Lactose oxidase mutant with improved enzyme activity and use in the production of lactobionic acid
By optimizing the codons of Pseudomonas lactose oxidase and performing error-prone PCR mutations, a highly efficient lactose oxidase mutant was screened, solving the problem of low catalytic efficiency of existing lactose oxidases and realizing the efficient and green industrial production of lactobionic acid.
Patent Information
- Application Number
- CN202511616209.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2045-11-06
AI Technical Summary
Existing lactose oxidases have low enzyme activity, limited catalytic efficiency, and insufficient stability, making it difficult to meet the high-throughput and continuous production requirements of industrial production.
A library of lactose oxidase mutants was constructed by codon optimization and error-prone PCR random mutation of lactose oxidase from Pseudomonas spp., and mutants with significantly improved catalytic performance were screened in Escherichia coli. High-efficiency expression was achieved using recombinant plasmids and expression vectors.
It significantly improves the catalytic conversion rate and stability of lactose oxidase, achieving efficient oxidative conversion of lactose to lactobionic acid. The reaction conditions are mild, green and environmentally friendly, and suitable for industrial production.
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a lactose oxidase mutant with improved enzyme activity and application thereof. BACKGROUND
[0002] Lactobionic acid (LBA) is a polyhydroxy organic acid formed by ether linkage of galactose and gluconic acid, also known as the third generation of fruit acid. Due to its unique chemical structure and excellent biological function, lactobionic acid has significant moisturizing, hygroscopic, film-forming, antioxidant and wound healing promoting properties. Therefore, lactobionic acid has wide application value in food, medicine, cosmetics and chemical industries. In the food industry, lactobionic acid can be used as a water-retaining agent, antioxidant or nutritional enhancer; in the pharmaceutical field, lactobionic acid and its derivatives can be used as drug carriers or intermediates for the preparation of antibacterial drugs, anticancer drugs and wound repair preparations; in the cosmetics industry, lactobionic acid can be used as a functional ingredient for moisturizing, anti-aging and promoting skin barrier repair.
[0003] At present, the preparation methods of lactobionic acid mainly include chemical method, enzymatic method and microbial method. The chemical method usually relies on high temperature, high pressure and metal catalysts (such as platinum, copper, etc.) to oxidize and convert lactose. This method has the following significant disadvantages: harsh reaction conditions, high energy consumption; the metal catalyst used is expensive and easy to be passivated; by-products are easily produced during the reaction, reducing the purity of the product; chemical reagents have potential toxicity and have a great impact on the environment and operation safety; in addition, the product post-treatment is complex and needs multiple steps of purification to obtain high-purity lactobionic acid. Therefore, the chemical method faces significant cost and environmental challenges in industrial production. Compared with the chemical method, the microbial fermentation method and the biological conversion method have the advantages of mild conditions, high selectivity, single product and environmental protection. The microbial method is a method of using natural or recombinant microbial cells to directly catalyze lactose to generate lactobionic acid. Its advantages are: wide substrate source, low cost; mild reaction, environmentally friendly; the performance of microorganisms can be optimized by genetic engineering technology to improve enzyme activity and yield. However, current research is mostly in the laboratory stage, and there are still many limitations in industrial application. The main technical bottlenecks include: the natural lactose oxidase activity of microorganisms is low; the inhibition of substrates lactose and products lactobionic acid affects the reaction rate and yield; the tolerance of high-concentration lactose is insufficient, which limits the production scale of lactobionic acid; the difficulty in regenerating cofactors in the enzyme catalytic system affects the continuous production efficiency.
[0004] The preparation of lactobionic acid by bioconversion mainly relies on the catalysis of specific enzymes. Lactose-oxidizing enzyme (LOE) as a key enzyme can catalyze the oxidation of specific hydroxyl group of lactose to generate lactobionic acid. In this process, enzymes as biological catalysts exhibit high selectivity and catalytic efficiency, and can realize the conversion of lactose to lactobionic acid under mild conditions, avoiding the environmental and safety problems caused by high temperature, high pressure and toxic metal catalysts in chemical methods. Due to the advantages of green environmental protection, high product purity and easy separation, bioconversion has been widely concerned in recent years and gradually become a research hotspot for the preparation of lactobionic acid. In the biological catalytic system, pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) as an important lactose-oxidizing enzyme plays a core role, and its ability to catalyze lactose to generate lactobionic acid is the key to realize efficient biological production. However, the lactose-oxidizing enzymes reported so far are mostly wild type, which have low enzyme activity, limited catalytic efficiency and insufficient stability, and are difficult to meet the requirements of high throughput, high efficiency and continuous production in industrial production. Therefore, it is urgent to optimize lactose-oxidizing enzymes by means of directed evolution, rational design or protein engineering, so as to significantly improve their catalytic performance, and realize the efficient, green and sustainable production of lactobionic acid, thereby providing a reliable technical basis for industrial application. SUMMARY
[0005] Based on the above needs, the primary purpose of the present application is to provide a lactose-oxidizing enzyme mutant with enhanced catalytic activity, which can improve the biological catalytic efficiency of lactose to lactobionic acid and its derivatives, thereby promoting the efficient synthesis of high-value metabolites such as lactobionic acid.
[0006] The present application adopts the following technical solutions: first, a wild-type lactose oxidase gene from Pseudomonas is used as a template, and the gene is codon-optimized according to its amino acid sequence (completed by Nanjing Kingsray Company), and an optimized lactose oxidase gene is obtained through whole gene synthesis technology, and is cloned into a NdeI / XhoI restriction endonuclease site of a prokaryotic expression vector pET21b to construct a recombinant plasmid pET21b-LOE (the lactose oxidase gene sequence is shown as SEQ ID NO. 1). On this basis, an error-prone PCR (Error-prone PCR) random mutation technology is used to mutate the lactose oxidase gene, and a Pseudomonas lactose oxidase mutant library (LOEmut) is constructed. Subsequently, a classic enzyme digestion-ligation strategy is used to subclone the mutant product into the NdeI / XhoI site of the pET21b expression vector to obtain a recombinant plasmid library containing the lactose oxidase mutant gene. The obtained plasmid library is transformed into an Escherichia coli BL21 (DE3) expression host, and a mutant with significantly improved enzyme activity is screened through a combination of 96-well plate high-throughput primary screening and shake flask rescreening, so that the catalytic performance of the lactose oxidase is optimized.
[0007] The present application provides a lactose oxidase mutant derived from Pseudomonas, wherein, compared with the wild-type lactose oxidase amino acid sequence (shown as SEQ ID NO. 2), the amino acid at position 312 is mutated from phenylalanine (F) to tyrosine (Y).
[0008] The present application further provides a coding gene of the mutant, which is a nucleotide sequence obtained through point mutation based on the nucleotide sequence shown in SEQ ID NO. 1.
[0009] In addition, the present application also provides a recombinant expression vector containing the mutant coding gene. In a specific embodiment, a commercial prokaryotic expression vector pET21b is selected, and the plasmid contains a T7 strong promoter related sequence, including an operator lacO and a conservative ribosome binding site (RBS), which can promote the repressor protein to leave the operator sequence when an inducer (such as IPTG or lactose) is added, so as to start the expression of the target gene. In a preferred embodiment, the prokaryotic expression vector includes but is not limited to pET21b.
[0010] The present application also provides a host cell containing the expression vector, preferably a prokaryotic microorganism, including but not limited to Escherichia coli, and can also be Corynebacterium glutamicum or other host strains with high-efficiency expression of heterologous proteins. By introducing the mutant coding gene into the host cell, high-efficiency expression and catalytic performance enhancement of the lactose oxidase can be realized.
[0011] The present application also provides the use of the lactose oxidase mutant, the coding gene thereof, the recombinant vector comprising the gene and the host bacteria in catalyzing the synthesis of lactobionic acid or its derivatives. Specifically, lactose or lactose-containing whey powder is used as the reaction substrate, and in the presence of pyrroloquinoline quinone (PQQ) coenzyme, the mutant is used to catalyze the generation of lactobionic acid, so as to realize the efficient oxidative conversion of lactose. Compared with the wild-type enzyme, the mutant exhibits higher catalytic conversion rate, better substrate conversion capacity and more stable catalytic performance in the whole aqueous phase reaction system. The mutant is used as a catalyst in the form of pure enzyme, crude enzyme liquid or whole cell of the recombinant bacteria expressing the amine mutant.
[0012] The present application also provides a method for producing lactobionic acid, which comprises the following steps: lactose or lactose-containing whey powder is used as the reaction substrate, and in the presence of pyrroloquinoline quinone coenzyme, the mutant is added as a catalyst to form a reaction system, and a catalytic reaction is performed to generate lactobionic acid; the mutant is used as a catalyst in the form of pure enzyme, crude enzyme liquid or whole cell of the recombinant bacteria expressing the amine mutant.
[0013] The present application has the following beneficial effects: by molecular evolution and directional mutation screening of lactose oxidase from Pseudomonas, a lactose oxidase mutant with significantly improved catalytic performance is obtained. The mutant can efficiently catalyze the generation of lactobionic acid from lactose in the whole aqueous phase system, and has the advantages of mild reaction conditions, high atom economy, green and environmentally friendly process, no by-product generation, high catalytic efficiency and substrate conversion rate, which provides a new type of efficient and sustainable biological catalyst for the biosynthesis of lactobionic acid, and has good industrial application prospect. DETAILED DESCRIPTION
[0014] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in combination with specific examples, but should not be understood as limiting the present application. Unless otherwise specified, the experimental methods used in the examples are conventional methods known to those skilled in the art. Unless otherwise specified, the materials, reagents and the like used in the following examples can be obtained from commercial channels.
[0015] Example 1: Screening and identification of lactose oxidase mutant
[0016] Pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) is a quinoprotein dehydrogenase that uses PQQ as a coenzyme. Its substrate spectrum is not limited to glucose, but also includes lactose, maltose, xylose, arabinose, and some polyols. This enzyme uses PQQ as a non-covalently bound coenzyme to catalyze the dehydrogenation of various aldehyde sugars and alcohol compounds to produce the corresponding carboxylic acid or ketone products. It has multiple functions in bacterial metabolism, including energy metabolism regulation, exometabolic oxidation, and electron transport. Its unique PQQ coenzyme-dependent mechanism endows it with efficient, stable, and recyclable oxidation catalytic ability. PQQ-dependent glucose dehydrogenase is widely distributed in various gram-negative bacteria, especially in Pseudomonas and Gluconobacter, which are active in exometabolism. Since PQQ-dependent glucose dehydrogenase from Pseudomonas usually has high dehydrogenation catalytic activity on lactose, it is also called lactose oxidase.
[0017] In this example, we used wild-type PQQ-dependent glucose dehydrogenase encoding gene from Pseudomonas as a template, which was codon-optimized by Nanjing Jinssri Company, obtained by whole gene synthesis technology, and cloned into pET21b expression vector to obtain the corresponding recombinant plasmid, named pET21b-LOE (the gene sequence is shown in SEQ ID NO. 1). Subsequently, using error-prone PCR random mutation method, using LOE-For (5'-TCGACATATGagcacggaaggtgctttcagt-3', SEQ ID NO: 3) and LOR-Rev (5'-CTAGCTCGAGttccgccagcttaaaagccatc-3', SEQ ID NO: 4) primer pair, and pET21b-LOE recombinant plasmid as template, the Pseudomonas lactose oxidase encoding gene LOEm mutant library was amplified, and the traditional enzyme digestion and ligation construction strategy was used to subclone it into the NdeI / XhoI site of the pET21b expression vector, to obtain a recombinant plasmid library containing Pseudomonas lactose oxidase mutant encoding genes.
[0018] The error-prone PCR system used in the present application is: 5 μL 10 × EasyTaq buffer, 0.2 μM upstream primer P1, 0.2 μM upstream primer P2, 200 μM dNTPs, 0.8 mM MnCl2, 6 mM MgSO4, 50 ng template DNA, 1 μL EasyTaq DNA polymerase, and sterile water to make up to 50 μL system. The PCR reaction program is: 95℃ pre-denaturation 3 min; 95℃ denaturation 30 s; 58℃ annealing 30 s; 72℃ extension 2 min, 35 cycles; 72℃ extension 5 min, 4℃ storage.
[0019] In view of the fact that the lactose oxidase from Pseudomonas can catalyze the conversion of lactose to generate lactobionic acid, the present application establishes a high-throughput screening method based on the pH change of the system caused by product generation. The enzyme activity can be evaluated by indirect determination of color indicator or substrate consumption. On the one hand, the generation of lactobionic acid will reduce the pH of the reaction system, and the rapid detection of color change can be achieved by adding phenolphthalein indicator to the culture solution; on the other hand, the degree of substrate lactose consumption can be quantitatively determined by using the classic 3,5-dinitrosalicylic acid (DNS) method to evaluate the catalytic activity of lactose oxidase. In a specific embodiment, the recombinant plasmid library containing the Pseudomonas lactose oxidase coding gene is constructed, which is introduced into the E. coli BL21(DE3) host strain by heat shock method or electroporation method, cultured in LB medium containing suitable resistance screening markers overnight, and the colonies are collected for high-throughput primary screening.
[0020] In one specific embodiment, after the obtained strain is cloned and picked, it is inoculated into 2 mL LB medium containing 50 g / L lactose and 100 μM PQQ in a 96-deep well plate, and an appropriate amount of inducer (such as IPTG) is added to each well to induce the expression of lactose oxidase. The culture conditions are set as 37 ℃, 220 r / min shaking culture for 24 hours. After the culture is completed, phenolphthalein indicator is added to each well, or the culture solution is treated by the DNS method, and the color change or the degree of substrate lactose consumption is determined by colorimetry with an enzyme marker, so as to preliminarily evaluate the lactose oxidase activity of the strain, and thus to screen candidate mutant strains with activity significantly higher than that of the empty vector control. The high-activity candidate strains obtained by preliminary screening are further subjected to shake flask rescreening in 100 mL LB liquid medium, and the culture conditions are set as 30 ℃, 220 r / min shaking culture for 16-20 hours. After the rescreening is completed, the bacterial solution is collected and the lactobionic acid yield or lactose consumption rate is quantitatively analyzed by the phenolphthalein colorimetric method or the DNS method, so as to verify and confirm the enzyme activity of the candidate strain. Through rescreening, the optimal mutant with significantly improved enzyme activity is finally obtained, and its gene sequence is verified by Sanger sequencing, which shows that the gene sequence has a point mutation at the 312th amino acid, and phenylalanine (F) is replaced by tyrosine (Y), so the mutant is named as LOE-F312Y, and the plasmid containing the mutant is named as pET21b-LOE-F312Y.
[0021] The nucleotide sequence of the wild-type lactose oxidase is as follows (SEQ ID NO. 1):
[0022] ATGAGCACGGAAGGTGCTTTCAGTCGTTCCCGCCTGCTTCCATCACTCTTGGGCATTCTCTTACTTCTTATGGGACTCGCCATGCTCGCAGGAGGAATCAAGCTGGTCACCCTTGGCGGGTCCTGGTACTACCTGCTAGCCGGAATCGGCTTCGGTTTGTCCGGCGCCTTGCTCATTGCAGGCCGTCGGGCGGCGTTGGCACTCTACGCATTGACATTATTTGCCTCGACCGTCTGGGCACTCATGGAAGTTGGTCTCGATTGGTGGCAATTAGTTCCACGTTTGGCAATGTGGTTCGCCATTGGTATTGTTCTGCTACTTCCGTGGTTTCGACGCCCCGTTCTACGCGGACAGTCCGCGCCATTGGCAACCGGCGCTTTGTCCGTGGCTGTAGTGCTTGCGGGTGCCGCCGCTCTGGCAAGCCAGTTTACCTCTCCTGGCGAAATCAAAGGCCAGCTGGACCGTGACGCTGTGCCTGGCATGACTAATGCAGCGCCCGCAATGCCAGATGGTGATTGGCAATCATACGGCCGAACTGCGTTTGGTGACCGCTATTCACCGTTGAAGGAAATCACTCCTGAAAATGCTCACAAGCTGGTACCAGCCTGGACCTTCAGGACCGGTGATATGCCTGGTGAGGGCGATCCGGGTGAGACAACAGCGGAGAACACCCCACTGAAGGTCAACGGCATGCTTTACGTGTGCACCCCGCATTCACAGGTGATCGCACTTGATCCTGACACCGGCAAAGAAATCTGGCGTTACGATCCAAAGATCTCAACCCAAAACGCCGAGAATTTCAAAGGTTGGGCGCACATGACCTGCCGCGGCGTGACGTACCACGATGAAAACGCCTACGCAAAGGCGAGCACCGAGCAGTCTGCCGCAGAGCCAGCTGCAGCCACGTCTTCCAATTCATGCCCACGGCGTCTA TTC
[0023] The amino acid sequence of the wild-type lactose oxidase is as follows (SEQ ID NO. 2):
[0024] MSTEGAFSRSRLLPSLLGILLLLMGLAMLAGGIKLVTLGGSWYYLLAGIGFGLSGALLIAGRRAALALYALTLFASTVWALMEVGLDWWQLVPRLAMWFAIGIVLLLPWFRRPVLRGQSAPLATGALSVAVVLAGAAALASQFTSPGEIKGQLDRDAVPGMTNAAPAMPDGDWQSYGRTAFGDRYSPLKEITPENAHKLVPAWTFRTGDMPGEGDPGETTAENTPLKVNGMLYVCTPHSQVIALDPDTGKEIWRYDPKISTQNAENFKGWAHMTCRGVTYHDENAYAKASTEQSAAEPAAATSSNSCPRRL F LPTADTRLIALNADTGKPCEDFGDHGSVDLRHNIGSFAPGGYYSTSPPAVTKDLVVIGGHVTDNISNDEPSGVIRAYDVRTGKLVWNWDSGNPEKTTPIAEGETYTRNSPNMWSMFAVDEDLGMLYLPMGNQTPDQFGGDRTEDSERYAAGITALDINTGKVRWYRPLTHHDLWDMDVGGQPTLMDLKTADGVKPALLASTKQGSIYVMDRRTGEAIVPITEIPAPGGAVEGDHTAPTQPRSDLNMIPPVLTERDMWGVTPFDQMLCRINFKSLRYDGMYTPPSLQGSIVYPGNFGVFDWGGISVDPVRQIAFLNPSYMAFTSKLVPQADVAAMGPRKGETSGVQPNKGAPYGVILEPLLSPLGLPCQAPAWGYVAAVDLTNNEVIWKHKNGTVRDSSPVPIPLSMGVPSLGGTFTTAGGVAFLSGTLDQYLRAYDVSNGKVLWEGRLPAGGQTTPMTYTGKDGTQYVLVMAGGHGGLGTKKGDYVMAFKLAE*.
[0025] Example 2 Activity determination of lactose oxidase mutant LOE-F312Y
[0026] The recombinant strain E. coli BL21 (pET21b-LOE-F312Y) containing the lactose oxidase mutant constructed in Example 1 and the control strain E. coli BL21 (pET21b-LOE) expressing unmutated lactose oxidase were inoculated into 4 mL of LB liquid medium containing 100 μg / mL ampicillin, and cultured at 37°C, 200 rpm overnight. The next day, 1% (v / v) of the seed liquid was inoculated into fresh LB medium, and the culture was continued under the same conditions until the bacterial density (OD 600 ) reached about 0.6. Then, IPTG was added to the culture system to a final concentration of 0.4 mM to induce expression, and the culture temperature was lowered to 16°C, and the induction culture was continued at 200 rpm for 24 h to achieve efficient expression of lactose oxidase and its mutants. After the induction expression was completed, the bacterial cells obtained by culture were removed by centrifugation, and the bacterial cell pellet was resuspended with 10 mL of pre-cooled lysis buffer (20 mM Na2HPO4, 200 mM NaCl, pH 7.5). Then, the cells were lysed using an ultrasonic cell disruptor, with a power of 200 W, ultrasonic for 2 seconds, intermittent for 1 second, and cycle processing for 10 minutes. After disruption, the supernatant was collected by centrifugation at 8000 × g for 10 minutes using a high-speed refrigerated centrifuge, and used as crude enzyme solution for subsequent enzyme activity determination.
[0027] According to the catalytic properties of Pseudomonas lactose oxidase, it can catalyze the conversion of lactose to produce lactobionic acid, so the consumption of lactose substrate is used as an evaluation index of enzyme activity. The enzyme activity determination system is prepared as follows: 1 mL of citric acid-sodium phosphate buffer (pH 6.5), 10 g / L lactose, 50 μM PQQ, 10 μL of crude enzyme solution. The reaction system is incubated at 30°C for 30 min, and the consumption of lactose substrate in the catalytic system is determined by DNS method. During the determination process, parallel controls with blank control and wild-type lactose oxidase are performed to ensure the reliability and repeatability of the experimental results.
[0028] The results show that, in the E. coli recombinant expression system, compared with the wild-type lactose oxidase activity (0.47 U / mg), the LOE-F312Y mutant shows significantly enhanced catalytic performance, with an increase of about 1.8 times in enzyme activity (0.85 U / mg), which indicates that the lactose oxidase mutant obtained by high-throughput screening can significantly improve the substrate conversion efficiency, and provides an efficient and implementable enzyme resource for industrial lactobionic acid production.
[0029] Example 3 Application of lactose oxidase mutant in production of lactobionic acid
[0030] The embodiment provides a lactobionic acid production process based on a whole cell transformation method, utilizes bulk chemical raw materials such as lactose, and under the synergistic action of PQQ cofactor, efficiently synthesizes lactobionic acid through lactose oxidase mutant catalysis. In a preferred specific embodiment, a commercialized shuttle expression vector pXMJ19 is selected, and an expression host bacterium is preferably Escherichia coli. In order to realize efficient expression of the lactose oxidase mutant LOE-F312Y, the one-step seamless cloning technology (ClonExpress II One Step Cloning Kit, Vazyme Biotech, China) is adopted, the lactose oxidase mutant gene LOE-F312Y is subcloned into the pXMJ19 skeleton through molecular assembly, the pXMJ19-LOE-F312Y recombinant plasmid is obtained, and the recombinant plasmid is transformed into the Escherichia coli Top10 strain. After resistance screening, the engineering strain expressing the lactose oxidase mutant is obtained, which can efficiently catalyze the production of lactobionic acid.
[0031] Specifically, the Escherichia coli recombinant strain containing the lactose oxidase mutant plasmid pXMJ19-LOE-F312Y is inoculated into a seed culture medium containing chloramphenicol, the culture condition is set to 32 DEG C, 200 r / min, and the seed liquid is obtained after 16-20 hours of shaking culture. Then, the seed liquid is inoculated into a 3 L fermenter at a inoculation amount of 5%-10%, the culture temperature is set to 32 DEG C, the stirring speed is set to 300-500 r / min, and the pH value of the culture solution is maintained at neutral. During the fermentation process, when the dissolved oxygen concentration is reduced to below 30%, the stirring-dissolved oxygen combined control system is started to ensure sufficient dissolved oxygen supply. When the cell concentration (OD 600 ) reaches 20-40, 0.4-0.6 mM IPTG is added for induction expression, and the culture temperature is lowered to below 25 DEG C, and the induction culture is continued for more than 20 hours under the condition of neutral pH.
[0032] After enzyme induction culture, the bacterial liquid is centrifuged at 8000xg for 10 minutes, the bacterial cells are collected, and the supernatant is removed to obtain the bacterial slurry of the lactose oxidase mutant recombinant strain. The components of the seed culture medium are: yeast powder 2.5 g / L, peptone 5 g / L, NaCl 5 g / L; the components of the fermentation medium are: glucose 100 g / L, corn syrup 20 g / L, molasses 20 g / L, yeast powder 1.0 g / L, ammonium sulfate 10 g / L, magnesium sulfate 1 g / L, potassium dihydrogen phosphate 0.5 g / L, dipotassium hydrogen phosphate 0.5 g / L, sodium citrate 1 g / L, and the medium is adjusted to pH 7.0.
[0033] In a specific embodiment of lactobionic acid production, a whole-cell catalytic reaction system is established in a fermenter, and 180 g / L of lactose substrate is added to the reaction system, and 20 g / L of E. coli whole-cell catalyst induced to express lactose oxidase mutant LOE-F312Y is added. At the same time, in order to maintain the pH stability of the reaction system, 50 g / L of calcium carbonate is added to the system as a buffer to neutralize the organic acid produced in the reaction process, so as to ensure that the catalytic process continues under near neutral conditions. The stirring speed of the reaction system is set to 300-500 r / min, the dissolved oxygen concentration is controlled between 10% and 30%, the catalytic reaction temperature is controlled between 30 and 37℃, and the reaction time is 30-50 hours. After the reaction is completed, the composition of the reaction liquid is quantitatively analyzed by liquid chromatography. The liquid chromatography analysis results show that in the whole-cell catalytic liquid using lactose oxidase mutant LOE-F312Y, the lactobionic acid yield reaches 186.9 g / L after 32 hours, and the lactose substrate is almost completely converted, with a conversion rate of more than 99%. In contrast, in the reaction system catalyzed by unmutated lactose oxidase, there is still significant residual lactose substrate at the same time, indicating that the LOE-F312Y mutant has significant advantages in catalytic efficiency, product generation rate and conversion rate.
[0034] Through this process, the lactose oxidase mutant of the present application can effectively improve the production efficiency of lactobionic acid, simplify the process flow, and has important significance for the industrial production of lactobionic acid, and shows a wide industrial application prospect.
[0035] The above-described content is only the preferred embodiments of the present application, which aims to illustrate the technical solutions of the present application, but not to limit the protection scope of the present application. On the premise of not deviating from the core technical idea of the present application, those skilled in the art can make appropriate adjustments, changes or equivalent replacements based on the specification and claims of the present application, and all technical improvements, equivalent schemes and modifications within the scope defined by the claims of the present application shall be regarded as the protection scope of the present application. In addition, the technical content not described in the present application, if it is the routine technical means of those skilled in the art, is also regarded as a part of the present application.
Claims
1. A mutant lactose oxidase enzyme having increased activity, characterized in that: On the basis of the wild-type lactose oxidase amino acid sequence shown in SEQ ID NO. 2, only the mutation of the 312th amino acid from phenylalanine to tyrosine.
2. The coding gene of the mutant according to claim 1.
3. A recombinant expression vector, characterized in that, The coding gene according to claim 2.
4. The recombinant expression vector of claim 3, wherein, The recombinant expression vector is suitable for expression in prokaryotes selected from Escherichia coli or Corynebacterium glutamicum.
5. The recombinant expression vector of claim 4, wherein, The recombinant expression vector is pET21b or pXMJ19 vector.
6. A recombinant bacterium, characterized in that, The recombinant expression vector is pET21b or pXMJ19 vector.
7. The recombinant bacteria of claim 6, wherein The recombinant expression vector is pET21b or pXMJ19 vector.
8. The mutant according to claim 1, the coding gene according to claim 2, the recombinant expression vector according to any one of claims 3 to 5, or the recombinant bacteria according to claim 6 or 7 for use in catalyzing synthesis of lactobionic acid.
9. Use according to claim 8, wherein the compound is ###0002### The mutant catalyzes the production of lactobionic acid from lactose or lactose-containing whey powder in the presence of pyrroloquinoline quinone coenzyme; the pure enzyme, crude enzyme liquid produced by the recombinant bacteria according to claim 6 or 7, or the whole cells of the recombinant bacteria according to claim 6 or 7 are used as catalysts.
10. A method for producing lactobionic acid, characterized by, The method comprises the following steps: using lactose or lactose-containing whey powder as the reaction substrate, adding catalysts as catalysts to form a reaction system in the presence of pyrroloquinoline quinone coenzyme, and performing catalytic reaction to produce lactobionic acid; the catalysts are the pure enzyme, crude enzyme liquid produced by the recombinant bacteria according to claim 6 or 7, or the whole cells of the recombinant bacteria according to claim 6 or 7.
Citation Information
Patent Citations
Glucose quinic acid shikimic acid family PQQ-dependent membrane-bound dehydrogenase as well as coding gene and application thereof
CN115322976A
Method for producing galactobionic acid and lactobionic acid through two-stage catalysis by taking whey as substrate
CN115786409A