Application of exosome miR-30e-5p and / or miR-34c-5p in detection of blood brain barrier damage and severe enterovirus infection

Abstract

The invention relates to the field of biological medicine, in particular to application of exosome miR-30e-5p and / or miR-34c-5p in detection of blood brain barrier damage and severe enterovirus infection. The exosome miR-30e-5p and / or miR-34c-5p provided by the invention is used as the marker, has high specificity and sensitivity in blood brain barrier damage detection, and can be used for early recognition of blood brain barrier damage and severe enterovirus infection. The invention proves that the miR-30e-5p and / or miR-34c-5p inhibitor reduces the permeability of the blood brain barrier by recovering the activity of the Notch pathway, and is expected to become a drug target for repairing structural damage, functional damage or inflammatory damage of the blood brain barrier.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and particularly relates to application of exosome miR-30e-5p and / or miR-34c-5p in detection of blood-brain barrier destruction and severe enterovirus infection. BACKGROUND

[0002] The blood-brain barrier (BBB) has the ability to selectively control the passage of substances from blood into brain tissue, and the BBB prevents harmful substances and pathogens from entering brain tissue while ensuring that essential nutrients and oxygen can be delivered to nerve cells, thereby maintaining the homeostasis of the central nervous system. The blood-brain barrier is mainly composed of brain microvascular endothelial cells (BMEC), tight junction proteins, basement membrane and podocytes. Among them, brain microvascular endothelial cells are the core of the blood-brain barrier, and their tight junctions prevent most substances from passing through the vascular wall. Tight junction proteins are key proteins that connect between brain microvascular endothelial cells, making the vascular wall impermeable to water. Factors that damage the blood-brain barrier include inflammation, infection, trauma, cerebrovascular disease, immune mediators, drugs and chemicals, and other physiological environmental factors. These factors can cause an increase in blood-brain barrier permeability, allowing harmful substances, pathogens or drugs to enter brain tissue, triggering inflammation, infection or other neurological diseases. Therefore, protecting and maintaining the integrity of the blood-brain barrier is crucial for preventing and treating diseases related to it.

[0003] The Notch signaling pathway is a signaling pathway that plays a key role in cell-to-cell communication. It plays an important role in biological processes such as embryonic development, cell fate determination, adult tissue maintenance and regeneration. The Notch signaling pathway is composed of Notch receptors and their ligands, including Notch1 to Notch4 receptors and Delta-like (DLL1, DLL3 and DLL4) and Jagged (JAG1 and JAG2) two types of ligands. Current research shows that the Notch signaling pathway promotes the transformation of vascular endothelial cells to the blood-brain barrier in the development of brain microvascular endothelial cells (BMEC). In addition, the Notch signaling pathway is also involved in the development and functional regulation of other types of cells in the blood-brain barrier, such as astrocytes.

[0004] MicroRNA(miRNA) is a class of short-chain non-coding RNA molecules that can cleave or inhibit translation of the mRNA of protein-coding genes. The current research on the interaction between miRNA and Notch signaling pathway is still in its infancy. Some studies have shown that specific miRNAs may regulate key components in the Notch signaling pathway, and some miRNAs may directly target Notch receptors or their downstream effectors, thereby changing the intensity and duration of Notch signaling. This interaction may play an important role in various biological processes such as heart development, angiogenesis, and cancer. Therefore, it is of great significance to develop miRNA markers that can predict BBB disruption and early identify severe tendencies.

[0005] Currently, clinical assessment of BBB integrity mainly relies on imaging and biochemical detection techniques. Imaging methods such as dynamic contrast-enhanced magnetic resonance imaging(DCE-MRI) can indirectly reflect BBB damage by contrast agent leakage, but they require higher equipment and detection costs, and need to be combined with biochemical indicators for comprehensive judgment. In biochemical detection, cerebrospinal fluid albumin quotient(QAlb, i.e. cerebrospinal fluid to serum albumin concentration ratio x 10 3 ) is the gold standard for evaluating BBB permeability. However, QAlb has a large molecular weight(67kDa), and its leakage only reflects abnormal function of macromolecular barriers, and cannot sensitively represent changes in BBB small molecule permeability. QAlb value increases physiologically with age, leading to insufficient specificity. In addition, short-term BBB damage may not be detected by QAlb, but irreversible damage to the central nervous system has already occurred. Therefore, it is of great significance to develop new biomarkers with high sensitivity and high specificity for early diagnosis of BBB-related diseases. SUMMARY

[0006] In view of this, the present application provides the application of exosome miR-30e-5p and / or miR-34c-5p in detecting blood-brain barrier damage and severe enterovirus infection.

[0007] The technical solution of the present application is as follows:

[0008] In the first aspect, the present application provides the application of exosome miR-30e-5p and / or miR-34c-5p in preparing a product for detecting blood-brain barrier damage.

[0009] In some specific embodiments, the exosomal miR-30e-5p and / or miR-34c-5p as a marker can detect the blood-brain barrier damage caused by enterovirus infection. Further, the enterovirus is Enterovirus A71 (EV-A71). The pathological process of severe virus infection is related to the degree of blood-brain barrier damage. When the expression level of the exosomal miR-30e-5p and / or miR-34c-5p marker is higher than the detection threshold, it can be judged that the virus infection is severe, and the severe prediction can be made in the early stage of the disease course.

[0010] In some specific embodiments, the blood-brain barrier damage includes at least one of structural damage, functional damage and inflammatory damage of the blood-brain barrier.

[0011] In some specific embodiments, the product is used to detect at least one of brain trauma, stroke, brain tumor, Alzheimer's disease, cerebral hemorrhage, cerebral hypoxia, cerebral edema, encephalitis, meningitis, multiple sclerosis, acute disseminated encephalomyelitis, autoimmune encephalitis, viral encephalitis, vascular dementia and Parkinson's disease.

[0012] In some specific embodiments, the exosome source includes at least one of blood, saliva and sputum.

[0013] In some specific embodiments, the product components include: a detection reagent for detecting exosomal miR-30e-5p and / or miR-34c-5p by real-time fluorescent quantitative PCR and / or digital PCR. Further, the product components further include: an exosome separation reagent and / or an exosomal miRNA extraction reagent.

[0014] In a second aspect, the present application provides a kit for early diagnosis of severe enterovirus infection, the kit components include: primers for detecting the expression levels of exosomal miR-30e-5p and miR-34c-5p, an exosome separation reagent, an exosomal miRNA extraction reagent, a reverse transcription reagent and a real-time fluorescent quantitative PCR reagent; the pathological process of severe enterovirus infection is related to the degree of blood-brain barrier damage. Further, the virus is Enterovirus A71.

[0015] The present application has the following beneficial effects:

[0016] The application proves that miR-30e-5p and miR-34c-5p directly target and combine the 3'UTR region of Notch1 mRNA, inhibit the translation activity by luciferase reporter experiment, and the inhibitor can reverse the effect and restore the expression of Notch1. miR-30e-5p and miR-34c-5p also significantly down-regulate the expression of Notch1 and tight junction protein in BMEC, leading to the destruction of BBB; and the inhibitor can repair the integrity of BBB.

[0017] The application proves that the expression levels of exosome miR-30e-5p and / or miR-34c-5p are positively correlated with the severity of viral infection in patients, and the AUC value of joint diagnosis is as high as 0.97, which can be used as a marker for early identification of blood-brain barrier damage and viral infection in severe cases.

[0018] The research of the application shows that the miR-30e-5p and / or miR-34c-5p inhibitor can restore the activity of the Notch signaling pathway and reduce the permeability of the BBB, which provides experimental basis for developing small molecule inhibitor drugs targeting miRNA, and is suitable for BBB dysfunction caused by inflammation, infection or brain injury. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is a schematic diagram of construction of luciferase reporter gene plasmid of Notch1 mRNA 3'UTR and the complementation of miR-30e-5p, miR-34c-5p and the predicted NOTCH1 mRNA 3'UTR binding site;

[0020] Figure 2 is the detection result of the effect of miR-30e-5p and miR-34c-5p mimics on the luciferase reporter gene of Notch1 mRNA 3'UTR (the abscissa respectively corresponds to different concentrations of miR-30e-5p and miR-34c-5p mimics 0, 20, 50, 100 nM);

[0021] Figure 3 is the detection result of the effect of miR-30e-5p and miR-34c-5p inhibitors on the luciferase reporter gene of Notch1 mRNA 3'UTR (the abscissa respectively corresponds to different concentrations of miR-30e-5p and miR-34c-5p inhibitors 0, 20, 50, 100 nM);

[0022] Figure 4are the detection results of the expression of Notch1 and downstream connecting proteins of BMEC, wherein: A is the detection result of the effect of miR-30e-5p and miR-34c-5p mimics on the expression of Notch1 and downstream connecting proteins of BMEC; B is the detection result of the effect of miR-30e-5p and miR-34c-5p inhibitors on the expression of Notch1 and downstream connecting proteins of BMEC;

[0023] Figure 5 are the schematic diagram and detection results of BBB in vitro model experiment, wherein: A is the schematic diagram of BBB in vitro model experiment; B is the detection result of the effect of miR-30e-5p and miR-34c-5p mimics on the permeability of BMEC blood brain barrier in vitro model; C is the detection result of the effect of miR-30e-5p and miR-34c-5p inhibitors on the permeability of BMEC blood brain barrier in vitro model (the abscissa in B and C respectively corresponds to different concentrations of miR-30e-5p and miR-34c-5p mimics, miR-30e-5p and miR-34c-5p inhibitors 0, 20, 50, 100 nM);

[0024] Figure 6 are the expression results of miR-30e-5p and miR-34c-5p in patient blood exosomes and ROC analysis, wherein: A is the detection result diagram of the relative expression amount of miR-30e-5p in patient blood exosomes; B is the detection result diagram of the relative expression amount of miR-34c-5p in patient blood exosomes; C is the Receiver Operating Characteristic Curve (ROC) analysis result diagram of miR-30e-5p and miR-34c-5p in patient blood exosomes. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. The specific technologies or conditions not specified in the examples are carried out according to the technologies or conditions described in the literature in the art or according to the product instructions.

[0026] The materials and reagents used in the experiments of the present application include the following:

[0027] HEK293T cells were obtained from China Typical Culture Collection Center (CCTCC) (Wuhan, China); luciferase reporter plasmid (pCMV-Tag2A-Luc) was obtained from Wuhan University Key Laboratory; BMEC cells were obtained from American Type Culture Collection (ATCC); DMEM medium and fetal bovine serum (FBS) were purchased from GIBCO company;

[0028] miR-30e-5p mimic: UGUAAACAUCCUACACUCUCAGC (SEQ ID NO: 3), ID: MIMAT0000692, purchased from Shanghai Sangon Biological Company; miR-34c-5p mimic: UGGCAGUGUCUUAGCUGGUUGU (SEQ ID NO: 4), ID: MIMAT0000686, purchased from Shanghai Sangon Biological Company; miR-30e-5p inhibitor: GCUGAGAGUGUAGGAUGUUUACA (SEQ ID NO: 5), purchased from Shanghai Sangon Biological Company; miR-34c-5p inhibitor: ACAACCAGCUAAGACACUGCCA (SEQ ID NO: 6), purchased from Shanghai Sangon Biological Company;

[0029] DMSO was purchased from Sigma company; EV71 VP1 antibody was purchased from Abnova company in Taiwan, China; HRP luminescent substrate reaction solution was purchased from Bio-Rad company; sterile PBS solution was purchased from Hyclone company; CCK8 (Cell Counting Kit-8) activity detection kit was purchased from Dojindo company in Japan; crystal violet and low-melting-point agarose were purchased from Shanghai Sangon Biological Company; EV713C antibody was purchased from Wuhan Aibotaike Biological Company; dsRNA mouse primary antibody was purchased from Scicons company in Hungary; DAPI was purchased from Roche company; goat anti-mouse Cy3 fluorescent secondary antibody was purchased from Wuhan Sanying Biological Company.

[0030] The instruments used in the experiments of the present application include the following:

[0031] Multifunctional enzyme label instrument was purchased from Thermo Fisher company in the United States; fluorescent inverted microscope was a product of Nikon company in Japan; cell incubator was a product of Thermo Fisher company; multi-label microwell plate reader and high-content cell analyzer were purchased from PerkinElmer company; cell incubator was a product of Thermofisher company; bioluminescence instrument was purchased from Fujifilm company in Japan; fluorescent confocal microscope was a product of Olympus company in Japan.

[0032] Example 1 Construction of luciferase reporter gene plasmid of Notch1 mRNA 3'UTR

[0033] To further explore the inhibitory effect of miR-30e-5p and miR-34c-5p mimics on Notch1 mRNA in the Notch signaling pathway, and based on this targeted inhibition, to further verify how the miR-30e-5p and miR-34c-5p inhibitors restore the translation activity of the inhibited Notch1 mRNA by the absence of the activity of endogenous miR-30e-5p and miR-34c-5p, the inventors designed the following experiment: The 3' untranslated region (3'UTR) of Notch1 mRNA was connected with the luciferase reporter gene, and the luciferase reporter gene plasmid of Notch1 mRNA 3'UTR (CMV promoter-Luc-Notch1-3'UTR) was successfully constructed. The construction of this plasmid provides an important experimental tool for subsequent research, which helps us to more accurately understand the mechanism of the influence of these miRNAs and their inhibitors on the Notch signaling pathway.

[0034] In the examples, the inventors first designed primers for the target fragment (3' untranslated region of Notch1 mRNA), and the ligation product of the target fragment and the vector (luciferase reporter gene plasmid vector pCMV-Tag2A-Luc) was transformed into E. coli competent DH5α. The transformants were subjected to colony identification and sequencing verification, and the bacteria were preserved and the plasmid was extracted. The pCMV-Tag2A-Luc reporter vector is constructed based on the commercialized pCMV-Tag2A plasmid, which is purchased from Agilent Company (formerly Stratagene, catalog number: 211172), and the structure and sequence information are detailed in the product manual provided by Agilent (pCMV-Tag Vectors Instruction Manual, Catalog#211170). The pCMV-Tag2A plasmid contains CMV promoter, N-terminal Flag tag and multiple cloning site (MCS) functional elements.

[0035] In the present application, the pCMV-Tag2A-Luc vector was constructed by inserting the luciferase coding sequence into the multiple cloning site of pCMV-Tag2A. The luciferase sequence was derived from the pGL3-Basic vector (Promega Company), and was cloned into the vector after double digestion with BamHI and EcoRI, and was verified correct by Sanger sequencing. The specific experimental steps and experimental results are as follows:

[0036] 1.1 Experimental steps

[0037] (1) Design primers for the target fragment:

[0038]

[0039]

[0040] (2) The target fragment was obtained by cDNA library, and the reaction system was as follows:

[0041] Total Volume 50 μL Template 1 μL KOD enzyme 1 μL 10 x PCR buffer 5 μL 2 mM dNTP 5 μL Forward primer (10 μM) 1 μL Reverse primer (10 μM) 1 μL Mg2SO4 3 μL ddH2O 32 μL

[0042] (3) Reaction procedure

[0043]

[0044] (4) Linearization of the vector pCMV-Tag2A-Luc was performed using double enzyme digestion at 37°C in a water bath for 1 h, and the reaction system was as follows:

[0045] Reagent Volume pCMV-Tag2A-Luc 3 μg 10 x rCutSmart Buffer 5 μL EcoRI-HF 1 μL Hind III 1 μL ddH2O Make up to 50 μL

[0046] (5) 1% agarose gel was prepared, electrophoresis was performed at a constant voltage of 120 V, and after the bromophenol blue indicator ran to the appropriate distance, the electrophoresis was stopped, and the correct size of the gel strip was cut with a UV gel imaging instrument for photographing and saving, and a knife was used to cut the correct size of the gel strip for the purpose of fragment purification and recovery.

[0047] (6) The DNA solution was recovered using a special gel recovery kit.

[0048] (7) Seamless ligation: the reaction system was prepared on ice:

[0049] Reagent Volume 5 x CE II Buffer 4 μL Linearized cloning vector 50 to 200 ng Insert of interest 20 to 200 ng Exnase TM II]] 1 μL ddH2O Make up to 20 μL

[0050] After preparation, mix evenly with a pipette, react at 37°C for 30 min, immediately transfer to ice water bath for 5 min, and the product can be directly used for transformation.

[0051] (8) Transformation of E. coli DH5α competent cells, picking single colony, culturing in kanamycin LB liquid medium at 37°C for 12-16 h, colony identification and sequencing verification of the transformants, and extraction of plasmid using a plasmid extraction kit.

[0052] 1.2 Experimental results

[0053] The construction of the luciferase reporter gene plasmid of Notch1 mRNA 3'UTR is shown in Figure 1 In addition Figure 1 The complementarity of miR-30e-5p, miR-34c-5p and the predicted NOTCH1 3'UTR binding site is also shown.

[0054] Example 2 Detection of the targeting inhibition of miR-30e-5p and miR-34c-5p mimics on luciferase reporter gene of Notch1 mRNA 3'UTR

[0055] In this example, HEK293T cells were transfected with different concentrations of miR-30e-5p or miR-34c-5p (or miR-NC, negative control) and CMV promoter-Luc-Notch1-3'UTR (luciferase reporter gene plasmid of Notch1 mRNA 3'UTR), and then luciferase detection was performed to determine the effect of miR-30e-5p and miR-34c-5p mimics on the expression of luciferase reporter gene of Notch1 mRNA 3'UTR. The specific experimental steps and experimental results are as follows:

[0056] 2.1 Experimental steps

[0057] (1) HEK293T cells were seeded in a 24-well plate, and the cell seeding density was 8.0 x 10 4 , and the culture conditions were 37℃, 5% CO2, and the cells were adherent to the wall until the cell confluence reached 80% before transfection.

[0058] (2) Before transfection, the culture medium was replaced with 900 μL of serum-free DMEM per well. CMV promoter-Luc-Notch1-3'UTR (0.1 μg) was transfected into cells with miR-NC (0, 20, 50, 100 nM), miR-30e-5p (0, 20, 50, 100 nM), and miR-34c-5p (0, 20, 50, 100 nM), respectively. Lipo2000 reagent was used for transfection, and after transfection, the cells were incubated at 37℃ in a 5% CO2 cell incubator for 6h, and then the complete culture medium was replaced and incubated for 48h.

[0059] (3) Add 10 mL of luciferase detection buffer to the freeze-dried luciferase detection substrate bottle to prepare luciferase detection reagent (LAR). Aliquot into working aliquots and store unused LAR at -80℃. Equilibrate to room temperature before each use.

[0060] (4) Remove the growth medium from the cultured cells. Rinse the cells with PBS, gently manipulate to maintain cell numbers, and aspirate as much of the PBS wash as possible. Add 800 μL of 1 x lysis reagent PLB per well, and lyse for 30 min at 4℃ on a shaker.

[0061] Collect the cell lysate and aliquot into 200 μL PCR tubes.

[0062] (5) Take 100 μL LARII fluorescent substrate into a black 96-well plate, take 10 μL cell lysate into the 96-well plate, mix well, and quickly read the fluorescence intensity on a multifunctional microplate reader.

[0063] 2.2 Experimental results

[0064] The results are shown in Table 1. Figure 2 As shown in Table 1, miR-30e-5p and miR-34c-5p at concentrations of 20, 50, and 100 nM had a significant inhibitory effect on the luciferase reporter gene expression of Notch1 mRNA 3'UTR, and the inhibitory effect was enhanced with increasing concentration.

[0065] Example 3: Detection of the effect of miR-30e-5p and miR-34c-5p inhibitors on the luciferase reporter gene of Notch1 mRNA 3'UTR

[0066] In this example, HEK293T cells were transfected with different concentrations of miR-30e-5p inhibitors or miR-34c-5p inhibitors (or miR-NC inhibitors) and CMV promoter-Luc-Notch1-3'UTR (luciferase reporter gene plasmid of Notch1 mRNA 3'UTR), and then luciferase detection was performed to determine the effect of miR-30e-5p and miR-34c-5p inhibitors on the luciferase reporter gene expression of Notch1 mRNA 3'UTR. The specific experimental steps and experimental results are as follows:

[0067] 3.1 Experimental steps

[0068] (1) HEK293T cells were seeded in a 24-well plate at a cell seeding density of 8.0 x 10 4 , and the culture conditions were 37℃, 5% CO2. After adhering, the cells were cultured to 80% confluence for transfection.

[0069] (2) Before transfection, the culture medium was replaced with 900 μL serum-free DMEM per well. CMV promoter-Luc-Notch1-3'UTR (0.1 μg) was transfected into cells with miR-NC inhibitors (0, 20, 50, 100 nM), miR-30e-5p inhibitors (0, 20, 50, 100 nM), and miR-34c-5p inhibitors (0, 20, 50, 100 nM), respectively. Lipo2000 reagent was used for transfection. After transfection, the cells were incubated at 37℃ in a 5% CO2 cell incubator for 6 h, and then the complete culture medium was replaced and the cells were cultured for another 48 h.

[0070] (3) Add 10 mL of luciferase detection buffer to the lyophilized luciferase detection substrate vial to prepare the luciferase detection reagent (LAR). Aliquot into working aliquots and store unused LAR at –80°C. Equilibrate to room temperature before each use.

[0071] (4) Remove the growth medium from the cultured cells. Wash the cells with PBS, handling gently to maintain cell count, and aspirate as much PBS wash buffer as possible. Add 800 μL of 1× lysis reagent PLB to each well and lyse on a shaker at 4°C for 30 min. Collect the cell lysis buffer and aliquot into 200 μL PCR tubes.

[0072] (5) Pipette 100 μL of LARII fluorescent substrate into a black 96-well plate, add 10 μL of cell lysate into the 96-well plate and mix well. Then quickly read the fluorescence intensity using a multi-functional microplate reader.

[0073] 3.2 Experimental Results

[0074] like Figure 3 As shown, both miR-30e-5p and miR-34c-5p inhibitors at concentrations of 20, 50, and 100 nM upregulated the expression of the luciferase reporter gene at the Notch1 mRNA 3'UTR, with the upregulation effect strengthening with increasing concentration. These results indicate that the miR-30e-5p and miR-34c-5p inhibitors target and inhibit the activity of endogenous miR-30e-5p and miR-34c-5p, leading to a loss of endogenous miR-30e-5p and miR-34c-5p binding to Notch1 mRNA, thereby enhancing the activity of the Notch signaling pathway.

[0075] Example 4: Detection of the effects of miR-30e-5p and miR-34c-5p mimics on the expression of Notch1 and downstream linker proteins in BMEC.

[0076] In this embodiment, BMEC cells were treated with miR-30e-5p or miR-34c-5p mimics at different concentration gradients. The expression of Notch1 (Notch receptor), downstream conjugate protein (ZO-1 / β-catenin), and β-actin (internal control) in BMEC cells was detected by Western blotting to confirm the effects of miR-30e-5p and miR-34c-5p mimics on the expression of Notch1 and downstream conjugate proteins in BMEC cells.

[0077] BMEC is human brain microvascular endothelial cell, which is the main component of blood brain barrier (BBB). Notch1 is a Notch signal receptor protein, the expression level of Notch1 indicates the degree of activation of Notch signal pathway, the expression of ZO-1, VE-cadherin and β-catenin is related to the degree of tight junction between BMEC cells, and the integrity of BMEC refers to the firmness of intercellular junction and the sealing of intercellular space, which is mainly maintained by junction proteins such as ZO-1, VE-cadherin and β-catenin. For example, zonula occludens (ZOs, including ZO-1) forms a tight junction between BMEC, filling the intercellular gap, thereby limiting the permeability of paracellular. The expression and distribution of ZO-1, VE-cadherin, β-catenin and other junction proteins are essential to maintain the integrity of blood brain barrier. Therefore, detecting the expression level of these junction proteins can evaluate the integrity of BMEC, and the expression of these proteins also directly affects the selective permeability of BMEC. By evaluating the integrity and selective permeability of BMEC, the integrity and selective permeability of blood brain barrier can also be directly reflected. The specific experimental steps and experimental results are as follows:

[0078] 4.1 Experimental steps

[0079] (1) BMEC cells were seeded in 96-well cell culture plates at a density of 1×10 6 cells / well, using DMEM medium containing 10% FBS, and adding 1% penicillin and streptomycin. Incubate in a 37℃, 5% CO2 humidified incubator. When the confluence of BMEC cells reaches about 80%, prepare for transfection.

[0080] (2) Dilute the target miR-30e-5p and miR-34c-5p mimics and Lipo2000 with 200 μL Opti-MEM, respectively, and the mass volume ratio of miR-30e-5p and miR-34c-5p mimics and Lipo2000 is 1:3, then mix the diluted miR-30e-5p and miR-34c-5p mimics and Lipo2000, and place at room temperature for 15 min.

[0081] (3) Replace the DMEM medium of BMEC cells, then add the miR-30e-5p and miR-34c-5p mimics Lipo2000 mixture to the cell culture dish, mix gently, and continue to culture in a 37℃ incubator.

[0082] (4) After 6-8h of transfection, replace the complete culture medium, and collect the cells 36h later for Western blotting to detect protein expression.

[0083] The steps of the Western blot detection are as follows:

[0084] (i) Discard the cell culture medium, rinse the cell sample with PBS buffer, digest the cells with 0.25% trypsin, resuspend and collect into a 1.5 mL EP tube, centrifuge at 3000 x g for 5 min, remove the supernatant to obtain a cell pellet, use RIPA cell lysis buffer containing 1% cocktail protease inhibitor, gently blow the cell pellet, incubate on ice for 30 min, use an ultrasonic cell disruptor at 30 Hz to break the cells until the lysis buffer is clear. After ultrasonic disruption, the sample is centrifuged at 12000 x g for 10 min in a high-speed centrifuge at 4°C, and the supernatant is transferred to a new 1.5 mL EP tube.

[0085] (ii) Determine the protein concentration of different protein samples using BCA protein quantification reagent, prepare protein standards and BCA working solution, measure the absorbance at A562 wavelength using a microplate reader, draw a standard curve, and calculate the protein concentration according to the sample volume. Take 40 μg of total protein for each sample, perform SDS-PAGE protein gel electrophoresis at 100 V, and stop the electrophoresis when the protein sample is electrophoresed to the bottom of the separation gel.

[0086] (iii) Prepare the transfer buffer, and prepare the gel, NC membrane, transfer filter paper and filter cotton in the order of negative electrode-filter cotton-transfer filter paper-gel-NC membrane-transfer filter paper-filter cotton-positive electrode in a sandwich method, insert them into the transfer slot, and then transfer them at 200 mA constant current for 1.5 h in a 4°C refrigerator.

[0087] (iv) After transfer, cut the desired size along the protein marker, add TBST buffer to prepare 10% skimmed milk blocking solution, shake on a shaker at room temperature for 1 h. Then wash off the skimmed milk with TBST solution, cut the NC membrane according to the size of the protein molecule, and incubate Notch1, ZO-1, β-catenin and the internal reference β-actin primary antibodies at 4°C on a vertical shaker overnight.

[0088] (v) Discard the I antibody solution, rinse the PBST buffer on the shaker for 2 times, each for 10 min. Prepare the II antibody by diluting 2% skimmed milk powder in TBST buffer at 1:5,000, incubate the NC membrane at room temperature for 1 h. Rinse with TBST buffer for 5 times, each for 5 min. Absorb the water on the surface of the NC membrane with filter paper, develop the color for 5 min in the dark with the luminescent substrate mixture. Absorb the color developing solution on the surface of the NC membrane with filter paper, and expose it to light in the chemiluminescence imager to obtain and save the image.

[0089] 4.2 Experimental results

[0090] As Figure 4As shown in FIG. 5, the expression of Notch1 and the expression of the junction protein β-catenin of BMEC were significantly inhibited by miR-30e-5p at the concentration of 50 nM and 100 nM, and the expression of the junction protein ZO-1 of BMEC was significantly inhibited by miR-3 at the concentration of 100 nM. The expression of Notch1 and the expression of the junction protein β-catenin of BMEC were also significantly inhibited by miR-34c-5p at the concentration of 50 nM and 100 nM, and the expression of the junction protein ZO-1 of BMEC was significantly inhibited by miR-34c-5p at the concentration of 100 nM. That is, the expression of Notch1 and the downstream junction protein of BMEC was down-regulated by the miR-30e-5p and miR-34c-5p mimics.

[0091] Example 5: Detection of the effect of miR-30e-5p and miR-34c-5p inhibitors on the expression of Notch1 and the downstream junction protein of BMEC

[0092] In this example, BMEC cells were treated with miR-30e-5p inhibitors or miR-34c-5p inhibitors at different concentration gradients, and the expression of Notch1 (Notch receptor), downstream junction protein (ZO-1 / β-catenin) and β-actin (internal reference) of BMEC was detected by immunoblotting to confirm the effect of miR-30e-5p and miR-34c-5p inhibitors on the expression of Notch1 and the downstream junction protein of BMEC. The specific experimental steps and experimental results are as follows:

[0093] 5.1 Experimental steps

[0094] (1) BMEC cells were seeded in a 96-well cell culture plate at a density of 1 x 10 6 cells / well, using 10% FBS DMEM medium containing 1% penicillin and streptomycin. The cells were cultured in a humidified incubator at 37°C and 5% CO2. When the confluence of BMEC cells reached about 80%, transfection was prepared.

[0095] (2) 200 μL of Opti-MEM was used to dilute the target miR-30e-5p and miR-34c-5p inhibitors and Lipo2000, respectively, and the mass volume ratio of miR-30e-5p and miR-34c-5p inhibitors and Lipo2000 was 1:3. Then the diluted mimic and Lipo2000 were mixed and incubated at room temperature for 15 min.

[0096] (3) BMEC cells were replaced with DMEM medium, and then miR-30e-5p and miR-34c-5p inhibitor Lipo2000 mixture was added dropwise to the cell culture dish, mixed gently, and placed in a 37°C incubator for continuous culture.

[0097] (4) After transfection for 6-8 h, the complete culture medium was replaced, and the cells were collected after 36 h for protein expression detection by immunoblotting.

[0098] The protein immunoblotting detection step is as follows:

[0099] (i) Discard the cell culture medium, rinse the cell sample with PBS buffer, digest the cells with 0.25% trypsin, resuspend and collect in a 1.5 mL EP tube, centrifuge at 3,000 x g for 5 min, aspirate the supernatant to obtain the cell pellet, use RIPA cell lysis solution containing 1% cocktail protease inhibitor, gently blow the cell pellet, incubate on ice for 30 min, use an ultrasonic cell disruptor at 30 Hz to break up the lysis solution until it is clear. After ultrasonic disruption, the sample was centrifuged at 12,000 x g for 10 min in a high-speed centrifuge at 4°C, and the supernatant was transferred to a new 1.5 mL EP tube.

[0100] (ii) Determine the protein concentration of different protein samples using BCA protein quantification reagent, prepare protein standards and BCA working solution, measure the absorbance at A562 wavelength using a microplate reader, and plot the standard curve. Put the sample into the regression curve, calculate the protein concentration according to the sample volume, and take 40 μg of total protein for SDS-PAGE protein gel electrophoresis at 100 V. Stop electrophoresis when the protein sample is electrophoresed to the bottom of the separation gel.

[0101] (iii) Prepare the transfer buffer, prepare the gel, NC membrane, transfer filter paper and filter cotton in the sandwich method from the negative electrode-filter cotton-transfer filter paper-gel-NC membrane-transfer filter paper-filter cotton-positive electrode direction, insert into the transfer slot, then transfer at 200 mA constant current in a 4°C refrigerator for 1.5 h.

[0102] (iv) After transfer, cut the desired size along the protein marker, add TBST buffer to prepare 10% skimmed milk blocking solution, shake on a shaker at room temperature for 1 h. Then wash off the skimmed milk with TBST solution, cut the NC membrane according to the size of the protein molecule, and incubate Notch1, ZO-1, β-catenin and the internal reference β-actin primary antibody, respectively, on a 4°C vertical shaker overnight.

[0103] (v) Discard the primary antibody solution, and wash the NC membrane with PBST buffer for 2 times, 10 min each time. The secondary antibody is prepared with TBST buffer containing 2% skim milk at 1:5000, and incubate the NC membrane at room temperature for 1 h. Wash the NC membrane with TBST buffer for 5 times, 5 min each time. Absorb the surface water of the NC membrane with filter paper, and develop the color for 5 min under the protection of light with the luminescent substrate mixture. Absorb the surface color developing solution of the NC membrane with filter paper, and expose the NC membrane to the chemiluminescence imager to obtain and save the image.

[0104] 5.2 Experimental results

[0105] The results are shown in Table B in the Figure 4 miR-30e-5p and miR-34c-5p inhibitors up-regulate the expression of Notch1 and downstream connecting proteins in BMECs.

[0106] Example 6: Detection of the effect of miR-30e-5p and miR-34c-5p mimics on the permeability of the in vitro BBB model of BMECs

[0107] In this example, the Transwell device is used to establish the in vitro BBB model, as shown in Table A in the Figure 5 The BMEC cells on the chamber membrane have no direct physical contact with the lower chamber. The cells are treated with different concentrations of miR-30e-5p and miR-34c-5p mimics, and FITC-labeled dextran is added to each chamber to detect the fluorescence value in the lower chamber to confirm the effect of miR-30e-5p and miR-34c-5p mimics on the permeability of the in vitro BBB model of BMECs. The specific experimental steps and experimental results are as follows:

[0108] 6.1 Experimental steps

[0109] (1) Digest the BMECs from T75 with 0.25% trypsin, and resuspend them in complete medium

[0110] (2) Count the cells, and plate 1 x 10 5 cells on the chamber membrane (0.4 μm pore size) of the Transwell cell culture plate.

[0111] (3) Dilute the target miR-30e-5p and miR-34c-5p mimics and Lipo2000 with 100 μL Opti-MEM, wherein the mass-volume ratio of miR-30e-5p and miR-34c-5p mimics (0, 20, 50, 100 nM) and Lipo2000 is 1:3, and then mix the diluted mimic and Lipo2000, and stand at room temperature for 15 min.

[0112] (4) BMEC cells were changed to DMEM medium, then miR-30e-5p and miR-34c-5p, mimic Lipo2000 mixture was added dropwise to the cell culture dish, mixed gently, placed in 37°C incubator for continuous culture for 48h.

[0113] (5) 10K FITC labeled dextran was diluted to 10mg / mL, 50μL was added to each chamber, and the culture was continued for 2h.

[0114] (6) After the end of the culture, 100mL of the lower medium was taken, added to the opaque 96-well plate, and the fluorescence value at 485 / 520nm was read using a multifunctional microplate reader. The sample was repeated in triplicate, and the data was recorded and saved.

[0115] 6.2 Experimental results

[0116] The results are shown in Figure 5 B, 20, 50, 100nM of miR-30e-5p and miR-34c-5p increased the permeability of the BBB in vitro model, and the permeability was significantly enhanced with increasing concentration.

[0117] Example 7 Detection of the effect of miR-30e-5p and miR-34c-5p inhibitors on the permeability of BMEC blood brain barrier in vitro model

[0118] This example uses a Transwell device to establish a BBB in vitro model, as shown in Figure 5 A, the BMEC cells on the chamber membrane have no direct physical contact with the lower chamber. Different concentrations of miR-30e-5p and miR-34c-5p inhibitors were used to treat the cells, and FITC labeled dextran was added to each chamber, and the fluorescence value in the lower chamber was detected to confirm the effect of miR-30e-5p and miR-34c-5p inhibitors on the permeability of BMEC blood brain barrier in vitro model. The specific experimental steps and experimental results are as follows:

[0119] 7.1 Experimental steps

[0120] (1) BMEC was digested from T75 with 0.25% trypsin, and resuspended with complete medium

[0121] (2) Cell counting, 1x10 5 cells were plated on the chamber membrane (0.4μm pore size) of the Transwell cell culture plate.

[0122] (3) Dilute the target miR-30e-5p and miR-34c-5p inhibitors and Lipo2000 with 100 μL Opti-MEM, respectively. The mass-volume ratio of miR-30e-5p and miR-34c-5p inhibitors (0, 20, 50, 100 nM) to Lipo2000 is 1:3. Then mix the diluted mimic and Lipo2000 and let it stand at room temperature for 15 min.

[0123] (4) Replace BMEC cells with DMEM medium, then add a mixture of miR-30e-5p and miR-34c-5p and inhibitor Lipo2000 to the cell culture dish, mix gently, and place in a 37°C incubator for 48 hours.

[0124] (5) Dilute 10K FITC-labeled dextran to 10 mg / mL, add 50 μL to each chamber, and continue culturing for 2 h.

[0125] (6) After the culture is completed, take 100 mL of the lower layer of culture medium and add it to an opaque 96-well plate. Use a multi-functional microplate reader to read the fluorescence value at 485 / 520 nm. The sample is repeated in triplicate and the data is recorded and saved.

[0126] 7.2 Experimental Results

[0127] like Figure 5 As shown in Figure C, miR-30e-5p inhibitors and miR-34c-5p inhibitors at concentrations of 20, 50, and 100 nM significantly reduced the permeability of the BBB in vitro model.

[0128] Example 8: Application of serum exosomes miR-30e-5p and miR-34c-5p in detecting viral infection and blood-brain barrier disruption.

[0129] 8.1 Serum Sample Collection

[0130] A total of 68 peripheral blood samples were collected from the clinical population and divided into three groups according to the severity of the disease: a healthy group (n=24), a mild viral infection group (n=23), and a severe viral infection group (n=21). Severe viral infection refers to cases related to human enterovirus infection (such as children with severe EV71 infection), and the clinical diagnosis was based on the "Guidelines for the Diagnosis and Treatment of Hand, Foot and Mouth Disease in Children (2018 Edition)," confirming enterovirus-related neurological damage. The severity grouping was based on clinical manifestations and disease stage: early stage was defined as 1–3 days after symptom onset, without radiographic evidence of substantial brain damage, mainly manifested as fever, irritability, or mild altered consciousness, without severe manifestations such as convulsions or coma. All samples were approved by the hospital's ethics committee. Fasting peripheral blood was collected in the morning, centrifuged at 3500×g for 10 minutes, and serum was collected and stored at -80℃.

[0131] 8.2 Main reagents

[0132] Exosome isolation kit: Total Exosome Isolation Reagent from Thermo Fisher; miRNA isolation kit: miRNeasy Serum / Plasma Kit from Qiagen; qRT-PCR system: SYBR Green or TaqMan (Thermo); CD63 antibody: purchased from Santa Cruz, USA; CD81 antibody: purchased from Hangzhou Huaan Biotech; miRNA primers: miR-30e-5p, miR-34c-5p and cel-miR-39 primers were provided by RiboBio, and the primers were full-length sequences.

[0133] 8.3 Experimental procedures

[0134] (1) Serum exosome extraction

[0135] 200 μL serum samples were added with an equal volume of exosome extraction reagent according to the instructions of the exosome extraction kit, incubated at 4°C for 30 minutes, centrifuged at 12000 x g for 10 minutes, and the supernatant was discarded. The precipitate was resuspended in 100 μL PBS for subsequent experiments. NTA analyzer was used to detect the particle size, and Western blot was used to detect CD63 and CD81 to confirm the purity of exosomes.

[0136] (2) Exosome miRNA extraction and quantitative detection

[0137] Total RNA was extracted using the miRNeasy kit in PBS pH 7.2 buffer. The concentration and purity were determined by Nanodrop. qRT-PCR was used to detect the expression of miR-30e-5p and miR-34c-5p, and cel-miR-39 was used as an internal control. All samples were determined in triplicate.

[0138] (3) Statistical analysis

[0139] The relative expression was calculated by ΔΔCt method.

[0140] 8.4 Experimental results

[0141] The relative expression of miR-30e-5p and miR-34c-5p in serum exosomes of healthy control group (Healthy), mild group (Mild) and severe group (Severe) is shown in Figure 6 As shown in Figs. A and B, compared with the healthy control group, the expression of miR-30e-5p and miR-34c-5p in the mild group was slightly increased.

[0142] The expression of miR-30e-5p and miR-34c-5p in the severe group was significantly increased, and the expression of miR-30e-5p and miR-34c-5p in the severe group was up-regulated by 7.3 times and 11.8 times, respectively, compared with the healthy control group; the expression level is positively correlated with the disease grade (p<0.01);

[0143] The application verifies the application value of miR-30e-5p and miR-34c-5p in detecting blood-brain barrier damage through exosome miRNA expression analysis. First, the ROC curve analysis result of miR-30e-5p shows that the area under the curve (AUC) is 0.8135, the standard error is 0.07896, the 95% confidence interval is 0.6587-0.9683, and the p value is 0.0003. In 24 healthy controls and 21 patients with blood-brain barrier damage, the optimal diagnostic cutoff value is ΔCt=5.62, the corresponding sensitivity is 86.7%, and the specificity is 83.3% according to the Youden index method.

[0144] Further, the independent analysis of miR-34c-5p also shows good performance, AUC is 0.8509, standard error is 0.07941, 95% confidence interval is 0.6952-1.000, and p value is less than 0.0001. In 24 healthy controls and 19 patients (excluding 3 missing data), the cutoff value is ΔCt=6.05, the sensitivity is 82.0%, and the specificity is 85.0%.

[0145] After constructing a diagnostic model by joint analysis of the two, the ROC curve shows that AUC reaches 0.9740, the standard error is 0.04493, the 95% confidence interval is 0.8589-1.000, and the p value is less than 0.0001, indicating that the combined use can significantly improve the diagnostic accuracy. The joint detection based on 24 healthy controls and 22 blood-brain barrier damage samples is superior to single miRNA detection in terms of sensitivity and specificity, and is recommended as an early auxiliary diagnostic marker combination for blood-brain barrier damage.

[0146] In addition, the miR-30e-5p / miR-34c-5p can target and regulate Notch1, and play a role by binding to the 3'UTR region, miR-30e-5p / miR-34c-5p inhibits the Notch signaling pathway, affects the key proteins of the blood-brain barrier, and then destroys the integrity. The miR-30e-5p / miR-34c-5p inhibitor helps to repair the blood-brain barrier. The mechanism of miR-30e-5p / miR-34c-5p regulating the integrity of the blood-brain barrier through Notch1 provides a new target for related disease diagnosis and treatment, and provides an important scientific basis for early warning and targeted treatment of central nervous system diseases.

[0147] The above merely provides the preferred embodiment of the present application, and is not used to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of exosome miR-30e-5p and / or miR-34c-5p in the preparation of a product for detecting blood-brain barrier damage.

2. Use according to claim 1, characterized in that, Exosome miR-30e-5p and / or miR-34c-5p are used as markers to detect blood-brain barrier damage caused by enterovirus infection.

3. Use according to claim 2, characterized in that, The enterovirus is enterovirus 71.

4. Use according to claim 2, characterized in that, The blood-brain barrier damage includes at least one of structural damage, functional damage and inflammatory damage of the blood-brain barrier.

5. Use according to claim 1 or 2, characterised in that, The product is used to detect at least one of brain trauma, stroke, brain tumor, Alzheimer's disease, cerebral hemorrhage, cerebral hypoxia, cerebral edema, encephalitis, meningitis, multiple sclerosis, acute disseminated encephalomyelitis, autoimmune encephalitis, viral encephalitis, vascular dementia and Parkinson's disease.

6. Use according to claim 1, characterized in that, The exosome source includes at least one of blood, saliva and sputum.

7. The use according to claim 1, characterized in that, The product components include: real-time fluorescent quantitative PCR and / or digital PCR detection reagents for exosome miR-30e-5p and / or miR-34c-5p.

8. Use according to claim 7, characterized in that, The product components also include: exosome separation reagents and / or exosome miRNA extraction reagents.

9. A kit for early diagnosis of severe enterovirus infection, characterized in that, The kit components include: primers for detecting the expression levels of exosome miR-30e-5p and miR-34c-5p, exosome separation reagents, exosome miRNA extraction reagents, reverse transcription reagents and real-time fluorescent quantitative PCR reagents; The pathological process of the severe viral infection is related to the degree of blood-brain barrier damage.

10. The kit of claim 9, characterized in that The enterovirus is enterovirus 71.

Images