Nucleic acid molecule and application thereof

Abstract

The invention provides a nucleic acid molecule and application thereof, and belongs to the technical field of biology. Specifically, compared with SEQ ID NO: 1, the nucleic acid molecule has c.1850A > C mutation. The mutation is closely related to myopic maculopathy.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular, to nucleic acid molecules and their applications. BACKGROUND

[0002] Myopia is showing a rapid upward trend worldwide, especially in East Asia and Southeast Asia. High myopia is characterized by continuous elongation of the eye axis, usually defined as an axial length (AL) ≥ 26 mm or a spherical equivalent (SE) ≤ -6.00 diopters (D). Studies have shown that environmental and genetic factors are considered to be the main predisposing factors for myopia and high myopia. Family-based association analysis, genome-wide association study (GWAS) and whole exome sequencing (WES) have revealed hundreds of susceptibility genes associated with myopia or high myopia.

[0003] However, the harm of high myopia lies in its complications: myopic maculopathy (MM), which is characterized by typical myopic degenerative changes in the macular retina, choroid and sclera. MM has become the main cause of irreversible visual impairment worldwide, and is expected to affect tens of millions of people by 2050. In the general population, the proportion of high myopia cases with MM is quite high in adult or elderly populations in Japan, Australia, Singapore and Beijing. MM is a disease with high prevalence worldwide, and existing studies have identified hundreds of susceptibility genes associated with myopia or high myopia through family-based association analysis and genome-wide association study. However, despite some progress worldwide, due to the large differences in the incidence of the disease between different populations and the large heterogeneity of different populations, there is still a considerable lack of genetic factors in the Chinese population. Existing studies have focused on family-based association analysis and gene association analysis of common variants, with few studies on low-frequency variants of myopic maculopathy, which has also led to a partial lack of genetic power.

[0004] Therefore, the research on MM-related susceptibility genes or pathogenic genes still needs to be improved. SUMMARY

[0005] The present application aims to at least partially solve one of the technical problems in the related art. To this end, the present application provides a nucleic acid molecule for effectively diagnosing / differentiating myopic maculopathy.

[0006] Specifically, the technical solutions of the present application are as follows:

[0007] In a first aspect, the present application provides a nucleic acid molecule. According to an embodiment of the present application, the nucleic acid molecule has a c.1850A>C mutation compared with SEQ ID NO:1. According to the nucleic acid molecule of the present application, the nucleotide sequence of the SEQ ID NO:1 is identical to the nucleotide sequence of the coding region of the wild-type NFE2L3 gene, the base at position 1850 of the SEQ ID NO:1 is A, and the base at position 1850 of the nucleic acid molecule is C, i.e. the base at position 1850 of the nucleic acid molecule is mutated from A to C. The applicant found that the mutation is closely related to myopic maculopathy, forming a new genotype of myopic maculopathy.

[0008]

[0009] It should be noted that the aforementioned SEQ ID NO: 1 is the nucleotide sequence of human wild-type NFE2L3 gene. For the nucleic acid molecules mentioned in the specification and claims of the present application, it should be understood by those skilled in the art that any one of the complementary double strands, or both, are actually included. For the convenience, in the specification and claims, although only one strand is given in most cases, the other complementary strand is actually disclosed. In addition, the nucleic acid sequences in the present application include DNA or RNA forms, and the disclosure of one means the disclosure of the other.

[0010] According to a specific embodiment of the present application, the nucleic acid molecule is DNA, and the inventors have confirmed that the mutation of the base at position 1850 of the coding region of NFE2L3 gene from A to C is closely related to myopic maculopathy, and thus whether a biological sample has a higher probability of myopic maculopathy phenotype can be inferred by detecting whether the sample has the mutation at the site.

[0011] In different animal models, the equivalent nucleotide mutation site of NFE2L3 gene can be different, and those skilled in the art can understand that the nucleotide mutation site of NFE2L3 gene in other animal models obtained based on the present application and myopic maculopathy is also within the protection scope of the present application, such as the c.1739A>C mutation of mouse wild-type NFE2L3 gene (SEQ ID NO: 11).

[0012]

[0013] In a second aspect of the present application, a primer is provided. According to an embodiment of the present application, the primer is suitable for amplifying the nucleic acid molecule of the first aspect. The primer sequence according to an embodiment of the present application is used to amplify a target sequence, which includes the base at position 1850 in SEQ ID NO: 1.

[0014] It should be noted that the amplification is based on the principle of base complementary pairing, and the obtained nucleic acid molecule is amplified in quantity and the fragments are extracted. By adding a linker, a fluorescent group, a biotin group, a label and the like to the primer, preparation for subsequent sequencing or positioning of the nucleic acid molecule and other technical means can be prepared.

[0015] According to an embodiment of the present application, the primer can further include at least one of the following additional technical features:

[0016] According to an embodiment of the present application, the primer has at least one of the nucleotide sequences shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 (guide RNA).

[0017] TGAAGAACCAGATTCCGGGC (SEQ ID NO: 2);

[0018] GGCTTCCTTTTTGTGGCCTG (SEQ ID NO: 3);

[0019] TTGAGTTTGCTCATTTTTAAGGG (SEQ ID NO: 4).

[0020] In some examples of the present application, the verification of the mutation site of myopic maculopathy is carried out on a mouse model, and therefore the above-mentioned sequences are primer sequences of the mouse NFE2L3 gene. It can be understood that based on equivalent mutation sites of different animal models, a person skilled in the art can design matching primer sequences and guide RNA sequences accordingly, for example, a primer designed based on the c.1850A>C mutation of the human wild-type NFE2L3 gene (SEQ ID NO: 1) is also within the protection scope of the present application.

[0021] In a third aspect, the present application provides a probe. According to an embodiment of the present application, the probe specifically recognizes a target sequence having a c.1850A>C mutation compared with SEQ ID NO: 1. The probe according to an embodiment of the present application can specifically recognize and label the target sequence of the sample to be detected, and then determine whether the base of the target site in the sample to be detected is mutated from A to C compared with the nucleotide sequence of the wild-type NFE2L3 gene, i.e., SEQ ID NO: 1.

[0022] It can be understood that based on the equivalent mutation sites of different animal models, a person skilled in the art can design a probe accordingly, for example, a probe designed based on the c.1850A>C mutation of the human wild-type NFE2L3 gene is also within the protection scope of the present application.

[0023] In a fourth aspect, the present application provides a kit. According to an embodiment of the present application, the kit comprises the primer of the second aspect and / or the probe of the third aspect. The kit according to an embodiment of the present application can be used to diagnose whether the sample to be detected contains the above-mentioned mutation, and then diagnose whether the sample to be detected has myopic maculopathy.

[0024] In a fifth aspect, the present application provides the use of the kit of the fourth aspect in diagnosing myopic maculopathy. According to the use of an embodiment of the present application, the primer and / or probe in the kit can specifically detect the above-mentioned nucleic acid molecule, and specifically label the above-mentioned nucleic acid molecule by specifically pairing with the above-mentioned nucleic acid molecule. The above-mentioned nucleic acid molecule can also be detected by detecting secondary products such as peptide chains and proteins.

[0025] In a sixth aspect, the present application provides a non-diagnostic nucleic acid typing method. According to an embodiment of the present application, the method comprises: obtaining at least a part of the genomic sequence information of a target object; and comparing the at least a part of the genomic sequence information with a reference sequence to determine whether the genomic sequence has a c.1850A>C mutation, wherein the reference sequence at least includes the site information at position 1850 in SEQ ID NO: 1. The non-diagnostic nucleic acid typing method according to an embodiment of the present application can effectively determine whether the target object genome contains the above-mentioned site mutation, and then perform subsequent related scientific research.

[0026] According to the embodiments of the present application, at least part of the genomic sequence information of the target object can be obtained based on a sequencing approach. In some examples of the present application, the aforementioned sequencing is performed by a sequencing platform. In the present application, the sequencing platform is not particularly limited and can be any common first, second or third generation sequencing platform. In the present application, the sequencing platform that can be used to perform the aforementioned sequencing method can be selected from, but is not limited to, the Hiseq / Miseq / Nextseq / Novaseq sequencing platform of Illumina, the Ion Torrent platform of Thermo Fisher / Life Technologies, the BGISEQ and MGISEQ / DNBSEQ platform of Huada Gene, and the single molecule sequencing platform. In some examples of the present application, the sequencing platform is selected from the MGISEQ.

[0027] According to the embodiments of the present application, the aforementioned reference sequence is a sequence that has been determined, which can be a DNA and / or RNA sequence that is self-previously determined to be assembled, or a DNA and / or RNA sequence that is publicly determined by others, or a reference template that is obtained from a sample source individual / target individual belonging to any biological category, for example, all or at least part of the publicly disclosed genome assembly sequence of the same biological category. If the sample source individual or the target individual is a human, the genomic reference sequence (also referred to as the reference chromosome) can be selected from the human reference sequence provided by the UCSC, NCBI or ENSEMBL database, such as HG19, HG38, GRCh36, GRCh37, GRCh38, etc. In some examples of the present application, the aforementioned reference sequence is GRCh38.

[0028] In a seventh aspect of the present application, a genotyping method for non-disease diagnosis purposes is provided. According to the embodiments of the present application, the method comprises: (1) extracting a nucleic acid sample of a biological sample for sequence determination of the nucleic acid sample; (2) determining the sequence of the nucleic acid sample for sequence alignment of the nucleic acid sample; (3) aligning the sequence of the nucleic acid sample with SEQ ID NO: 1 to determine whether the nucleic acid sample sequence has a c.1850A>C mutation, and further to determine whether the nucleic acid molecule is a mutant; wherein the gene is selected from NFE2L3. The method according to the embodiments of the present application is based on a sequencing approach, which can simply and quickly determine whether the base at position 1850 of the NFE2L3 gene in the genome of the biological sample is mutated from A to C.

[0029] According to the embodiments of the present application, the method further comprises at least one of the following technical features:

[0030] According to an embodiment of the present application, the biological sample can be selected from at least one of cells, tissues, organs, blood, skin, subcutaneous tissue of a human or an animal, and the "biological sample" is not particularly limited as long as a nucleic acid sample of the subject can be extracted. According to a specific embodiment of the present application, the biological sample is peripheral blood of a human, which is convenient and quick to obtain and does not cause great trauma to the subject. The nucleic acid sample should be understood in a broad sense, which can be any sample capable of reflecting whether the coding region of the NFE2L3 gene in the biological sample has the c.1850A>C mutation, for example, can be whole genome DNA directly extracted from the biological sample, can be a part of the whole genome containing the coding sequence of the NFE2L3 gene, can be total RNA extracted from the biological sample, or can be mRNA extracted from the biological sample. According to an embodiment of the present application, the nucleic acid sample is whole genome DNA. Thus, the source range of the biological sample can be expanded, and various information of the biological sample can be determined at the same time, thereby improving the detection efficiency. In addition, for the use of RNA as the nucleic acid sample, the extraction of the nucleic acid sample from the biological sample can further include: extracting an RNA sample, preferably an mRNA sample, from the biological sample, and based on the obtained RNA sample, obtaining a cDNA sample through a reverse transcription reaction, and the obtained cDNA sample constitutes the nucleic acid sample, thereby further improving the detection efficiency using RNA as the nucleic acid sample. Those skilled in the art can understand that, with the development of sequencing technology, the nucleic acid extraction step before sequencing can not be performed, such as single-cell sequencing, which does not need to extract nucleic acid from the cell sample to perform high-throughput sequencing on the nucleic acid in the cell sample, and thus the purpose of this step is to obtain the nucleic acid sequence of the biological sample for the preliminary processing.

[0031] According to an embodiment of the present application, the alignment is an alignment of the obtained sequence with a reference sequence.

[0032] According to an embodiment of the present application, the step (2) further includes: amplifying the NFE2L3 gene by using primers to obtain an NFE2L3 gene amplification product; adding the amplification product to a linker to obtain a sequencing library; and sequencing the sequencing library to determine the sequence of the nucleic acid sample. Based on this step, the sequence of the biological sample can be quickly, efficiently and accurately obtained.

[0033] According to an embodiment of the present application, the method further includes enriching the amplification product to improve the detection efficiency.

[0034] According to an embodiment of the present application, the primers have a nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0035] In an eighth aspect, the present application provides a genotyping system for non-disease diagnosis purposes. According to an embodiment of the present application, the system comprises: a nucleic acid sample extraction device for extracting a nucleic acid sample from a biological sample; a nucleic acid sequence determination device connected to the nucleic acid extraction device for analyzing the nucleic acid sample to determine the nucleic acid sequence of the nucleic acid sample; a judging device connected to the nucleic acid sequence determination device for comparing the nucleic acid sequence of the nucleic acid sample with SEQ ID NO: 1 to determine whether the nucleic acid sequence has a c.1850A>C mutation, and further determine whether the nucleic acid molecule is a mutant; wherein the gene is selected from NFE2L3. The system according to the embodiment of the present application can perform the aforementioned genotyping method, and further quickly and effectively determine whether the base at position 1850 of the NFE2L3 gene in the genome of the biological sample is mutated from A to C.

[0036] According to an embodiment of the present application, the system further comprises at least one of the following technical features:

[0037] According to an embodiment of the present application, the biological sample can be cells, tissues, organs, blood, etc. of a human or an animal, and the "biological sample" is not particularly limited as long as a nucleic acid sample of the subject can be extracted. According to an embodiment of the present application, the biological sample is peripheral blood of a human, which is convenient and fast to take and does not cause great trauma to the subject. The nucleic acid sample is DNA, RNA, cDNA or a polymer, and the nucleic acid sample contains information matching the SEQ ID NO: 1. Those skilled in the art can understand that, with the development of sequencing technology, the nucleic acid extraction step can not be performed before sequencing, such as single-cell sequencing which can perform high-throughput sequencing on the nucleic acid in the cell sample without nucleic acid extraction of the cell sample, and therefore the purpose of this step is to obtain the nucleic acid sequence of the biological sample.

[0038] According to an embodiment of the present application, the nucleic acid sequence determination device further comprises: a target gene amplification unit for amplifying the NFE2L3 gene using primers to obtain an NFE2L3 gene amplification product; a sequencing library construction unit connected to the target gene amplification unit for adding the amplification product to a linker to obtain a sequencing library; and a sequencing unit connected to the sequencing library construction unit for sequencing the sequencing library as input to obtain sequencing data of the nucleic acid sample.

[0039] According to an embodiment of the present application, the primers have a nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0040] In a ninth aspect, the present application provides an isolated polypeptide. According to embodiments of the present application, the isolated polypeptide has a p.617K>T mutation compared with SEQ ID NO: 5. The polypeptide according to embodiments of the present application can be used to construct a disease model, which can be used for drug screening of myopic maculopathy.

[0041] MKHLKRWWSAGGGLLHLTLLLSLAGLRVDLDLYLLLPPPTLLQDELLFLGGPASSAYALSPFSASGGWGRAGHLHPKGRELDPAAPPEGQLLREVRALGVPFVPRTSVDAWLVHSVAAGSADEAHGLLGAAAASSTGGAGASVDGGSQAVQGGGGDPRAARSGPLDAGEEEKAPAEPTAQVPDAGGCASEENGVLREKHEAVDHSSQHEENEERVSAQKENSLQQNDDDENKIAEKPDWEAEKTTESRNERHLNGTDTSFSLEDLFQLLSSQPENSLEGISLGDIPLPGSISDGMNSSAHYHVNFSQAISQDVNLHEAILLCPNNTFRRDPTARTSQSQEPFLQLNSHTTNPEQTLPGTNLTGFLSPVDNHMRNLTSQDLLYDLDINIFDEINLMSLATEDNFDPIDVSQLFDEPDSDSGLSLDSSHNNTSVIKSNSSHSVCDEGAIGYCTDHESSSHHDLEGAVGGYYPEPSKLCHLDQSDSDFHGDLTFQHVFHNHTYHLQPTAPESTSEPFPWPGKSQKIRSRYLEDTDRNLSRDEQRAKALHIPFSVDEIVGMPVDSFNSMLSRYYLTDLQVSLIRDIRRRGKNKVAAQNCRKRKLDIILNLEDDVCNLQAKKETLKREQAQCNKAINIMKQKLHDLYHDIFSRLRDDQGRPVNPNHYALQCTHDGSILIVPKELVASGHKKETQKGKRK*(SEQ ID NO: 5).

[0042] In some examples of the present application, the isolated polypeptide has a p.617K>T mutation compared with SEQ ID NO: 5, i.e., the lysine (K) at position 617 is mutated to threonine (T).

[0043] In some examples of the present application, the aforementioned polypeptide sequence (SEQ ID NO: 5) is the polypeptide sequence of the human wild-type NFE2L3 gene. In different animal models, the equivalent mutation site of the NFE2L3 gene can be different, and those skilled in the art can understand that the amino acid mutation site of the NFE2L3 gene of other animal models obtained based on the present application is also within the protection scope of the present application, such as having a p.K580T mutation compared with the amino acid sequence of the wild-type NFE2L3 gene of a mouse (SEQ ID NO: 12).

[0044] MKLPKPWWAGGGLLQLTILLSLVGLRVDLDLFLPPPAAALWEELLPLCPTRPASASNPFSASEGWERTPLLPAKGRLLHEVRALGVPFIPRTRVDAWLVHSVATGNADGAHGLLGTAASSAVGDGGQSASAGGGDPRAAHSSPLAAEEEEEKAAEPTAQVPDAGGCGSQENGMLREKSEAVDHSSQQEENEEGVSAQAKSRQQSKTEEHKMACASAREAEKITEARNESHLHWSDTSFSLEDLFQLLSSQPEHSLEGISVEDIPPFLSSVCESVNSSAQNINLSQAISHDVNLHEAMLLYPNNTFRRDPSARSSQAQEPFLQLNPHTNPEQATPAMSLPPFDNQMRNLTSQDLLYDLDSNIFDGINLMSLATGFSPLEVSQLFEEPDSGLSLNSSYNSTSLTNSYRIYDGTVGYNSDLQSLCHDLGAVGGCYPEPHKHCHMDHRTIAGFHVSLECQQVFHDHTYHLQSGASEPTSESFAWSEKSQKTSGCLDNPDRNLSRDEQRAKALHIPFSVDEIVRMPVDSFNSMLSRYYLTDLQVSLIRDIRRRGKNKVAAQNCRKRKLDIILNLEDDICNLQAKKEALKNEQTQCSKAIDIMRQKLHGLHQDVFNRLRDDQGRPVNPSQYALQYSHDGTVLIVPKELISSGHKKEAPKGKRERRN (SEQ ID NO: 12).

[0045] In a tenth aspect, the present application provides a method for screening a mutant nucleic acid molecule. According to an embodiment of the present application, the method comprises: obtaining variant sequencing data of a test sample; based on a control sample, screening common variants and / or low-frequency variants of the variant sequencing data using bioinformatics methods; and determining the mutant nucleic acid molecule based on the common variants and / or low-frequency variants. Based on the method, a nucleic acid molecule with a mutation can be obtained, and based on the mutant nucleic acid molecule, a disease model (such as a myopic maculopathy model) can be constructed, which can be used for screening drugs for treating the aforementioned diseases.

[0046] According to an embodiment of the present application, the method described above can further include at least one of the following additional technical features:

[0047] According to an embodiment of the present application, the test sample satisfies at least one of the following conditions:

[0048] (1) age ≥ 18 years old;

[0049] (2) spherical equivalent refraction of either eye ≤ -6.00 D or axial length ≥ 26 mm;

[0050] (3) macular degeneration determined based on an optical coherence tomography (OCT) system.

[0051] According to an embodiment of the present application, the variant sequencing data includes at least one of SNP information and insertion-deletion (Indels) information.

[0052] According to an embodiment of the present application, the method for obtaining the variant sequencing data is not limited to whole genome sequencing, whole exome sequencing, SNP chip, and other technologies that can obtain variant data.

[0053] According to an embodiment of the present application, the control sample satisfies at least one of the following conditions:

[0054] (1) age ≥ 18 years old;

[0055] (2) -0.25 D ≤ spherical equivalent refraction ≤ +2.0 D;

[0056] (3) uncorrected visual acuity ≥ 20 / 25;

[0057] (4) educational background ≥ university degree.

[0058] According to an embodiment of the present application, the bioinformatics method for screening common variants and / or low-frequency variants of the variant sequencing data includes:

[0059] 1) quality control processing of the sequencing data;

[0060] 2) analyzing and processing the quality-controlled data meeting the following conditions to obtain common variant sites; and / or

[0061] a. minimum allele frequency (MAF) > 0.05;

[0062] 3) analyzing and processing the quality-controlled data meeting the following conditions to obtain low-frequency variant sites;

[0063] a. minimum allele frequency < 0.05;

[0064] b. having at least one of missense mutation and loss-of-function mutation.

[0065] According to an embodiment of the present application, the loss-of-function mutation includes at least one of nonsense mutation, splice-site mutation and frameshift mutation.

[0066] According to an embodiment of the present application, the method further includes constructing a mouse model and functionally verifying the screened mutant nucleic acid molecule.

[0067] For ease of understanding, the above method is exemplarily described below by screening of myopic maculopathy nucleic acid molecules.

[0068] 1) Selecting samples

[0069] Select samples of myopic maculopathy and normal control samples. In the identification of susceptibility genes of myopic maculopathy, the inclusion criteria of myopic maculopathy patients include: 1) age ≥ 18 years old; 2) spherical equivalent of any eye ≤ -6.00 D or axial length ≥ 26 mm; 3) macular degeneration determined based on optical coherence tomography (OCT) system. The control samples are selected from highly eye-using but non-myopic samples, and the inclusion criteria include: 1) age ≥ 18 years old; 2) -0.25 D ≤ spherical equivalent ≤ +2.0 D; 3) uncorrected visual acuity ≥ 20 / 25; 4) educational background ≥ university degree;

[0070] 2) Obtaining sample variant sequencing data

[0071] The foregoing obtaining method of variant sequencing data includes whole genome sequencing, whole exome sequencing and chip sequencing, etc.

[0072] For whole genome sequencing or whole exome sequencing data, fastq files of samples are obtained, and based on BWA alignment, picrad deduplication, GATK realignment, GATK variant detection, variant (SNPs and Indels) of samples are obtained, and low-confidence variants are filtered out to obtain high-confidence variants for subsequent analysis.

[0073] For chip sequencing, the binding of samples and probes is measured based on fluorescence or other detection markers on the chip to determine the base composition of each SNP site to obtain the genotype information of the sample.

[0074] 3) Determination of common variant sites and / or low-frequency variant sites

[0075] For common variants, principal component analysis (PCA) was performed on the genotype data of all samples using PLINK software. Logistic regression analysis was performed using PLINK, and common genetic variants (MAF>0.05) that may be associated with MM were explored by adjusting the first ten principal components (PCs) as covariates.

[0076] In terms of low-frequency variants, gene-based analysis of low-frequency variants was performed on low-frequency variants that may be harmful to find genes that may be associated with myopic maculopathy. The inclusion criteria include: 1) MAF<0.05; 2) missense mutations predicted to be deleterious or possibly deleterious by five software (LRT, MutationTaster, PolyPhen-2 HumDiv, PolyPhen-2 HumVar, SIFT); 3) loss-of-function mutations, including nonsense mutations, splice site mutations, and frameshift mutations.

[0077] In one specific example of the present application, it is determined based on the above method that four genes are likely to be associated with myopic maculopathy, including PRR35 (OR=Inf, P=0.0018), ATP2B2 (OR=3.29, P=0.0032), NFE2L3 (OR=4.18, P=0.0042), and LAMA5 (OR=2.97, P=0.0044).

[0078] 4) Functional verification

[0079] For the multiple potentially deleterious variants found in the four genes that may be associated with myopic maculopathy, homozygous knock-in mice were constructed to evaluate the effect of these missense mutations on myopia. The missense variants include p.P192L mutation in PRR35 gene, p.P894S mutation in ATP2B2 gene, p.K617T mutation in NFE2L3 gene, and p.R1560C mutation in LAMA5. Due to the differences between humans and mice in genes, the p.K617T mutation in NFE2L3 gene in humans corresponds to the p.K580T mutation in NFE2L3 in mice. Compared with wild-type mice, homozygous knock-in mice of the four genes p.K580T (NFE2L3) showed obvious myopia characteristics, indicating that the p.K580T site in the NFE2L3 gene is a pathogenic site of myopic maculopathy.

[0080] Additional aspects and advantages of the present application will be in part apparent and in part pointed out below in the description of embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0081] The above and / or additional aspects and advantages of the present application will become apparent and be readily appreciated from the following description of embodiments, taken in conjunction with the accompanying drawings.

[0082] Figure 1 is a Sanger verification result schematic diagram of a recurrently mutated site provided by an embodiment of the present application;

[0083] Figure 2 is a ball equivalent (D) result schematic diagram of a wild type and p.K580T (NFE2L3) homozygous insertion mouse provided by an embodiment of the present application. DETAILED DESCRIPTION

[0084] Embodiments of the present application are described below in detail, examples of which are shown in the accompanying drawings, in which the same or similar elements or elements having the same or similar functions are denoted by the same or similar reference numerals throughout. The embodiments described below by reference to the accompanying drawings are exemplary and are intended to explain the present application, and cannot be understood as limiting the present application.

[0085] In addition, the terms "first", "second", are only for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined with "first", "second" can explicitly or implicitly include at least one of the features. In the description of the present application, the meaning of "a plurality of" is at least two, for example, two, three, etc., unless otherwise explicitly and specifically limited.

[0086] In the present application, the term "amino acid" is represented by a single letter or a three-letter code, and has the following meanings: A: Ala (alanine); R: Arg (arginine); N: Asn (asparagine); D: Asp (aspartic acid); C: Cys (cysteine); Q: Gin (glutamine); E: Glu (glutamic acid); G: Gly (glycine); H: His (histidine); I: Ile (isoleucine); L: Leu (leucine); K: Lys (lysine); M: Met (methionine); F: Phe (phenylalanine); P: Pro (proline); S: Ser (serine); T: Thr (threonine); W: Trp (tryptophan); Y: Tyr (tyrosine); V: Val (valine).

[0087] The solutions of the present application will be explained hereinafter with reference to the embodiments. Those skilled in the art will appreciate that the embodiments described hereinafter are only used to explain the present application and should not be considered as limiting the scope of the present application. The specific techniques or conditions not mentioned in the embodiments are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be obtained by purchase.

[0088] Examples

[0089] 1.1 Sample inclusion criteria

[0090] The inclusion criteria for myopic maculopathy patients include: 1) age ≥ 18 years old; 2) spherical equivalent of any eye ≤ -6.00 D or axial length ≥ 26 mm; 3) macular degeneration determined based on optical coherence tomography (OCT) system.

[0091] The inclusion criteria for control samples include: 1) age ≥ 18 years old; 2) -0.25 D ≤ spherical equivalent ≤ +2.0 D; 3) uncorrected visual acuity ≥ 20 / 25; 4) educational background ≥ university degree;

[0092] The exclusion criteria for the two sample cohorts include: previous intraocular surgery or refractive surgery, corneal opacity, severe cataract, glaucoma, retinal diseases unrelated to high myopia (such as diabetic retinopathy, age-related macular degeneration and optic neuropathy), severe systemic diseases and poor image quality. The sample phenotypes are shown in Table 1.

[0093] Table 1 Sample phenotype information

[0094]

[0095]

[0096] 1.2 Sequencing data processing

[0097] To ensure data integrity, the initial processing steps included filtering of raw reads using SOAPnuke (v2.1.0) to eliminate adapters and low-quality sequences. Next, high-quality reads were aligned to the GRCh38 reference sequence using the Burrows-Wheeler Aligner (BWA v0.7.17). Duplicate reads were identified and removed using the Genome Analysis Toolkit (GATK v4.1.4.1). To further improve the accuracy and precision of variant calling, local realignment around insertions and deletions (indels) was performed using GATK, and base quality scores in the generated BAM files were recalibrated by GATK. SNVs and indels were identified using GATK HaplotypeCaller, and joint genotyping was performed by the GATK GenotypeGVCFs tool, following the recommended best practice guidelines.

[0098] 1.3 Variant quality control and sample quality control

[0099] To obtain high-quality sites, the following filtering steps were applied: 1) VQSR; 2) ensure mean sequencing depth of variants ≥8x for cases and controls; 3) ensure mean mapping quality root mean square ≥30; 4) strand bias: FS <5 and SOR <3; 5) allele balance: between 0.25 and 0.75; 6) run of di-nucleotide <6; 7) Hardy-Weinberg equilibrium test P-value ≥10 -6 .

[0100] To obtain highly credible samples, the following samples were excluded: 1) mean sequencing depth: <30x; 2) coverage distribution: less than 90% of the genome has a minimum of 10x coverage; 3) exclude samples with close relationships; 4) samples with abnormal GC content; 5) inbreeding coefficient; 6) PCA outliers.

[0101] In summary, a total of 697 individuals (403 case samples, 294 control samples) and 763,251 variants were left for subsequent analysis.

[0102] 1.4 Search for myopic maculopathy-associated susceptibility loci / gene

[0103] In terms of common variants, principal component analysis (PCA) was performed on the genotype data of all samples using PLINK software (v1.9). Subsequently, logistic regression analysis was performed using PLINK, and the top 10 principal components (PCs) were contributed for covariate adjustment to explore common genetic variants (MAF >0.05) that may be associated with MM. Due to the small sample size of the data, no loci associated with myopic maculopathy were found.

[0104] In terms of low-frequency variants, gene-based analysis of low-frequency variants was performed to find genes that may be associated with myopic maculopathy. The inclusion criteria for potentially harmful low-frequency variants were: 1) MAF < 0.05; 2) missense mutations predicted to be deleterious or possibly deleterious by five software (LRT, MutationTaster, PolyPhen-2 HumDiv, PolyPhen-2 HumVar, SIFT); 3) loss-of-function mutations: nonsense mutations, splice site mutations, frameshift mutations. It was found that the relative risk (Oddsratio, OR) of 4 genes (PRR35, ATP2B4, NFE2L3, LAMA5) was > 2 and P value < 0.005, which may be associated with myopic maculopathy (Table 2).

[0105] Table 2 Genes associated with myopic maculopathy

[0106]

[0107] 1.5 Disease state prediction

[0108] For each sample, the edit distance score was calculated for the potentially harmful low-frequency variants of the myopic maculopathy-related genes. The specific method is as follows: for the presence or absence of potentially harmful low-frequency variants of four susceptibility genes in individuals, the presence of mutations was recorded as 1 and the absence of mutations was recorded as 0. After constructing the scoring matrix, the data was randomly divided into a test set and a training set, and it was noted that the test set and the training set data had no overlap. Considering the small sample size, a 5-fold cross-validation method was used to divide the data into 5 parts, and each time 1 part was taken out as the test set and the rest as the training set. Then, a multilayer perceptron (MLP) neural network was used to train and predict the data, and the overall prediction accuracy was 61.87%.

[0109] 1.6 Experimental verification

[0110] Among the above four genes that may be associated with myopic maculopathy, the recurrent variants are the following four (see Table 3).

[0111] Table 3 Recurrent deleterious variants in four genes

[0112] Gene Position Risk allele Mutation Cases Controls OR P-value PRR35 16:563869 T p.P192L 0 / 11 / 393 0 / 0 / 294 Inf 3.51E-03 LAMA5 20:62327985 A p.R1560C 0 / 16 / 387 0 / 2 / 292 5.93 7.00E-03 ATP2B4 1:203721278 T p.P894S 0 / 28 / 375 0 / 7 / 287 2.99 8.43E-03 NFE2L3 7:26185548 C p.K617T 0 / 17 / 386 0 / 3 / 291 4.2 1.22E-02

[0113] To verify the effect of these four potentially deleterious low frequency missense mutations on refractive error, homozygous knock-in mice were constructed. The AT P2B4 (P895S), LAMA5 (R1565C) and NFE2L3 (K580T) heterozygous homozygous knock-in mouse strains were generated by CRISPR / Cas9 constructs and single-stranded oligonucleotide donor DNA injection into zygotes by homologous recombination. The RNA sequences are listed in Table 4. The A930017k11rik (P186L) mouse strain was generated by transgenic JM8A3 C57BL / 6 embryonic stem cells injected into blastocysts. Mice were maintained under a 12-hour light and 12-hour dark cycle and provided with adequate food and water.

[0114] Table 4 Primers for homozygous knock-in mice

[0115]

[0116]

[0117] To verify the knock-in effect of the corresponding mutations in the homozygous knock-in mice, Sanger sequencing was performed, and the results, as shown in Table 5, indicate that the corresponding site mutations do exist in the homozygous knock-in mice. Figure 1 To verify the effect of the mutations on the ocular characteristics of the mice, the refractive error and ocular biometry components were monitored every week. The results show that among the four mutation sites, the NFE2L3 gene p.K580T homozygous knock-in mice exhibit a significant myopia phenotype. Figure 2

[0118] The preferred embodiments of the present application are described in detail above, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be considered as disclosed by the present application and fall within the protection scope of the present application.

[0119] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any suitable manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the present specification and the features of the different embodiments or examples without contradiction.

[0120] ​Although the embodiments of the present application have been shown and described above, it is understood that the above-described embodiments are exemplary and are not to be construed as limiting the present application, and that changes, modifications, substitutions and variations can be made by those skilled in the art without departing from the scope of the present application.

Claims

1. A nucleic acid molecule, characterized in that, The nucleic acid molecule has a c.1850A>C mutation compared with SEQ ID NO:

1.

2. A primer, characterized in that, The primer is suitable for amplifying the nucleic acid molecule of claim 1.

3. The primer of claim 2, wherein, The primer has at least one of the nucleotide sequences shown in SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:

4.

4. A probe, characterized by The probe specifically recognizes a target sequence having a c.1850A>C mutation compared with SEQ ID NO:

1.

5. A kit characterized in that, Comprising: The primer of claim 2 or 3 and / or the probe of claim 4.

6. Use of the kit of claim 5 in diagnosing myopic maculopathy.

7. A method for nucleic acid typing for non-disease diagnostic purposes, characterized in that, Comprising: Obtaining at least a part of the genomic sequence information of the target object; Comparing the at least a part of the genomic sequence information with a reference sequence to determine whether the genomic sequence has a c.1850A>C mutation, the reference sequence at least including the site information of position 1850 in SEQ ID NO:

1.

8. A method for genotyping for non-disease diagnostic purposes, characterized by, Comprising: (1) extracting a nucleic acid sample of a biological sample to determine the sequence of the nucleic acid sample; (2) determining the sequence of the nucleic acid sample to compare the sequence of the nucleic acid sample; (3) comparing the sequence of the nucleic acid sample with SEQ ID NO:1 to determine whether the nucleic acid sample sequence has a c.1850A>C mutation, and further to determine whether the nucleic acid molecule is a mutant; The gene is selected from NFE2L3; Optionally, the step (2) further comprises: amplifying the NFE2L3 gene using primers to obtain an NFE2L3 gene amplification product; adding the amplification product to a linker to obtain a sequencing library; sequencing the sequencing library to determine the sequence of the nucleic acid sample; Optionally, the primer has a nucleotide sequence as shown in SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:

4.

9. A genotyping system for non-disease diagnostic purposes, characterized by, Comprising: a nucleic acid sample extraction device for extracting a nucleic acid sample from a biological sample; a nucleic acid sequence determination device connected to the nucleic acid extraction device for analyzing the nucleic acid sample to determine the nucleic acid sequence of the nucleic acid sample; a judging device connected to the nucleic acid sequence determination device for comparing the nucleic acid sequence of the nucleic acid sample with SEQ ID NO:1 to determine whether the nucleic acid sequence has a c.1850A>C mutation, and further to determine whether the nucleic acid molecule is a mutant; The gene is selected from NFE2L3; Optionally, the nucleic acid sequence determination device further comprises: a target gene amplification unit for amplifying the NFE2L3 gene using primers to obtain an NFE2L3 gene amplification product; a sequencing library construction unit connected to the target gene amplification unit for adding the amplification product to a linker to obtain a sequencing library; a sequencing unit connected to the sequencing library construction unit, which sequences the sequencing library as input in order to obtain sequencing data of the nucleic acid sample; Optionally, the primer has a nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO:

4.

10. An isolated polypeptide, comprising, The isolated polypeptide has a p.617K>T mutation compared to SEQ ID NO: 5.

Images