and shortening the breeding cycle.
[0024] The application further develops a specific detection method and a detection kit for the SNP site. The beef cattle chest circumference can be identified by performing Nco I enzyme digestion on the amplification product according to the enzyme digestion result, thereby providing a new molecular marker tool for beef cattle breeding and improving the breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments.
[0026] Figure 1 A Manhattan plot for the whole genome association analysis of the chest circumference of beef cattle;
[0027] Figure 2 QQ plot of GWAS results for beef cattle girth trait;
[0028] Figure 3 Boxplot of distribution of girth phenotypes of individuals with different genotypes at SNP locus Chr8:94541673;
[0029] Figure 4 Electrophoretogram of PCR product before enzyme digestion;
[0030] Figure 5 Electrophoretogram of PCR product after Nco I enzyme digestion. DETAILED DESCRIPTION
[0031] The present application provides a SNP molecular marker related to beef cattle girth, which comprises a SNP locus; the SNP locus is located on chromosome 8 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 94541673, and has C / T polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and is specifically as follows:
[0032] 5'-AAAGACAGAAGCAAAGGACTTCCCTGGTGGTCCAGCGGCAAGACTCTGAGCTCCCAGCATAAGGGGCCCAGGTTCGATCCCTGGTCAGGGATCTAGATCCCACATGCTGCAACTGAGTTTACATACTGCAACTAAGTATCCCGCACTACAACTAAGACCTGGTGCAGCCAAAAAATTAAATAAATATTAAAAATATACAGAAGCAGAGACAGGAAAGATGTGGCCACAAGCTAAGGAACACCAGGCACTTCCAGCTTCTGGAAGGATCCTCCTCTATAGCCAYGGGAGGGAGCACGAGCCTGCCAACACCTTTATCTCAGACTTCTGGCCTCCAGACTGTGAGAGAACCCATTTCTTTTGTTTTAAGCTACCAAGTTGGTGGTAATTTGGTTTGGCAGCACTAGGAAACTGATACAGTATGTCTGTGCTTCTATATTAACCAT-3'; wherein the SNP locus is at 283bp in SEQ ID NO. 1, and is represented by a degenerate base Y, i.e. Y is C or T.
[0033] The SNP molecular marker provided by the present application is a molecular marker highly related to the chest circumference trait, wherein the beef cattle with genotype TT or CT at the SNP site has a larger chest circumference than the beef cattle with genotype CC, that is, the T allele is a superior allele related to a higher chest circumference trait. The SNP molecular marker provided by the present application can be used to accurately and efficiently identify the chest circumference of beef cattle individuals, and has important value in early selection and breeding programs of beef cattle. The SNP molecular marker can also be used to construct a molecular assisted evaluation model of the chest circumference trait of beef cattle, so as to predict the adult chest circumference or growth rate of the beef cattle by detecting the genotype of the SNP site of the beef cattle or the candidate breeding individual, thereby performing early selection. The SNP molecular marker provided by the present application has the advantages of early screening, accuracy, efficiency, low cost and the like, and can accelerate the breeding of beef cattle with excellent chest circumference traits.
[0034] The present application provides a primer pair for detecting the SNP molecular marker described in the above technical solution, which is composed of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3. The primer pair provided by the present application can specifically amplify the nucleotide sequence containing the SNP molecular marker described in the above technical solution, and the genotype of the amplification product (i.e. the genotype of the SNP site or the genotype of Y in the sequence shown in SEQ ID NO. 1) can be used to identify or evaluate the chest circumference of beef cattle after adulthood, wherein the beef cattle with genotype TT or CT has a larger chest circumference than the beef cattle with genotype CC, and the beef cattle with excellent chest circumference traits can be bred more quickly.
[0035] The present application provides a kit for detecting the SNP molecular marker described in the above technical solution, which comprises the primer pair described in the above technical solution and Nco I restriction endonuclease.
[0036] As an embodiment, the kit further comprises one or more reagents selected from the group consisting of a buffer, a dNTP mixture and a DNA polymerase required for PCR reaction.
[0037] The application also finds that the SNP mutation of the SNP molecular marker changes the only Nco I enzyme cutting recognition site in the PCR product sequence (shown in SEQ ID NO. 1), and the recognition site "CCATGG" exists in the mutant sequence, while the site is "CCACGG" in the wild type and cannot be restrictedly cut by Nco I enzyme. According to this feature, a PCR-RFLP-based typing method is developed: the PCR products of different genotypes of beef cattle individuals can be conveniently and quickly distinguished by Nco I enzyme cutting, wherein the PCR product of the CC genotype individual is not cut by the enzyme, the PCR product of the TT genotype is completely cut, and the hybrid CT genotype is partially cut to present a unique electrophoresis band, so that the genotype can be clearly determined. This molecular detection means can significantly shorten the beef cattle breeding cycle, reduce the breeding cost, and can be combined with traditional breeding techniques, and has a good application prospect.
[0038] Based on the above advantages, the application provides application of a product for detecting the SNP molecular marker genotype in the above technical solution in identifying the chest size of beef cattle or breeding beef cattle with large chest, and the chest of beef cattle with the SNP molecular marker genotype of TT or CT is larger than that of beef cattle with the genotype of CC.
[0039] As an implementation manner, the product comprises the primer pair in the above technical solution or the kit in the above technical solution.
[0040] As an implementation manner, the beef cattle comprises Angus.
[0041] The application provides a method for identifying the chest size of beef cattle, comprising the following steps:
[0042] Taking the genomic DNA of the beef cattle to be detected as a template, the primer pair in the above technical solution is used for PCR amplification to obtain an amplification product;
[0043] The amplification product is cut by using Nco I restriction endonuclease, and identification is performed according to the cutting result;
[0044] If the cutting product is one band, the SNP molecular marker genotype of the beef cattle to be detected in the above technical solution is CC;
[0045] If the cutting product is two bands, the SNP molecular marker genotype of the beef cattle to be detected in the above technical solution is TT;
[0046] If the cutting product is three bands, the SNP molecular marker genotype of the beef cattle to be detected in the above technical solution is CT;
[0047] The chest of beef cattle with the SNP molecular marker genotype of TT or CT is larger than that of beef cattle with the genotype of CC.
[0048] The detection method provided by the application can predict the adult chest circumference potential of beef cattle at a young age stage by detecting the genotype of the SNP molecular marker, and can be used for selection of breeding bulls, screening of reserve cows and the like, thereby improving the accuracy and efficiency of breeding selection. The method provided by the application has the advantages of high specificity, simplicity, rapidness, low cost and the like, and is very suitable for genotype screening of a large number of beef cattle individuals.
[0049] Based on the above advantages, the application provides a method for breeding beef cattle with high chest circumference, comprising: detecting the genotype of the SNP molecular marker in the beef cattle to be detected by the method described in the above technical solution, retaining the beef cattle with the genotype of TT and / or CT for breeding offspring, and screening the beef cattle with the genotype of TT or CT from the offspring. As an implementation manner, the beef cattle include Angus cattle.
[0050] In order to further illustrate the application, the SNP molecular marker related to the chest circumference of beef cattle and the application thereof provided by the application are described in detail below in combination with examples and drawings, but they should not be understood as limiting the protection scope of the application.
[0051] Example 1: Screening of a molecular marker related to adult chest circumference of beef cattle
[0052] (1) The chest circumference data of 110 adult Angus cattle were collected as phenotype data, and whether the distribution thereof conforms to normal distribution was detected, for subsequent trait association analysis. About 10 ml of blood was collected from the tail vein of each cattle, and DNA was extracted by phenol chloroform extraction method. The obtained DNA sample was subjected to fragmentation treatment and hybridization with a probe labeled with biotin by using the beef cattle promoter breeding chip in Chinese patent CN118853911B, the hybridization product of the genomic DNA labeled with biotin was enriched by using streptavidin-coated magnetic beads, elution and secondary amplification were performed, and then sequencing was performed by using Huada T7 platform. After the data were downloaded, the raw data (Raw reads) were filtered by using Fastp software to remove low-quality fragments, and a fastq format file (Clean reads) after filtering was obtained.
[0053] (2) Based on the fastq file obtained in (1), the sequencing Clean reads were aligned to the beef cattle reference genome (ARS-UCD1.3) by using the MEM function of BWA software (Version: 0.7.17), and the repeats introduced in the library construction and sequencing process were marked by using picard software (Version: 3.0), and the sample sequencing bam file after alignment was obtained.
[0054] (3) Use the HaplotypeCaller function in GATK software (Version: 4.0) to detect variant sites in the bam file of each sample generated in (2), generate the gVCF file of each sample, and then use the CombineGVCF function and GenotypeGVCF function of GATK software to obtain the variant detection and genotyping results of all samples.
[0055] (4) Use the FilterVcf function of picard (Version: 1.1) software to perform quality control on the genotyping results of each locus for each sample. When the genotyping quality value (GQ) is less than 15, the genotyping result of that locus for that sample is considered unqualified and is redefined as missing. SNP quality control is performed according to the hard filtering parameters recommended by GATK software, and a high-quality SNP VCF file containing the genotyping results of all samples is obtained. SNP quality control parameters: -filter "QD<2.0"&&-filter "QUAL<30.0"&&-filter "SOR>3.0"&&-filter "FS>60.0"&&-filter "MQ<40.0"&&-filter "MQRankSum<-12.5"&&-filter "ReadPosRankSum<-8.0".
[0056] (5) Use Plink software (Version: 1.9) to extract the genotyping results of all 52 beef cattle from the results in (4), and use vcf2hmp software (Version: 1.0) to convert the VCF format files into haplotype files.
[0057] (6) Using the SUPER model in the GAPIT package (Version: 3.0) of R software (Version: 4.3.3), phenotypic association analysis was performed on the beef cattle chest circumference data obtained in (1) and the haplotype data obtained in (5). Manhattan plots and QQ plots were plotted using the ggplot2 package (Version: 3.5.0) for visualization of the analysis results. Figure 1 and Figure 2 Extract those with p-values less than 10. -6 Loci were marked as those significantly associated with the phenotype, and their location information was recorded. Haplotypes were then extracted from the haplotype files extracted in (5). Figure 1 The presence of a significant association signal peak (threshold line indicating significance level) on chromosome 8 indicates a genetic variation significantly associated with chest circumference near Chr8:94541673. Figure 2It can be seen that most of the points are distributed along the diagonal line, indicating that the overall population has no systematic deviation. However, there are points significantly deviating from the diagonal line (greater than the diagonal line) in the tail, representing SNP sites with extremely significant correlation, including the key site on chromosome 8.
[0058] (7) The chest circumference phenotype data obtained in (1) was re-grouped according to the genotype data in the haplotype file obtained in (6) by R software (Version: 4.3.3), and ANOVA was used for significance test, and the box plot was drawn by ggplot2 package (Version: 3.5.0) for result visualization, and the key site Chr8:94541673 was extracted, and the results are shown in Figure 3 and Table 1, *** represents P <0.001, ns represents P >0.05, and the middle horizontal line in the box plot corresponds to the median value rather than the average value of the chest circumference.
[0059] Table 1 Summary of Chr8:94541673 genotype and chest circumference of 110 Angus cattle
[0060]
[0061] Note: Different lowercase letters in Table 1 indicate significant differences between different groups, and the same lowercase letters indicate no significant differences between different groups, and the same applies to the following table.
[0062] The results show that the average chest circumference and median of the TT genotype individuals are greater than those of the CC genotype. The chest circumference of TT and TC type individuals is significantly different from that of CC type individuals, while the difference between TT and TC type individuals is not significant. This indicates that the T allele has a positive effect on the chest circumference trait, and TT homozygous individuals show greater chest circumference increment.
[0063] Example 2 Molecular detection method of SNP site (PCR-RFLP)
[0064] This example provides a method for detecting the genotype of Chr8:94541673 site based on PCR-RFLP technology. The method uses a specific primer pair designed by the present application to amplify the genomic fragment containing the target site, and then uses a restriction enzyme to digest the product and analyze it by gel electrophoresis to distinguish the genotype. The specific steps are as follows:
[0065] 1. Design of PCR amplification primers: According to the bovine genome reference sequence, select primer binding sites in the upstream and downstream regions of the target SNP site, and design a primer pair to make the length of the amplification product about 443 bp. The designed primer sequences are as follows:
[0066] Forward primer: 5'-AAGACAGAAGCAAAGGACTTCC-3', SEQ ID NO. 2;
[0067] Reverse primer: 5'-ATGGTTAATATAGAAGCACAGACAT-3', SEQ ID NO. 3.
[0068] The primers are verified to only target the amplification of the target region through specific BLAST alignment.
[0069] 2. PCR amplification conditions: PCR amplification is performed with the genomic DNA of the beef cattle individual to be tested as a template. The PCR reaction system and the PCR program are as follows:
[0070] PCR reaction system: Green Taq Mix (Novozyme) 30 μL, forward primer (10 μM) 1.5 μL, reverse primer (10 μM) 1.5 μL, template 2 μL, and ddH2O is supplemented to 50 μL.
[0071] PCR program: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 20 s, 58℃ annealing for 22 s, 72℃ extension for 40 s, 35 cycles; 72℃ complete extension for 5 min.
[0072] The amplification product is verified to be about 443 bp in size through 2% agarose gel electrophoresis, and no non-specific amplification band is present, as shown in Figure 4 , wherein M represents Marker (DL500, purchased from Takara Bio) in the lane, and S1-S9 represent samples to be tested in the lanes.
[0073] 3. Restriction enzyme cleavage typing: The product obtained through PCR amplification is purified and used for restriction enzyme cleavage analysis. Nco I endonuclease is selected for cleavage reaction (the recognition sequence of Nco I is 5'-CCATGG-3'). The cleavage system is, for example, 20 μL, which contains 10 μL PCR product, 5 μL 1x suitable cleavage buffer, and 5 U Nco I enzyme, and the reaction is performed at 37℃ for 1 h, and then the enzyme is inactivated at 65℃ for 10 min. Since the SNP site identified in the application is mutated to destroy the recognition site of Nco I, the PCR products of different genotypes present different fragment patterns after cleavage:
[0074] If the individual to be tested is of pure mutant TT genotype, its PCR product sequence contains a complete Nco I restriction site, which will be cut into two specific length DNA fragments (in this example, about 284 bp and 163 bp fragments) after Nco I digestion. If it is of wild type CC genotype, the PCR product sequence does not contain the restriction site, and the product cannot be cut by Nco I, remaining about 443 bp intact fragment after digestion. If it is of hybrid CT genotype, one allele is TT (can be cut) and the other is CT (cannot be cut). After digestion, three fragments will be produced: the uncut 443 bp fragment, and the about 163 bp and 284 bp fragments produced by digestion.
[0075] 4. Electrophoretic detection: The digestion reaction product is separated by 2.0% agarose gel electrophoresis, running at 125 V for about 20-30 min. The results are recorded under ultraviolet light. The electrophoretic patterns of different genotypes are interpreted as follows: TT genotype samples show two clear bands (the 443 bp band disappears, and about 284 bp and 163 bp bands appear); CC genotype shows a single band (the 443 bp uncut band); CT hybrid genotype shows three bands (the 443 bp uncut band, and the 284 bp and 163 bp digestion bands). Overall, the electrophoretic fingerprints produced by different genotypes are clearly distinguishable, as shown in Figure 5
[0076] 5. Result determination: Determine the genotype of the individual to be tested according to the electrophoretic band pattern. In combination with the trait association effect discovered by the present application, the breeding value can be further inferred: individuals detected to be of TT genotype and CT hybrid genotype carry favorable alleles, and are expected to have higher chest circumference phenotype under the same feeding conditions; individuals of CC genotype lack the favorable alleles, and are expected to have relatively lower growth performance. Accordingly, individuals of TT genotype can be selected and kept in the population as breeding stock to improve the average chest circumference of the next generation population.
[0077] Example 3 Application of molecular marker assisted breeding
[0078] Take a candidate bull from a certain beef cattle breeding farm as an example: take a blood sample from each candidate bull at 6 months of age, extract genomic DNA, and detect the genotype of the Chr8:94541673 locus according to the method described in Example 2. The results are shown in Table 2.
[0079] Table 2 Summary of Chr8:94541673 locus genotypes and chest circumference of 152 Angus offspring
[0080]
[0081] According to the detection results, the bulls with genotypes of TT or CT are marked as preferred individuals, which are expected to have higher adult chest circumference, body development and meat production performance. For the bulls with genotype of TT, they can be preferentially selected for breeding and mating test to evaluate the growth performance of their offspring; for the bulls with genotype of CC, they can be appropriately considered to be degraded to commodity beef cattle or eliminated to avoid the influence of their allele disadvantage on the growth of offspring. Similarly, the marker can also be applied to screen the reserve cows carrying excellent alleles (T) in the cow group for breeding the next generation. By introducing the molecular marker detection step of the present application into the breeding program, the performance prediction and selection at the genetic level can be carried out at the young stage of the animal, and the efficiency of breeding progress can be greatly improved. After several generations of selection, the frequency of favorable alleles in the population will gradually increase, thereby improving the growth rate and chest circumference traits of the beef cattle population as a whole. The technology described in the present application provides a beneficial supplement and support means for traditional breeding.
[0082] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. Application of products containing SNP molecular marker genotypes in identifying chest circumference of beef cattle or selecting for large-chest-circumference beef cattle; wherein the SNP molecular marker contains an SNP locus; the SNP locus is located on chromosome 8 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 94541673, and exhibits C / T polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y is C or T; beef cattle with the SNP molecular marker genotype TT or CT have a larger chest circumference than beef cattle with the genotype CC; the beef cattle are Angus cattle.
2. The application according to claim 1, characterized in that, The product includes primer pairs or a kit; the primer pair consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; The kit includes the primer pair and Nco I restriction endonuclease.
3. The application according to claim 2, characterized in that, The kit also includes one or more of the following reagents: buffer, dNTP mixture, and DNA polymerase required for PCR reaction.
4. A method for determining the chest circumference of beef cattle, characterized in that, Includes the following steps: Using the genomic DNA of the cattle to be tested as a template, PCR amplification was performed using primer pairs to obtain amplification products; the primer pairs consist of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; The amplified product was digested with Nco I restriction endonuclease, and the results were used for identification. If the digested product was a single band, the genotype of the SNP molecular marker in the beef cattle to be tested was CC. If the enzyme digestion product shows two bands, then the genotype of the SNP molecular marker in the beef cattle being tested is TT; If the enzyme digestion product shows three bands, then the genotype of the SNP molecular marker in the beef cattle to be tested is CT; The SNP molecular marker contains an SNP site; the SNP site is located on chromosome 8 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 94541673, and exhibits C / T polymorphism; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y represents C or T; The beef cattle with the SNP molecular marker genotype TT or CT have a larger chest circumference than beef cattle with the genotype CC; the beef cattle are Angus cattle.
5. A method for breeding beef cattle with high breast girth, characterized in that, include: The method described in claim 4 is used to detect the genotype of SNP molecular markers in the beef cattle to be tested. Beef cattle with genotypes TT and / or CT are retained for breeding, and beef cattle with genotypes TT or CT are selected from the offspring. The SNP molecular marker contains an SNP locus. The SNP locus is located on chromosome 8 of the bovine reference genome GCF_002263795.2_Bos_taurus.ARS-UCD1.3, at position 94541673, and exhibits C / T polymorphism. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where Y is C or T. The beef cattle are Angus cattle.
Citation Information
Patent Citations
A beef cattle promoter breeding chip and its application
CN118853911B