Small nucleic acid targeting androgen receptor as well as pharmaceutical composition and application thereof

Abstract

The invention discloses a small nucleic acid targeting androgen receptor AR, provides various modification methods, enhances sequence stability after modification, effectively knocks down AR mRNA, has a remarkable curative effect, and can be used together with various delivery prescriptions. The small nucleic acid provided by the invention can be efficiently delivered to a target spot through lipid nanoparticles, and also can be effectively delivered to cells without other delivery carriers by coupling an alkyl chain structure in a sequence. The small nucleic acid and the preparation method thereof provided by the invention can be used as a technical means for treating diseases caused by abnormal androgen expression or treating diseases related to androgen receptors, and the indications of the small nucleic acid include but are not limited to androgenetic alopecia, alopecia areata, neuropathic alopecia, scar alopecia, diffuse alopecia, acne and the like.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically, it relates to small nucleic acids targeting androgen receptors, their pharmaceutical compositions, and their uses. Background Technology

[0002] Androgenetic alopecia (AGA) is a progressive hair loss disorder that begins in or after puberty, characterized by the miniaturization of hair follicles. AGA is a polygenic recessive genetic disorder with a genetic predisposition.

[0003] Current research indicates that androgens play a decisive role in the pathogenesis of AGA (aerotic alopecia). Other factors, including perifollicular inflammation, increased life stress, tension and anxiety, and unhealthy lifestyle and dietary habits, can all exacerbate AGA symptoms. Although androgens are a key factor in the development of AGA, almost all AGA patients maintain normal circulating androgen levels. Studies have shown that increased expression of the androgen receptor gene (AR) or type II 5α-reductase gene in the hair follicles of the bald area leads to increased androgen action on susceptible hair follicles. In AGA, the dermal cells of susceptible hair follicles contain specific type II 5α-reductases that catalyze the conversion of testosterone circulating in the blood to dihydrotestosterone (DHT). DHT binds to androgen receptors within the cells, triggering a series of reactions that lead to progressive miniaturization of the hair follicle and hair loss, ultimately resulting in baldness.

[0004] The main treatment methods for AGA include systemic drug therapy and topical therapy. Common systemic drugs include finasteride and spironolactone, while common topical drugs include minoxidil. Both medications require daily administration, and patient adherence still needs improvement.

[0005] The androgen receptor (AR) is a popular target in current drug research for hair loss, and many studies have reported on RNA therapies targeting AR. However, these studies still have some limitations. For example, patent CN118726351A discloses an effective small interfering RNA and its product, but this patent only presents in vitro experimental results for the small interfering RNA and lacks in vivo experimental data. Patent CN118421625A discloses an antisense oligonucleotide and an androgen receptor inhibitor and their uses, but only discloses in vitro experimental results and does not present in vivo experimental results. Therefore, effective RNA therapies targeting AR still need to be developed. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a siRNA targeting AR, and a corresponding siRNA containing modifications, which can effectively reduce the expression level of AR mRNA, thereby being used to treat diseases caused by abnormal androgen expression or diseases related to androgen receptors.

[0007] In one aspect, the present invention provides a small nucleic acid targeting the androgen receptor, wherein the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 2; the small nucleic acid targeting the androgen receptor comprises one or more modifications; the sequence of the sense strand is t*t*AmUmUm(C16-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0008] Where u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, and t represents thymine deoxynucleotide. The symbol represents pseudouridine monophosphate, m represents 2'-O-methyl modification, and Cm-CH3 represents cytosine nucleotides containing 2'-O-methyl and 5-methyl modifications. The symbol represents pseudouridine monophosphate with 2'-O-methyl and N1-methyl modifications, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents ethylene glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, * represents thiolation modification of a non-bridging oxygen atom of the α-phosphate group of nucleotide, and C16- represents 2'-O-hexadecyl modification.

[0009] In another aspect, the present invention provides a method for preparing small nucleic acids targeting androgen receptors as described in any embodiment herein.

[0010] Preferably, the method for preparing small nucleic acids targeting androgen receptors is the phosphoramidite method.

[0011] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent, or excipient.

[0012] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0013] Preferably, the carrier is a lipid nanoparticle.

[0014] In one or more embodiments, the lipid nanoparticles are composed of an aqueous phase and an organic phase, wherein the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0015] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1, or 1:1. Even more preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0016] In one or more embodiments, the organic phase comprises cationic lipids, auxiliary lipids, steroids, and PEG-lipids, wherein the molar ratio of cationic lipids, auxiliary lipids, steroids, and PEG-lipids is 40–60:3–20:25–55:0.1–10; the cationic lipids are selected from dilinyl methacrylate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-diolenoyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleoyloxypropylammonium bromide (DTOPA), dimethyl-2,3-diolenoyloxypropyl-2-(2-sperminecarbamoylamino)ethylammonium trifluoroacetate (DOSPA), dioleoylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, and 98N. 12-5, FTT5, Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate)(SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)(ALC-0315), bis((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butyryl)oxy)heptadecanedioate(Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylureo)nonadecanoate(OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonoxy)8-oxooctyl)amino)octanoate heptadecan-9-yl ester)(Lipid5), Lipid A6, YSK12-C4, and CL4H6 are selected from one or more of the following: the auxiliary lipid is selected from one or more of the following: 1,2-distearyl-sn-glycerol-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from phytosterols or cholesterol; the PEG-lipid is selected from one or more of the following: 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearylphosphatidylethanolamine (PEG2000-DSPE), distearyl-rac-glycerol-polyethylene glycol 2000 (DSG-PEG 2000), and methoxy polyethylene glycol bis(tetradecylacetamide) (ALC-0159).

[0017] Preferably, the molar ratio of cationic lipids, auxiliary lipids, steroids and PEG-lipids is 40-55:9-12:35-41:1-2.

[0018] Preferably, the aqueous phase is an acetate-sodium acetate buffer or a citrate-sodium citrate buffer. More preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 3.0–5.0. More preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 3.0–5.0. Even more preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 4.0–5.0. Even more preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 4.0–5.0. Even more preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 4.5. Even more preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 4.5.

[0019] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any embodiment herein, the method comprising adding to a solvent a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent, or excipient.

[0020] Preferably, the method is an ethanol injection method.

[0021] In another aspect, the present invention provides the use of small nucleic acid or pharmaceutical compositions targeting androgen receptors as described in any embodiment herein in the preparation of medicaments for treating diseases related to abnormal androgen expression.

[0022] Preferably, the disease associated with abnormal androgen expression is selected from androgenetic alopecia, alopecia areata, neurogenic alopecia, cicatricial alopecia, diffuse alopecia, or acne. More preferably, the disease associated with abnormal androgen expression is androgenetic alopecia.

[0023] In another aspect, the present invention provides a small nucleic acid that targets the androgen receptor, wherein the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 1 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 2;

[0024] The small nucleic acid targeting the androgen receptor contains one or more modifications; each modification is independently located on any nucleotide of the sense or antisense strand; each modification is independently selected from thymine deoxynucleotide substitution, pseudouridine substitution, 2'-O-methyl modification, 2'-O-methyl and 5-methyl modification, 2'-O-methyl and N1-methyl pseudouridine substitution, 2'-O-methoxyethyl modification, 2'-fluorine modification, locked nucleic acid modification, ethylene glycol nucleic acid modification, 5'-phosphorylation modification, 2'-O-Cn alkyl modification, thiomodification, GalNAc modification, globular nucleic acid modification, cholesterol modification, polyethylene glycol modification, cyclodextrin modification, cell-penetrating peptide modification, antibody conjugation, nucleic acid aptamer conjugation, and peptide conjugation.

[0025] In one or more embodiments, the sequence of the sense strand is t*t*AmUmUmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the small nucleic acid targeting the androgen receptor further comprises a 2'-O-Cn alkyl modification, wherein in the Cn alkyl group, n = 16 to 22;

[0026] Where u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, and t represents thymine deoxynucleotide. The symbol represents pseudouridine monophosphate, m represents 2'-O-methyl modification, and Cm-CH3 represents cytosine nucleotides containing 2'-O-methyl and 5-methyl modifications. The symbol represents pseudouridine monophosphate with 2'-O-methyl and N1-methyl modifications, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents ethylene glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, Cn- represents 2'-O-Cn alkyl modification, and * represents thiolation modification of a non-bridging oxygen atom of the α-phosphate group of the nucleotide.

[0027] In one or more embodiments, the sequence of the justice chain is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the sequence of the antisense chain is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um;

[0028] Where u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, and t represents thymine deoxynucleotide. The symbol represents pseudouridine monophosphate, m represents 2'-O-methyl modification, and Cm-CH3 represents cytosine nucleotides containing 2'-O-methyl and 5-methyl modifications. The term represents pseudouridine monophosphate with 2'-O-methyl and N1-methyl modifications, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents ethylene glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, * represents thiomodification of a non-bridging oxygen atom of the α-phosphate group of the nucleotide, and Cn- represents 2'-O-Cn alkyl modification; in the Cn alkyl group, n = 16 to 22.

[0029] Preferably, the Cn alkyl group is a C16-C22 saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a C16-C22 saturated alkyl group. Even more preferably, the Cn alkyl group is a C16-C22 saturated n-alkyl group.

[0030] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is tta*u*u*c*c*a*gu*gga*u*gggc*u*ga, and the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; the nucleotide sequence of the sense strand is... The nucleotide sequence of the antisense strand is (VPu)*uucagccca( -CH3)(Cm-CH3)(Cm-CH3)a(Cm-CH3)( -CH3)gga*a*( -CH3); the nucleotide sequence of the sense strand is tt(Cn-a)uuCLCLaguggaugggCLu*g*a, and the nucleotide sequence of the antisense strand is (VPu)uu(GNA-G)cc(GNA-C)au(GNA-C)ca(GNA-C)ug(GNA-G)aa(Cn-u); the nucleotide sequence of the sense strand is tt*a*u*u*(Cn-c)*c*a*gu*gga*u*gggcuga; and the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; The nucleotide sequence of the sense strand is t*t*auuccaguggaugggcu*g*a, and the nucleotide sequence of the antisense strand is u*Uf*UmCmAmGmCmCfcauccacugga*a*u; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0031] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is tta*u*u*c*c*a*gu*gga*u*gggc*u*ga, and the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; the nucleotide sequence of the sense strand is... The nucleotide sequence of the antisense strand is (VPu)*uucagccca( -CH3)(Cm-CH3)(Cm-CH3)a(Cm-CH3)( -CH3)gga*a*( -CH3); the nucleotide sequence of the sense strand is tt(Cn-a)uuCLCLaguggaugggCLu*g*a, and the nucleotide sequence of the antisense strand is (VPu)uu(GNA-C)a(GNA-G)cc(GNA-C)au(GNA-C)ca(GNA-C)ug(GNA-G)aa(Cn-u); the nucleotide sequence of the sense strand is tt*a*u*u*(Cn-c)*c*a*gu*gga*u*gggcuga; and the nucleotide sequence of the antisense strand is uuucagcccauccacugg aau; the nucleotide sequence of the sense strand is t*t*auuccaguggaugggcu*g*a, and the nucleotide sequence of the antisense strand is u*Uf*UmCmAmGmCmCfcauccacugga*a*u; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0032] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Even more preferably, the Cn alkyl group is a saturated n-alkyl group.

[0033] Preferably, the Cn alkyl group is n-hexadecyl.

[0034] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGm The antisense strand nucleotide sequence is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, with n=18; the sense strand nucleotide sequence is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the antisense strand nucleotide sequence is (VPu)*UfUmCmAmGfCmCfCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, with n=20; the sense strand nucleotide sequence is t*t*AmUmUm(Cn-c)CfAmGfUf The antisense strand has the nucleotide sequence GfGmAmUmGmGmGmCmUm*Gm*Am, where the antisense strand's nucleotide sequence is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, and n is 22. The sense strand's nucleotide sequence is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*(Cn-g)*Am, and the antisense strand's nucleotide sequence is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUf GmGmAm*Am*Um, n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCmAmGf(Cn-u)GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, n is 16; the nucleotide sequence of the sense strand is t*t*(Cn-a)UmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, n is 16;The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*(Cn-u), where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGm(Cn-g)Am*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am; the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCm(Cn-a)CmUfGmGmAm*Am*Um, where n is 16; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUm GmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUm(Cn-c)AmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16.

[0035] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Even more preferably, the Cn alkyl group is a saturated n-alkyl group.

[0036] Preferably, the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, where n = 16, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0037] In another aspect, the present invention provides a method for preparing small nucleic acids that target androgen receptors as described in any of the embodiments herein.

[0038] Preferably, the method for preparing small nucleic acids targeting androgen receptors is the phosphoramidite method.

[0039] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent, or excipient.

[0040] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0041] Preferably, the carrier is a lipid nanoparticle.

[0042] In one or more embodiments, the lipid nanoparticles are composed of an aqueous phase and an organic phase, wherein the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0043] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1, or 1:1. Even more preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0044] In one or more embodiments, the organic phase comprises cationic lipids, auxiliary lipids, steroids, PEG-lipids, and an aqueous phase, wherein the molar ratio of cationic lipids, auxiliary lipids, steroids, and PEG-lipids is 40–60:3–20:25–55:0.1–10; the cationic lipids are selected from dilinyl methacrylate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-diolenoyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleoyloxypropylammonium bromide (DTOPA), dimethyl-2,3-diolenoyloxypropyl-2-(2-sperminecarbamoylamino)ethylammonium trifluoroacetate (DOSPA), dioleoylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, and 98N. 12-5, FTT5, Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate)(SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)(ALC-0315), bis((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butyryl)oxy)heptadecanedioate(Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylureo)nonadecanoate(OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonoxy)8-oxooctyl)amino)octanoate heptadecan-9-yl ester)(Lipid5), Lipid A6, YSK12-C4, and CL4H6 are selected from one or more of the following: the auxiliary lipid is selected from one or more of the following: 1,2-distearyl-sn-glycerol-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from phytosterols or cholesterol; the PEG-lipid is selected from one or more of the following: 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearylphosphatidylethanolamine (PEG2000-DSPE), distearyl-rac-glycerol-polyethylene glycol 2000 (DSG-PEG 2000), and methoxy polyethylene glycol bis(tetradecylacetamide) (ALC-0159).

[0045] Preferably, the molar ratio of cationic lipids, auxiliary lipids, steroids and PEG-lipids is 40-55:9-12:35-41:1-2.

[0046] Preferably, the aqueous phase is an acetate-sodium acetate buffer or a citrate-sodium citrate buffer. More preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 3.0–5.0. More preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 3.0–5.0. Even more preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 4.0–5.0. Even more preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 4.0–5.0. Even more preferably, the aqueous phase is an acetate-sodium acetate buffer with a pH of 4.5. Even more preferably, the aqueous phase is a citrate-sodium citrate buffer with a pH of 4.5.

[0047] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any embodiment herein, the method comprising adding to a solvent a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent, or excipient.

[0048] Preferably, the method is an ethanol injection method.

[0049] In another aspect, the present invention provides the use of small nucleic acid or pharmaceutical compositions targeting androgen receptors as described in any embodiment herein in the preparation of medicaments for treating diseases associated with abnormal androgen expression.

[0050] Preferably, the disease associated with abnormal androgen expression is selected from androgenetic alopecia, alopecia areata, neurogenic alopecia, cicatricial alopecia, diffuse alopecia, or acne. More preferably, the disease associated with abnormal androgen expression is androgenetic alopecia.

[0051] This invention provides siRNA targeting androgen receptors (AR), along with corresponding modified siRNA sequences, which can effectively reduce AR mRNA expression levels. This allows for the treatment of diseases caused by abnormal androgen expression or diseases related to the androgen receptor, including but not limited to androgenetic alopecia, alopecia areata, neurogenic alopecia, scarring alopecia, diffuse alopecia, and acne. This invention provides various siRNA modification methods, resulting in enhanced sequence stability and effective AR mRNA knockdown. The siRNA provided by this invention can be efficiently delivered to the target site via lipid nanoparticles, or through alkyl chain modification to the sequence, enabling efficient delivery into cells without other delivery vectors, as verified in cell experiments. Compared to existing small molecule drugs, the siRNA of this invention has a longer duration of action, reduces the frequency of administration, eliminates the need for daily medication, and effectively improves patient compliance. Attached Figure Description

[0052] Figure 1 This is a graph showing the effect of naked siRNA sequences on the expression level of AR mRNA in cells.

[0053] Figure 2 This is a graph showing the results of serum enzymatic digestion of modified siRNA.

[0054] Figure 3 This is a graph showing the effect of modified siRNA on the expression level of AR mRNA in cells.

[0055] Figure 4 This figure shows the effect of modified siRNAs delivered via different methods on the expression level of AR mRNA in cells.

[0056] Figure 5 This figure shows the effect of siRNAs modified with alkyl chains containing different carbon atoms (Cn) on the expression level of AR mRNA in cells.

[0057] Figure 6 This figure shows the effect of siRNAs modified with alkyl chains Cn at different sites on the expression level of AR mRNA in cells.

[0058] Figure 7 This is a graph showing the effect of modified siRNA on hair growth in male mice.

[0059] Figure 8 This is a graph showing the effects of modified siRNA on various phenotypes of hair growth in male mice. Among them, Figure 8 In the figure, 'a' represents the effect on hair length. Figure 8 Figure 'b' shows the effect of hair shaft diameter on the result. Figure 8 The figure showing 'c' represents the effect of 'on' hair follicle length'. Figure 8 The figure shows the effect of d on hair follicle density. Figure 8 The figure showing the effect of 'e' on hair follicle diameter is a graph. Figure 8 The figure in the image shows the effect of f on the ratio of the number of hair follicles in the growth phase to the number in the resting phase. Figure 8 The figure showing 'g' represents the effect of melanin on the area of ​​the hairball.

[0060] Figure 9 This is a graph showing the effect of modified siRNA on the expression level of AR mRNA in the skin of male mice.

[0061] Figure 10 It refers to the levels of various factors in the serum of male mice affected by modified siRNA.

[0062] Figure 11 This is a graph showing the effect of modified siRNA on hair growth in female mice.

[0063] Figure 12 This is a graph showing the effects of modified siRNA on various phenotypes of hair growth in female mice. Among them, Figure 12 In the figure, 'a' represents the effect on hair length. Figure 12 Figure 'b' shows the effect of hair shaft diameter on the result. Figure 12 The figure showing 'c' represents the effect of 'on' hair follicle length'. Figure 12 The figure shows the effect of d on hair follicle density. Figure 12 The figure showing the effect of 'e' on hair follicle diameter is a graph. Figure 12 The figure in the image shows the effect of f on the ratio of the number of hair follicles in the growth phase to the number in the resting phase. Figure 12 The figure showing 'g' represents the effect of melanin on the area of ​​the hairball.

[0064] Figure 13 This is a graph showing the effect of modified siRNA on the expression level of AR mRNA in the skin of female mice. Detailed Implementation

[0065] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0066] Unless otherwise specified, all reagents used in the following examples are commercially available.

[0067] In this invention, RNA can function as one or more molecules among siRNA, ASO, saRNA, sgRNA, and miRNA to achieve therapeutic effects.

[0068] In this invention, RNA delivery methods include, but are not limited to, self-delivery, GalNAc, lipid nanoparticles, alkyl chains, cholesterol, phosphate groups, phosphate analogs, polyethylene glycol groups, cyclodextrin groups, cell-penetrating peptides, exosomes, antibody conjugation, nucleic acid aptamers, peptide conjugation, spherical nucleic acids (SNA), and DNA nanostructures.

[0069] In this invention, the preparation methods of lipid nanoparticles include, but are not limited to, ethanol injection, microfluidic mixing, thin film hydration, and T-connector mixing.

[0070] In this invention, the preparation method of some buffer solutions is as follows:

[0071] Sodium acetate solution (0.2 mol / L): Weigh 0.272 g of sodium acetate trihydrate and dissolve it in 10 g of water, then mix well.

[0072] Acetic acid solution (0.3 mol / L): Pipette 0.172 g of acetic acid into 9.828 g of water for injection and mix well.

[0073] Acetic acid-sodium acetate buffer (pH 4.5 at room temperature, 0.1368 mol / L): Transfer 2.65 mL of sodium acetate solution (0.2 mol / L) and 7.35 mL of acetic acid solution (0.3 mol / L) into a 50 mL centrifuge tube, add 10 mL of water for injection, mix well, and the pH value is approximately 4.5.

[0074] Citrate-sodium citrate buffer (pH 4.0, 0.01 mol / L): Add 0.114 g citric acid and 0.104 g trisodium citrate to water for injection, and dilute to 100 mL with water for injection and mix well.

[0075] Citrate-sodium citrate buffer (pH 4.5, 0.14 mol / L): Add 1.223 g of citric acid and 1.968 g of trisodium citrate to water for injection, and dilute to 100 mL with water for injection and mix well.

[0076] HEPES dilution buffer (containing 30mM HEPES, 30mM sodium chloride, and 6% sucrose): Weigh 0.715g of HEPES, 0.175g of sodium chloride, and 6.0g of sucrose, add 95.0g of water for injection, mix and dissolve, then adjust the pH to 7.4 with 0.5M sodium hydroxide.

[0077] Example 1: siRNA sequence design and validation

[0078] This embodiment discloses the design and screening of naked siRNA sequences targeting AR gene mRNA.

[0079] (1) siRNA sequence design

[0080] The NCBI gene ID of human androgen receptor (AR) is 367. Using its transcript NM_000044.6 as a template, and avoiding the 5' untranslated region (5'UTR) and 3' untranslated region (3'UTR) and sequences near their start codons, siRNA was designed. The 5' and 3' ends of the sense and / or antisense strands of the siRNA may be empty or have several dangling nucleotides. The bases of these dangling nucleotides do not participate in base pairing between the sense and antisense strands. The 5' end of the sense strand, the 5' end of the antisense strand, the 3' end of the sense strand, and the 3' end of the antisense strand may independently have or not have dangling nucleotides. The number of dangling nucleotides is preferably 0–10, more preferably 2–4, and even more preferably 2. Each dangling nucleotide is independently selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, thymine ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, uracil deoxyribonucleotide, and thymine deoxyribonucleotide.

[0081] Based on the above principles, several pairs of siRNA (hereinafter referred to as siAR) sequences targeting AR gene mRNA were designed, and the sequence details are shown in Table 2.

[0082] Table 1 shows the representation of some special nucleotide monomers. In oligonucleotides, these special nucleotide monomers are interconnected with other nucleotide monomers via 5'-3'-phosphodiester bonds. All of the special nucleotide monomers in Table 1 are commercially available.

[0083] Table 1: Representation and meaning of special nucleotide monomers

[0084]

[0085]

[0086] Table 2: siRNA sequences targeting AR

[0087]

[0088] (2) Synthesis of siRNA

[0089] siRNA sequences were synthesized using the phosphoramidite-triester method, which involved repeating a five-step procedure: deprotection, activation, coupling, capping, and oxidation. After each repetition, the oligonucleotide chain was extended by one nucleotide, ultimately yielding the crude synthetic product of the target length. The deprotection reagent was TCA·Deblock, the activator was 5-benzylthiotetrazole, the capping reagents were CAPA and CAPB, and the oxidizing agent was iodine solution or (E)-N,N-dimethyl-N'-(3-thio-3H-1,2,4-dithiazo-5-yl)formamidin.

[0090] Different siRNA sequences can be obtained by deprotecting, annealing, and purifying the crude synthetic product; among them, HPLC is used to purify the annealed product.

[0091] Purification materials: Diamond Q Mustang anion exchange column (purchased from BorgLen) and eluent (a mixture of solutions A and B in different proportions; solution A: 100mM Tris, 10mM EDTA, 300mM NaCl, pH 9.0; solution B: 100mM Tris, 10mM EDTA, 1000mM NaCl, pH 9.0).

[0092] Purification procedure: Elute with 5 CV (column volume) of solution A; elute with 50 CV of eluent (containing 0%-100% B); elute with 5 CV of solution B. The target elution peak product was desalted using a G25M column (purchased from BorgLyn). The desalted product was concentrated by ultrafiltration to obtain the purified product, which was then lyophilized, vacuum-packed, and stored at -20°C for later use.

[0093] (3) Verification of the effect of siRNA on the expression level of AR mRNA in cells

[0094] Validation process: siRNA was dissolved and diluted to 100 μM for later use. HaCat cells were seeded in 12-well plates, and siRNA was transfected 24 h after seeding using Lip3000 (Lipofectamine 3000, purchased from Thermofisher). The final concentrations of siRNA after transfection were 30 nM and 100 nM. Cells were cultured in a CO2 incubator for 48 h. A control group without siRNA was also included. RNA was extracted from the cells, reverse transcribed into cDNA, and detected by qPCR.

[0095] Verification results:

[0096] Cellular validation results for each siRNA sequence are as follows: Figure 1 As shown, the vertical axis represents the relative expression level of AR mRNA compared to the control group. Except for siAR-Luo5 and siAR-Luo6, which showed poor knockdown effects on AR mRNA, the relative expression levels of AR mRNA corresponding to the other four sequences were all less than 0.6. Among them, siAR-Luo1, siAR-Luo2, and siAR-Luo3 all showed good knockdown effects at concentrations of 30 nM and 100 nM.

[0097] Example 2: Preparation of the delivery carrier LNP

[0098] This embodiment discloses an LNP for delivering siRNA and its preparation method.

[0099] (1) LNP composition

[0100] The LNP consists of an aqueous phase and an organic phase, wherein the organic phase includes cationic lipids, accessory lipids, steroids, and PEG-lipids, with a molar ratio of 40–60:3–20:25–55:0.1–10. The aqueous buffer is selected from acetate-sodium acetate buffer and citrate-sodium citrate buffer. The volume ratio of the aqueous phase to the organic phase is 1–100:1–100. Non-limiting embodiments of some LNP compositions are shown in Table 3.

[0101] Cationic lipids include, but are not limited to, dilinyl methyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-diolenoyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleoyloxypropylammonium bromide (DTOPA), dimethyl-2,3-diolenoyloxypropyl-2-(2-sperminecarbamoylamino)ethylammonium trifluoroacetate (DOSPA), dioleoylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, and 98N. 12-5, FTT5, Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate)(SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)(ALC-0315), bis((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butyryl)oxy)heptadecanedioate(Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylureo)nonadecanoate(OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonoxy)8-oxooctyl)amino)octanoate heptadecan-9-yl ester)(Lipid5), Lipid A6, YSK12-C4 and CL4H6.

[0102] The auxiliary lipids include, but are not limited to, 1,2-distearyl-sn-glycerol-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE).

[0103] Steroid lipids include, but are not limited to, phytosterols (such as campesterol, sitosterol, stigmasterol, sennasterol, β-sitosterol, etc.) and cholesterol.

[0104] PEG-lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearylphosphatidylethanolamine (PEG2000-DSPE), distearyl-rac-glycerol-polyethylene glycol 2000 (DSG-PEG 2000), and methoxy polyethylene glycol bis(tetradecyl)acetamide (ALC-0159).

[0105] Table 3: LNP Composition

[0106]

[0107] (2) LNP preparation method

[0108] Taking LNP-001 as an example, the process of preparing small-sized LNPs by ethanol injection is as follows:

[0109] S1: Preparation of lipid ethanol solution

[0110] Weigh out 34.4 mg of SM-102, 7.2 mg of DSPC, 16.0 mg of cholesterol, and 4.0 mg of DMG-PEG2000, respectively, and add them to a 2 mL cryovial. Add 1 mL of anhydrous ethanol and vortex to dissolve the lipids, obtaining an ethanol solution. Transfer the required amount of each lipid ethanol solution to a 1.5 mL centrifuge tube and mix thoroughly to obtain a final organic phase solution of 500 μL for later use.

[0111] S2: Preparation of aqueous solution

[0112] Dissolve 2 mg of siRNA lyophilized powder in 0.4 mL of water for injection to obtain a 5000 ng / μL siRNA solution.

[0113] Take 1423 μL of acetate-sodium acetate buffer and 77 μL of siRNA solution into a 10 mL cryovial, stir slowly to mix well, and prepare an aqueous solution for later use.

[0114] Among them, V 水相 (volume of aqueous solution) = V 缓冲液 (volume of acetate-sodium acetate buffer) + V siRNA (siRNA solution volume), the volume ratio of aqueous phase to organic phase is 3:1; the required siRNA mass is pre-calculated to be 0.385 mg, and the required siRNA solution volume in the aqueous phase can be determined using the formula V. siRNA =385000 / C(μL), where C is the concentration of siRNA in the siRNA solution (ng / μL); from this, the required volume V of the acetate-sodium acetate buffer solution can be calculated. 缓冲液 =1500-385000 / C(μL).

[0115] S3: Preparation of LNP-siRNA

[0116] Approximately 500 μL of lipid ethanol solution was rapidly injected into the aqueous phase to obtain LNP-001-siRNA. A 50 μL sample of the LNP solution was taken, and the particle size was determined using a Malvern particle size analyzer.

[0117] S4: Concentrate and change solution

[0118] Add 3 volumes of HEPES buffer to the sample and mix slowly by inverting. Pour the diluted LNP solution into an ultrafiltration centrifuge tube, centrifuge to concentrate to 1.0–1.5 mL, fill with HEPES buffer, mix by inverting, and centrifuge again to concentrate to 0.3–0.5 mL. Collect the sample and store at 4°C for later use.

[0119] The LNP-002-siRNA to LNP-005-siRNA were prepared according to steps S1 to S4 and Table 3, respectively. The physicochemical data are shown in Table 4. The particle size was good, the particle distribution was uniform (PDI < 0.1), and the encapsulation efficiency was high (> 90%).

[0120] Table 4: Physicochemical data of each LNP-siRNA

[0121] name Particle size (nm) PDI (Polydispersion Index) Encapsulation rate % LNP-001-siRNA 82.4 0.02 94.6 LNP-002-siRNA 79.3 0.03 91.2 LNP-003-siRNA 84.6 0.02 92.5 LNP-004-siRNA 81.5 0.02 93.4 LNP-005-siRNA 83.1 0.02 93.5

[0122] Example 3: Design, synthesis and validation of modified siRNA

[0123] (1) Design and synthesis of modified siRNA

[0124] The RNA modifications in this invention include, but are not limited to, phosphate backbone modification, base modification, ribose modification, 5' end modification, 3' end modification, and bioconjugation modification.

[0125] Phosphate backbone modification includes, but is not limited to, modification with thiophosphates, dithiophosphates, peptide nucleic acids (PNA), and dimethyl phosphates (PMOs).

[0126] Base modifications include, but are not limited to, pseudouracil. ), 2-thiouracil (s2U), 5-methylcytosine, 2,6-diaminopurine, and 2-thiothymine.

[0127] Ribosugar modification includes, but is not limited to, 2'-O-methyl(2'-O-methyl)-2' ′ -O-methyl), 2'-O-methoxyethyl (2 ′ -O-methoxyethyl), 2'-fluoro(2 ′ -F), locked nucleic acid (LNA), constrained ethyl (cEt), ENA (ethylene-bridged nucleic acid), and GNA (glycerolnucleic acid), etc.

[0128] 5' end conjugations include, but are not limited to, conjugations of cholesterol, 5'-Vp (5'-vinylphosphonate), antibodies, polysaccharides, sterols, phospholipids, or polypeptides.

[0129] 3' end conjugations include, but are not limited to, conjugations of cholesterol, polyethylene glycol, N-acetylglucosamine derivatives, biotin, polypeptides, phospholipids, etc.

[0130] Bioconjugation modifications include, but are not limited to, one or more combinations of N-acetylgalactosamine (GalNAc), cholesterol, aptamers, and peptides.

[0131] Sequence-modified isomers include, but are not limited to, isomers introduced by different configurations of monomers or obtained by synthetic reactions, including, but not limited to, isomerism introduced by thiophosphates (R / S) and GNA (R / S).

[0132] Based on the above sequence modification principles, the siAR-Luo1 obtained in Example 1 was further modified, that is, a modified siRNA sequence was synthesized according to the siRNA synthesis method of Example 1. The specific nucleotide monomers containing the modification can all be obtained commercially. The modified siAR-Luo1 sequence is shown in Table 5.

[0133] Table 5: Modified siRNA sequences

[0134]

[0135] (2) Serum enzymatic digestion experiment

[0136] Normally, siRNA degrades rapidly in blood. According to the reference (doi:10.1038 / mt.2009.91), unmodified siRNA can be degraded within 1 minute in blood. The effect of different modification schemes on the stability of siRNA was investigated using a serum enzymatic digestion experiment. Multiple 0.2 mL PCR tubes were used, each containing 800 ng of modified siRNA and 1 μL of fetal bovine serum. DEPC water was added to a final volume of 10 μL, and the tubes were incubated at 37°C for 0 h or 24 h to obtain serum enzymatic digestion samples. The siRNA content in the serum enzymatic digestion samples was detected by agarose gel electrophoresis at 140 V for 15 min.

[0137] Electrophoresis analysis showed that siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 all exhibited clear bands under both 0h and 24h conditions, indicating good stability among these four molecules. Among them, siAR-1-mode1 and siAR-1-mode2 showed relatively better stability, as shown in their electrophoresis results. Figure 2 As shown.

[0138] (3) Verification of the effect of modified siRNA on the expression level of AR mRNA in cells

[0139] The knockdown effect of modified siRNA on AR mRNA was evaluated using HaCat cells. The verification method can be found in Example 1. Figure 3 It can be seen that, compared with the control group, the expression levels of AR mRNA corresponding to siAR-1-mode1, siAR-1-mode2, siAR-1-mode3 and siAR-1-mode6 were relatively low.

[0140] Example 4: Vectorless delivery effect of siRNA modified with alkyl chain Cn

[0141] Adding an alkyl chain to siRNA can effectively improve its lipophilicity, enabling siRNA to be delivered into cells and successfully knock down the target mRNA without other delivery vectors, and further reducing adverse reactions caused by delivery vectors. This example examines the effect of the alkyl chain Cn on the intracellular delivery of siRNA, using hexadecyl (Cn, n=16) as an example. siAR-1 from Example 3 was selected for modification, with siAR-1-mode1a and siAR-1-mode1b as experimental groups and a control group without siRNA. No delivery vector was used in either group, and the sequences are shown in Table 6 below. In siAR-1-mode1a, the Cn modification was replaced with a Cm modification; in siAR-1-mode1b, the same position was modified with Cn.

[0142] Table 6: siRNA names and their sequences

[0143]

[0144] Effects of Cn (n=16) modified siRNA on cellular AR mRNA expression levels

[0145] The knockdown effect of Cn (n=16)-modified siRNA on AR mRNA was evaluated using HaCat cells. The verification method can be found in Example 1. Figure 4 As can be seen, compared with the control group, the relative expression level of siAR-1-mode1a group was greater than 0.6 under both 30mM and 100mM siRNA conditions, while the relative expression level of AR mRNA in siAR-1-mode1b group was less than 0.6. This shows that Cn (n=16) modification significantly improved the delivery performance of siRNA into cells. Therefore, vectorless delivery of siRNA with excellent delivery efficiency can be achieved by adding an alkyl chain Cn modification.

[0146] Example 5: Vectorless delivery effect of siRNA modified with alkyl chain Cn

[0147] This embodiment further investigated the effect of the number of carbon atoms in the alkyl chain on siRNA delivery by introducing alkyl chain Cn (n = 16 to 22) modification into the siRNA sequence. The siRNA sequences containing Cn modification are shown in Table 7.

[0148] Table 7: siRNA sequences containing Cn modification

[0149]

[0150] Effects of siRNAs modified with alkyl chains containing different numbers of carbon atoms (Cn) on cellular AR mRNA expression levels

[0151] The knockdown effect of siRNA on AR mRNA was verified using HaCat cells. The verification method can be found in Example 1. Figure 5 As can be seen, compared with the control group, the relative expression levels of AR mRNA corresponding to the four Cn-modified siRNAs were all less than 0.6 at concentrations of 30 mM and 100 nM. This indicates that the Cn-modified siRNAs can still effectively knock down AR mRNAs even without lipid nanoparticles or other carriers. Therefore, the Cn-conjugates of siRNAs have good cell delivery performance.

[0152] Example 6: Delivery effect of siRNA with alkyl chain Cn modified at different sites

[0153] The antisense strand of siRNA can generally be divided into four regions: seed region, intermediate region, supplementary region, and 3' tail region. Corresponding to the siAR-1 and its modified sequence provided in this invention, the nucleotide sites corresponding to the four regions are the seed region (positions 4 to 10), the intermediate region (positions 11 to 14), the supplementary region (positions 15 to 19), and the 3' tail region (position 20 to the 3' end); all of the above sites are calculated in the 5'-3' direction.

[0154] In this embodiment, a Cn modification was inserted at one site in each of the aforementioned regions of the antisense strand, or a Cn modification was added at the corresponding complementary pairing site on the sense strand, to further investigate the effect of the modification sites of the alkyl chain of siRNA on siRNA delivery. Specifically, the binding of the siAR-1-mode1 sequence with Cn (n=16) modification is illustrated as an example; wherein, the complementary pairing sites of siAR-1-mode1 are located at positions 3–21 of the sense strand (positions 1–2 are dangling nucleotides), and positions 3–21 of the antisense strand (positions 1–2 are dangling nucleotides); these sites are calculated independently along the 5'–3' direction of each of the sense and antisense strands. siRNA sequences containing Cn (n=16) modifications at different sites are shown in Table 8.

[0155] Table 8: siRNA sequences containing Cn (n=16) modifications at different sites

[0156]

[0157] Effects of siRNAs with different alkyl chain Cn modifications on AR mRNA expression levels in HaCat cells

[0158] The knockdown effect of siRNA on AR mRNA was evaluated using HaCat cells; the verification method can be found in Example 1. Figure 6 It is evident that all eight modified siARs exhibited good silencing effects on AR. Among them, except for siAR-1-mode16, the relative expression levels of AR mRNA corresponding to the other seven siARs were less than 0.6, demonstrating outstanding effects. Insertion of Cn (n=16) into different regions of the siAR sequence achieved vector-free siRNA delivery and good gene silencing effects.

[0159] Example 7: Effects of modified siRNA on hair growth in male mice

[0160] The effects of modified siRNA (preferably siAR-1-mode1, hereinafter referred to as siAR) on hair growth and AR mRNA knockdown were verified using a male mouse model. The delivery vector used was LNP (preferably LNP-001) prepared in Example 2.

[0161] Establishment of a male baldness mouse model: Six- to eight-week-old C57BL / 6 male mice weighing 20±2g were selected. Hair was removed from the backs of each mouse using a depilatory cream. 100μL of dihydrotestosterone (DHT) at a concentration of 10mg / mL was subcutaneously injected into the hair removal site, five days a week for three weeks. The experiment lasted 21 days. Experimental groups are shown in Table 9 below.

[0162] For male-aborted mice, siAR was administered via LNP or lip3000 carriers, denoted as LNP-siAR and lip3000-siAR, respectively. LNP-siAR or lip3000-siAR was injected intradermally (id) on days 0, 3, and 7, with a dose of 60 μg siRNA per mouse. Minoxidil was administered via topical application for 5 consecutive days per week. LNP-siAR was prepared according to the method in Example 2. For lip3000-siAR preparation: 10 μL of lip3000 and 50 μL of physiological saline were added to tube A, and 50 μL of physiological saline and 60 μg siAR were added to tube B. The liquid from tube B was then transferred entirely to tube A and mixed thoroughly.

[0163] Mice were sacrificed on day 21 after hair removal, and skin samples were collected to detect changes in AR mRNA expression levels. Serum samples were also collected for later use. A separate skin tissue sample (2×3cm) was fixed in 4% paraformaldehyde solution for 24 hours. After fixation, the skin tissue sample was dehydrated using low-to-high concentration ethanol (75%→85%→95%→anhydrous ethanol I→anhydrous ethanol II, 30 min each time), and treated twice with xylene for 10 min each time. The ethanol- and xylene-treated skin tissue was embedded in paraffin blocks to prepare longitudinal and horizontal sections with a thickness of 5.0 μm.

[0164] Tissue sections were sequentially immersed in xylene I for 30 min, xylene II for 30 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 75% ethanol for 5 min to dewax and then stained with hematoxylin and eosin (H&E). The longitudinal sections were stained with Masson's trichrome stain to assess hair length, diameter, follicle density, anagen / telogen follicle ratio, and the area of ​​the hair bulb covered by melanin.

[0165] Table 9: Experimental grouping of male mice

[0166]

[0167] (1) Hair growth index

[0168] Changes in mouse phenotype over time, such as Figure 7 As shown. On day 7 after modeling, no obvious melanin patches or new vellus hair appeared in any group. The skin in the negative control group began to turn light gray, showing a tendency for hair regrowth. On day 14 after modeling, hair grew normally in the negative control group, and new hair appeared in the lip3000-siAR group, indicating that knocking down the AR gene can effectively promote hair growth, and lip3000 can be effectively used for siRNA delivery to skin tissue. On day 21 after modeling, hair growth was vigorous in the negative control group, and there was obvious new hair in the Minoxidil group. The new hair in the LNP-siAR group was vigorous and significantly better than that in the Minoxidil group. It can be seen that knocking down the AR gene can effectively promote hair regrowth, and LNP can also be effectively used for siRNA delivery to skin tissue.

[0169] The analysis results of various phenotypic data of mouse skin sections on day 21 after modeling are as follows: Figure 8 As shown:

[0170] For hair length, Figure 8 a) Mouse hair shaft diameter Figure 8b) Hair follicle length Figure 8 c), hair follicle density per view Figure 8 d), hair follicle diameter Figure 8 e), the ratio of hair follicles in the anagen phase to those in the telogen phase (anagen / telogen ratio). Figure 8 f), the area of ​​the hair bulb covered by melanin. Figure 8 (g) For each indicator, the values ​​in the DHT group were significantly lower than those in the negative control group, indicating a significant decrease in each indicator in the DHT group. In contrast, the values ​​in the Minoxidil group and the three treatment groups were significantly higher than those in the DHT group, indicating that treatment with Minoxidil, LNP-siAR, lip3000-siAR, or lip3000-siAR combined with Minoxidil can significantly alleviate or reverse the effects of DHT modeling on hair and hair follicles. Figure 8 The f indicates that treatment with Minoxidil, LNP-siAR, lip3000-siAR, or lip3000-siAR and Minoxidil can effectively shorten the resting phase of hair follicles, allowing them to enter the growth phase more quickly.

[0171] In the analysis of the above-mentioned multiple indicators, the Minoxidil group showed similar efficacy to siAR, and was close to or only lower than the siAR treatment group in each indicator. No significant increase in efficacy was observed in the lip3000-siAR+Minoxidil group compared to siAR alone. The results of this example suggest that the siRNA sequence siAR-1-mode1 has a significant promoting effect on hair growth.

[0172] (2) Androgen receptor mRNA expression level in skin tissue

[0173] RNA was extracted from mouse skin tissue using the Trizol method. The expression levels of target genes were detected by qPCR according to the kit instructions. The relative expression levels of each group compared to the negative control group are shown below. Figure 9 As shown in the figure, the AR mRNA expression level in the DHT group was significantly higher than that in all treatment groups, while the AR mRNA expression levels in the Minoxidil group and all treatment groups were lower than those in the negative control group.

[0174] Example 8: LNP-siAR Security Assessment

[0175] The expression levels of various factors TNF-α, TNF-γ, IL-1β, IL-6, CCL2, TGF-β and VEGF in serum samples collected in Example 7 from the negative control group, DHT group and LNP-siAR group were detected using an ELISA kit.

[0176] TNF-α, TNF-γ, IL-1β, IL-6, CCL2, and VEGF were expressed at low levels in serum, only at the pg level; TGF-β was expressed at the ng level. To better reflect the differences between the treatment group and the model group, this example examined the relative expression changes of each factor in the LNP-siAR group and the DHT group relative to the negative control group. The results are as follows: Figure 10 As shown.

[0177] Depend on Figure 10 It was observed that the expression levels of TNF-α, TNF-γ, IL-1β, IL-6, and CCL2 in the serum of the DHT and LNP-siAR groups showed relatively small differences, while the expression levels of TGF-β and VEGF differed significantly. This may be because TGF-β and VEGF play active roles related to hair growth in the LNP-siAR group, and their expression levels were significantly higher than those in the DHT group. Specifically, TGF-β is involved in regulating cell division in hair follicles, activating and proliferating hair follicle stem cells, and stimulating hair growth; VEGF regulates angiogenesis, and the blood vessels surrounding the hair follicle provide essential nutrients for hair growth.

[0178] Example 9: Effects of modified siRNA on hair growth in female mice

[0179] The effects of the modified siRNA (preferably siAR-1-mode1, the same as siAR in this example) on hair growth and AR mRNA knockdown were verified using a female mouse model. The delivery vector used was the LNP (preferably LNP-001) prepared in Example 2.

[0180] Establishment of a female male hair loss mouse model (modeling): Six- to eight-week-old C57BL / 6 female mice weighing 20±2g were selected. Hair was removed from the backs of each mouse using hair removal cream. 100μL of dihydrotestosterone (DHT) at a concentration of 10mg / mL was subcutaneously injected into the hair removal site, 5 days a week for three weeks. The experiment lasted 21 days. Experimental groups are shown in Table 10.

[0181] For male-dead mice, the injection method, administration method, and collection and processing method of mouse skin are the same as in Example 7.

[0182] Table 10: Experimental grouping of female mice

[0183]

[0184] (1) Hair growth index

[0185] Changes in mouse phenotype over time, such as Figure 11 As shown. On day 7 post-modeling, no obvious melanin patches or new vellus hair appeared in any group. On day 14 post-modeling, hair regrowth was significant in the negative control group, while the skin of the Minoxidil and lip3000-siAR groups began to turn light gray, showing a trend of hair regrowth. On day 21 post-modeling, hair regrowth was significant in the Minoxidil, lip3000-siAR, and DHT groups, with the lip3000-siAR group showing significantly better hair regrowth than the DHT group, indicating that knocking down the AR gene can effectively promote hair growth in female mice.

[0186] The analysis results of various phenotypic data of mouse skin sections on day 21 after modeling are as follows: Figure 12 As shown:

[0187] For hair length, Figure 12 a) Mouse hair shaft diameter Figure 12 b) Hair follicle length Figure 12 c), hair follicle density per view Figure 12 d), hair follicle diameter Figure 12 e), the ratio of hair follicles in the anagen phase to those in the telogen phase (anagen / telogen ratio). Figure 12 f), the area of ​​the hair bulb covered by melanin (melanin area in hairbulb, Figure 12 (g) The values ​​of each indicator in the DHT group were significantly lower than those in the negative control group, indicating that each indicator in the DHT group was significantly reduced. In contrast, the values ​​of each indicator in the Minoxidil group and the lip3000-siAR group were significantly higher than those in the DHT group, indicating that the treatment with Minoxidil or lip3000-siAR can significantly alleviate or reverse the effects of DHT modeling on the hair and hair follicles of female mice.

[0188] (2) Androgen receptor mRNA expression level in skin tissue

[0189] The mRNA extraction and detection methods are the same as in Example 7. The relative expression levels of each group compared to the negative control group are as follows: Figure 13As shown in the figure, the AR mRNA expression level in the DHT group was significantly higher than that in the treatment group, while the AR mRNA expression levels in the Minoxidil group and the lip3000-siAR group were lower than those in the negative control group.

[0190] In summary, this invention provides siRNA sequences targeting AR, as well as corresponding modified siRNA sequences, which can effectively reduce AR mRNA expression levels, thereby treating diseases caused by abnormal androgen expression or diseases related to androgen receptors. Indications include, but are not limited to, androgenetic alopecia, alopecia areata, neurogenic alopecia, scarring alopecia, diffuse alopecia, and acne. This invention provides various siRNA modification methods, resulting in enhanced sequence stability and effective AR mRNA knockdown. The siRNA provided by this invention can be efficiently delivered to the target site via delivery vectors, or it can be effectively delivered into cells without other delivery vectors by adding sterols or alkyl chains to the sequence, as verified in cell experiments. Compared to existing small molecule drugs, the siRNA of this invention has a longer duration of action, reduces the frequency of administration, and eliminates the need for daily medication, effectively improving patient compliance.

Claims

1. A small nucleic acid that targets the androgen receptor, characterized in that, The small nucleic acid targeting the androgen receptor comprises a sense strand and an antisense strand. The sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; Wherein, u or U represents uracil nucleotide, G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymine deoxynucleotide, m represents 2'-O-methyl modification, f represents 2'-fluorine modification, VP represents 5'-phosphorylation modification of ribose, * represents thiolation modification of a non-bridging oxygen atom of the α-phosphate group of the nucleotide, and Cn- represents 2'-O-Cn alkyl modification; in the Cn alkyl group, n = 16 to 22.

2. The small nucleic acid targeting the androgen receptor as described in claim 1, characterized in that, The nucleotide sequence of the positive strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the negative strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16; the nucleotide sequence of the positive strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the negative strand is (VPu)*UfUmCmAmGfCmCfCfAmUm The nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, with n = 20; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, with n = 22.

3. A small nucleic acid that targets the androgen receptor, characterized in that, The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*(Cn-g)*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCmAmGf(Cn-u)GfGmAmUmGmGmGm The nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is t*t*(Cn-a)UmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCm AfCmUfGmGmAm*Am*Um; The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*(Cn-u); The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUm The nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGm(Cn-g)Am*Am*Um; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am; the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCm(Cn-a)CmUfGmGmAm*Am*Um; Wherein, u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymine deoxynucleotide, m represents 2'-O-methyl modification, f represents 2'-fluorine modification, VP represents 5'-phosphorylation modification of ribose, * represents thiolation modification of a non-bridging oxygen atom of the α-phosphate group of the nucleotide, and Cn- represents 2'-O-Cn alkyl modification; in the Cn alkyl group, n is 16.

4. A method for preparing a small nucleic acid targeting the androgen receptor as described in any one of claims 1-3.

5. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a therapeutically effective amount of a small nucleic acid targeting the androgen receptor as described in any one of claims 1-3, and a pharmaceutically acceptable carrier.

6. The pharmaceutical composition according to claim 5, characterized in that, The carrier is a lipid nanoparticle or an exosome.

7. The pharmaceutical composition according to claim 6, characterized in that, The lipid nanoparticles are composed of an aqueous phase and an organic phase, wherein the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:

10.

8. The pharmaceutical composition according to claim 7, characterized in that, The organic phase is composed of cationic lipids, auxiliary lipids, steroids, and PEG-lipids, wherein the molar ratio of cationic lipids, auxiliary lipids, steroids, and PEG-lipids is 40–60:3–20:25–55:0.1–10; the cationic lipids are selected from dilinyl methyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-diolenoyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleoyloxypropylammonium bromide (DTOPA), dimethyl-2,3-diolenoyloxypropyl-2-(2-sperminecarbamoylamino)ethylammonium trifluoroacetate (DOSPA), dioleoylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, and 98N. 12 -5, FTT5, Heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate)(SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate)(ALC-0315), bis((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butyryl)oxy)heptadecanedioate(Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylureo)nonadecanoate(OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonoxy)8-oxooctyl)amino)octanoate heptadecan-9-yl ester)(Lipid5), Lipid A6, YSK12-C4, and CL4H6 are selected from one or more of the following: the auxiliary lipid is selected from one or more of the following: 1,2-distearyl-sn-glycerol-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from phytosterols or cholesterol; the PEG-lipid is selected from one or more of the following: 1,2-dimyristoyl-rac-glycerol-3-methoxy polyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearylphosphatidylethanolamine (PEG2000-DSPE), distearyl-rac-glycerol-polyethylene glycol 2000 (DSG-PEG 2000), and methoxy polyethylene glycol bis(tetradecylacetamide) (ALC-0159).

9. A method for preparing a pharmaceutical composition as described in any one of claims 5-8, characterized in that, The method includes adding a small nucleic acid targeting the androgen receptor as described in any one of claims 1-3, and a pharmaceutically acceptable carrier, to a solvent.

10. Use of the small nucleic acid targeting the androgen receptor as described in any one of claims 1-3 or the pharmaceutical composition as described in any one of claims 5-8 in the preparation of a medicament for treating androgenetic alopecia.

Images