Gene detection kit and system for evaluating medication of statins

By designing gene detection kits with specific primers and probes, combined with PCR reaction solutions and genotyping interpretation systems, the complexity and long cycle of SLCO1B1, ABCG2, and CYP2C9 gene detection in existing technologies have been solved, enabling rapid and accurate gene polymorphism analysis and meeting clinical needs.

CN121065331APending Publication Date: 2025-12-05CHONGQING PLOTONG INST OF GENETIC MEDICINE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511473169.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing technologies for detecting SLCO1B1, ABCG2, and CYP2C9 genes are cumbersome, have long testing cycles, are costly, and lack specificity, failing to meet the clinical demand for high-throughput multi-site detection.

Method used

A gene testing kit for evaluating the use of statin drugs is provided, which contains specific primers and probes for detecting SLCO1B1, ABCG2 and CYP2C9 gene loci, and achieves rapid and accurate genotyping analysis through PCR reaction solution and genotyping interpretation system.

Benefits of technology

It achieves high sensitivity, low cost, high specificity, simple operation, and short detection cycle for gene polymorphism detection, and can quickly and accurately assess an individual's risk of adverse reactions to statins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065331A_ABST
    Figure CN121065331A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of statins, and particularly relates to a gene detection kit and system for evaluating the medication of statins, the kit comprises primers and probes for detecting the rs4149056 site of an SLCO1B1 gene, the rs2231142 site of an ABCG2 gene and the rs1057910 site of a CYP2C9 gene, the kit also comprises a PCR reaction liquid, a positive quality control product and a negative quality control product, the system comprises a PCR reaction system, a PCR amplification system and a genotyping interpretation system, the PCR reaction system is composed of the gene detection kit for evaluating the medication of statins, the kit and the detection system have the advantages of being high in sensitivity, low in cost, high in specificity, easy and convenient to operate, short in detection period and the like, and individual SLCO1B1, ABCG2 and CYP2C9 gene polymorphism can be rapidly and accurately detected.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of statins, and particularly relates to a gene detection kit and system for evaluating statin medication. BACKGROUND

[0002] Statins are widely used in clinical lipid-lowering drugs, which significantly reduce low-density lipoprotein cholesterol (LDL-C) by inhibiting HMG-CoA reductase, and are used for preventing and treating atherosclerotic cardiovascular diseases (ASCVD), such as coronary heart disease, myocardial infarction and ischemic stroke. About 5%-20% of patients have adverse reactions after taking the drugs, including myopathy, rhabdomyolysis, abnormal liver function and new-onset diabetes, among which myopathy-related symptoms are the most common and can be life-threatening in severe cases.

[0003] Studies have shown that the adverse reactions of statins are closely related to genetic variations of multiple genes, mainly including SLCO1B1, ABCG2 and CYP2C9. The SLCO1B1 gene encodes the hepatic uptake transporter OATP1B1 of statins, and mutations at this site can reduce drug transport efficiency, leading to increased blood drug concentration and increased risk of myopathy. The ABCG2 gene encodes the drug efflux transporter BCRP, and mutations can reduce the excretion of statins, increase the blood drug concentration, and enhance the toxicity of the drug. The CYP2C9 gene affects the metabolism of some statins (such as fluvastatin), and mutations may lead to decreased metabolic enzyme activity, prolonged drug half-life, and increased risk of adverse reactions.

[0004] Currently, the detection methods of SLCO1B1, ABCG2 and CYP2C9 genes mainly include polymerase chain reaction-restriction fragment length polymorphism analysis (PCR-RFLP method), sequence-specific PCR, first-generation sequencing, second-generation sequencing and gene chip method. However, these methods have certain limitations, have their own application defects, are cumbersome to operate, have long detection periods, cannot perform high-throughput multi-site detection in a short time, and make the current application of polymorphism detection technology in clinical still not ideal, and it has been unable to meet the clinical detection needs. SUMMARY

[0005] In order to solve the problems of high sample processing requirements, long detection period, complex operation, high cost and low specificity in detecting SLCO1B1, ABCG2 and CYP2C9 gene polymorphisms in the prior art, the application provides a gene detection kit and system for evaluating statin medication, which achieves the purposes of high sensitivity, low cost, high specificity, simple operation and short detection period.

[0006] The technical problem of the application is solved by adopting the following technical solutions:

[0007] The application aims to provide a gene detection kit for evaluating statin medication, comprising primers and probes for detecting rs4149056 site of SLC01B1 gene, rs2231142 site of ABCG2 gene and rs1057910 site of CYP2C9 gene.

[0008] Further, the primer and probe sequence for detecting rs4149056 is SEQ ID NO.1-4, the primer and probe sequence for detecting rs2231142 is SEQ ID NO.5-8, and the primer and probe for detecting rs1057910 is SEQ ID NO.9-12.

[0009] The primer and probe for detecting rs4149056 are as follows:

[0010] SLC-F (SEQ ID NO.1): ACATAGGTTGTTTAAAGGAAT

[0011] SLC-R (SEQ ID NO.2): TTAGCGAAATCATCAATGTAA

[0012] SLC-WP (SEQ ID NO.3): FAM-TGTGGACATATGTGTTCATGGGTAATA-MGB

[0013] SLC-MP (SEQ ID NO.4): VIC-TGTGGACATATGCGTTCATGGGTAATA-MGB

[0014] The primer and probe for detecting rs2231142 are as follows:

[0015] ABC-F (SEQ ID NO.5): ATGATTCGTCATAGTTGTT

[0016] ABC-R (SEQ ID NO.6): AATGCTATTTGCCTTAAGGATG

[0017] ABC-WP (SEQ ID NO.7): FAM-CTGCTCAGAACTGTAAGTTTTCTC-MGB

[0018] ABC-MP (SEQ ID NO.8): VIC-CTGCAGAGAACTTTAAGTTTTCTC-MGB

[0019] The primer and probe for detecting rs1057910 are as follows:

[0020] 2C9-F (SEQ ID NO. 9): AAGACAGGAGCCACATGC

[0021] 2C9-R (SEQ ID NO. 10): GAATTTAATGTCACAGGTC

[0022] 2C9-WP (SEQ ID NO. 11): FAM-GGTCCATAGATACATTGACCTTCTCC-MGB

[0023] 2C9-MP (SEQ ID NO. 12): VIC-GGTCCAGATATACCTTGACCTTCTCC-MGB.

[0024] Further, the 5' end fluorescent group of the probe is FAM or VIC, and the 3' end quenching group is MGB.

[0025] Further, the kit further comprises a PCR reaction solution, a positive quality control and a negative quality control.

[0026] Further, the PCR reaction solution comprises the hot start taq enzyme, UNG enzyme, buffer, magnesium ion and dNTP substance required for PCR reaction.

[0027] Further, the method for obtaining the positive quality control is as follows: a plasmid is constructed according to the gene sequence of rs4149056, rs2231142 and rs1057910 published in the NCBI database to synthesize a sequence gene fragment, the fragment is then inserted into a T vector, and the E. coli DH5α strain is transformed and the plasmid is extracted, and the quality control plasmids are mixed in equal proportions to obtain the positive quality control.

[0028] Further, the negative quality control is DEPC treated deionized water.

[0029] A gene detection system for evaluating statin medication comprises a PCR reaction system, a PCR amplification system and a gene typing interpretation system of a gene detection kit for evaluating statin medication.

[0030] Further, the PCR amplification conditions in the PCR amplification system are as follows:

[0031] The UNG enzyme reaction condition is 25°C for 10 minutes;

[0032] The UNG enzyme inactivation condition is 95°C for 2 minutes;

[0033] The system amplification condition is as follows: denaturation: 98°C for 10 seconds; annealing: 60°C for 30 seconds, set the fluorescence signal collection; extension: 72°C for 30 seconds, cycle number is set to 40.

[0034] Further, the genotyping interpretation system includes: under the conditions of the PCR reaction system and cycling program, the fluorescence detection signals of the positive control products FAM and VIC should form a logarithmic amplification "S" curve; the negative control product should have no amplification curve or a Ct value greater than 37;

[0035] Under the above - satisfied conditions, observe the amplification curves of the FAM and VIC channels of the test sample. If a logarithmic amplification "S" curve is formed, the test sample contains the corresponding base mutation; if there is no logarithmic amplification "S" curve or the Ct value is greater than 37, there is no corresponding base mutation.

[0036] A method for using a gene detection kit for evaluating statin medication, comprising the following steps:

[0037] 1) Take a blood sample containing EDTA anticoagulant for nucleic acid extraction, and use a nucleic acid extraction kit (magnetic bead method) produced by Chongqing Puji Life Science and Technology Co., Ltd. for nucleic acid extraction;

[0038] 2) Premix the gene detection reagent to obtain a PCR reaction solution, and jointly form a PCR reaction system with the negative control product and the positive control product;

[0039] 3) Add the DNA obtained in step 1) to the PCR reaction solution in step 2), and perform PCR amplification synchronously with the negative control product and the positive control product;

[0040] 4) Perform genotyping interpretation after the reaction ends.

[0041] PCR reaction solution FAM signal VIC signal PCR reaction solution 1 SLCO1B1 (rs<4149056> T) SLCO1B1 (rs<4149056> C) PCR reaction solution 2 ABCG2 (rs<2231142> G) ABCG2 (rs<2231142> T) PCR reaction solution 3 CYP2C9 *3 > A CYP2C9 *3 > C .

[0042] The FAM signal of reaction solution 1 indicates the amplification of rs<4149056>T, the VIC signal indicates the amplification of rs<4149056>C, the FAM signal of reaction solution 2 indicates the amplification of rs<2231142>G, the VIC signal indicates the amplification of rs<2231142>T, the FAM signal of reaction solution 3 indicates the amplification of CYP2C9*3>A, and the VIC signal indicates the amplification of CYP2C9*3>C.

[0043] Compared with the prior art, the beneficial technical effects of the present invention are as follows:

[0044] (1) The present invention mixes the detection reagents for each gene locus into one tube of PCR reaction solution, realizing the multi - gene variation analysis of three reaction tubes, reducing costs while improving the detection efficiency.

[0045] (2) The application has the characteristics of high sensitivity, low cost, high specificity, simple operation, short detection period, etc., and can quickly and accurately detect SLCO1B1 (rs4149056), ABCG2 (rs2231142) and CYP2C9*3 gene sites.

[0046] The above description is only a summary of the technical solutions of the application, in order to more clearly understand the technical means of the application, the content of the specification can be implemented, and in order to make the above content and purposes, characteristics and advantages of the application more obvious and easy to understand, the specific embodiments of the application are as follows. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 The amplification curve of the positive quality control of the gene detection kit and system for evaluating the use of statins.

[0048] Figure 2 The amplification curve of the negative quality control of the gene detection kit and system for evaluating the use of statins. DETAILED DESCRIPTION

[0049] The technical solutions of the application will be further described in detail below in combination with specific embodiments. It should be understood that the following examples are only illustrative and explanatory of the application, and should not be interpreted as limiting the scope of protection of the application. Any technology realized based on the above content of the application is covered within the scope of protection intended by the application.

[0050] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the application can be purchased or prepared by existing methods.

[0051] The application analyzes the differences in the response of individuals to statins, queries guidelines to screen gene sites closely related to adverse reactions of statins, and prepares compositions for detecting the polymorphic sites and detection kits using the compositions, and establishes an accurate detection system method to effectively evaluate the risk of adverse reactions of individuals to statins.

[0052] Example 1: Design and use of primer and probe combination

[0053] Primer and probe combination for identifying SLCO1B1 (rs<4149056>T):

[0054] SLC-F: ACATAGGTTGTTTAAAGGAAT

[0055] SLC-R: TTAGCGAAATCATCAATGTAA

[0056] SLC-WP: FAM-TGTGGACATATGTGTTCATGGGTAATA-MGB.

[0057] Primer and probe combination for identifying SLC01B1 (rs<4149056>C):

[0058] SLC-F: ACATAGGTTGTTTAAAGGAAT

[0059] SLC-R: TTAGCGAAATCATCAATGTAA

[0060] SLC-MP: VIC-TGTGGACATATGCGTTCATGGGTAATA-MGB.

[0061] Primer and probe combination for identifying ABCG2 (rs<2231142>G):

[0062] ABC-F: ATGATTCGTCATAGTTGTT

[0063] ABC-R: AATGCTATTTGCCTTAAGGATG

[0064] ABC-WP: FAM-CTGCTCAGAACTGTAAGTTTTCTC-MGB.

[0065] Primer and probe combination for identifying ABCG2 (rs<2231142>T):

[0066] ABC-F: ATGATTCGTCATAGTTGTT

[0067] ABC-R: AATGCTATTTGCCTTAAGGATG

[0068] ABC-MP: VIC-CTGCAGAGAACTTTAAGTTTTCTC-MGB.

[0069] Primer and probe combination for identifying CYP2C9*3>A:

[0070] 2C9-F: AAGACAGGAGCCACATGC

[0071] 2C9-R: GAATTTAATGTCACAGGTC

[0072] 2C9-WP: FAM-GGTCCATAGATACATTGACCTTCTCC-MGB.

[0073] Primer and probe combination for identifying CYP2C9*3>C:

[0074] 2C9-F: AAGACAGGAGCCACATGC

[0075] 2C9-R: GAATTTAATGTCACAGGTC

[0076] 2C9-MP: VIC-GGTCCAGATATACCTTGACCTTCTCC-MGB.

[0077] The 5' end fluorescent group of the above probe is a commonly used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, such as FAM, VIC, HEX, CY5, Texas Red or ROX, and the 3' end quencher is a commonly used fluorescent quencher suitable for fluorescent quantitative PCR, such as TAMRA, BHQ1, BHQ2, MGB or Dabcy1, and the preferred scheme is that the 5' end fluorescent group is FAM and VIC, and the 3' end quencher is MGB.

[0078] Example 2: Obtaining of positive quality control

[0079] The method for obtaining the positive quality control is as follows: synthesizing a sequence gene fragment by constructing a plasmid according to the SLCO1B1 (rs4149056), ABCG2 (rs2231142) and CYP2C9*3 gene sequences published in the NCBI database, then inserting the fragment into a T vector, transforming by using an E. coli DH5α strain and extracting a plasmid, and mixing the quality control plasmids in equal proportions to obtain the positive quality control.

[0080] Example 3: Configuration of PCR reaction solution

[0081] The kit of the present application adopts a three-tube PCR reaction solution design, which respectively indicates different genotypes of SLCO1B1 (rs4149056), ABCG2 (rs2231142) and CYP2C9*3. The composition of the reaction solution is shown in Table 1, Table 2 and Table 3.

[0082] Table 1: PCR reaction solution of SLCO1B1

[0083] Reaction solution components Concentration Taq Hot Start Polymerase 0.5U 10 x PCR Buffer 10X dU plus dNTP Mixture (12.5X) 10 mM UNG 0.4U SLC-F 1 μM SLC-R 1 μM SLC-WP 1 μM SLC-MP 1 μM Genomic DNA (template) 1-200 ng Sterile deionized water To 20 μL

[0084] Table 2: PCR reaction solution of ABCG2

[0085] Reaction solution components Concentration Taq Hot Start Polymerase 0.5U 10 x PCR Buffer 10X dU plus dNTP Mixture (12.5X) 10 mM UNG 0.4U ABC-F 1 μM ABC-R 1 μM ABC-WP 1 μM ABC-MP 1 μM Genomic DNA (template) 1-200 ng Sterile deionized water To 20 μL

[0086] Table 3: PCR reaction solution of CYP2C9

[0087]

[0088]

[0089] Example 4: Use of the genetic detection kit

[0090] 1. Sample collection and processing

[0091] Peripheral blood of patients was collected, and blood samples of 2-5 ml were collected using vacuum blood collection tubes containing EDTA anticoagulant. Nucleic acid extraction was performed using acid extraction reagent kits (magnetic bead method) produced by Chongqing Puji, and the experimental steps were performed according to the instructions.

[0092] 2. Preparation of PCR reaction system

[0093] The reaction system was prepared according to the PCR reaction solution in Example 3.

[0094] 3. PCR reaction

[0095] The DNA extracted from the sample was added to the prepared PCR reaction system, and the amount of template added was 1-200 ng. When performing PCR reaction, the sample to be tested, positive quality control and negative quality control were detected together, and each sample only needed to be added to 3 reaction tubes for reaction.

[0096] 4. Selection of instrument channel and reaction volume

[0097] ① Select FAM channel (Reporter: FAM, Quencher: MGB) and VIC channel (Reporter: VIC, Quencher: MGB) to detect amplification;

[0098] ② Reaction volume (Sample Volume) is 20 μL;

[0099] ③ Reference dye: If ABI series PCR instrument is used, please select "none" for passive reference; specific detection channel settings can be referred to the instrument instruction.

[0100] 5. PCR reaction program

[0101] The conditions for UNG enzyme reaction are: 25°C, 10 minutes;

[0102] The conditions for UNG enzyme inactivation are: 95°C, 2 minutes;

[0103] The conditions for system amplification are: denaturation: 98°C, 10 seconds; annealing: 60°C, 30 seconds, set fluorescence signal collection; extension: 72°C, 30 seconds, cycle number set to 40.

[0104] 6. Experimental results

[0105] After the reaction procedure, the results were saved and interpreted. The amplification curve was standard "S" type and the amplification Ct value was ≤ 35, which was detected, otherwise it was not detected.

[0106] The FAM and VIC fluorescence detection signals of the positive quality control formed logarithmic amplification "S" type curve (see attached Figure 1 ) ;

[0107] The negative quality control had no amplification curve (see attached Figure 2 ) ;

[0108] Example 5: Performance analysis of the gene detection kit

[0109] 1. Accuracy of the kit

[0110] Three positive reference samples P1, P2, P3, P4, P5 and one negative reference sample N1 were selected, and the three batches of kits of Example 3 were detected according to the method of Example 4, each reference sample was detected 3 times, and the results are shown in Table 4.

[0111] Table 4: Accuracy detection results

[0112]

[0113] The 3 results of each sample in the accuracy detection results were consistent, the detection results of the three batches of reagents were consistent and consistent with the expected detection results, indicating that the kit and the detection system of the application had good accuracy.

[0114] 2. Detection limit of the kit

[0115] One hybrid detection limit reference sample L1 was selected, diluted with TE buffer to 1 ng / μL, 2 ng / μL, 5 ng / μL, 10 ng / μL and 100 ng / μL, and detected according to the method of Example 4 using three batches of kits of Example 3. Each concentration reference sample was detected 10 times, and the results are shown in Table 5.

[0116] Table 5: Detection limit detection results

[0117]

[0118]

[0119] The 10 results of each concentration sample in the detection limit detection results were consistent, the detection results of the three batches of reagents were consistent and consistent with the expected genotype, indicating that the kit and the detection system of the application had good sensitivity, and the detection limit was as low as 1 ng / μL.

[0120] 3. Precision of the kit

[0121] Select three precision reference J1, J2, J3 according to the method of Example 4 using three batches of kits of Example 3 for detection, repeat detection 2 times a day, repeat 5 days, the results are shown in Table 6.

[0122] Table 6 Precision test results

[0123]

[0124] The coefficient of variation (CV, %) is calculated from the Ct values of 10 detection results of the precision experiment. The CV of the two fluorescence signals of the analysis well is within 5%, and the inter-assay precision is within 5%, indicating that the kit and detection system of Example 3 have good repeatability.

[0125] 4. Analysis specificity of the kit

[0126] 4.1 Interference experiment

[0127] Select 2 clinical samples with known genotypes, add endogenous interfering substances cholesterol (13 mmol / L), urea (7 mmol / L), and exogenous interfering substances chloramphenicol (200 umol / L), and detect the above samples according to the method of Example 4 using three batches of kits of Example 3, repeat detection 3 times for each sample, the results are shown in Table 7, different interfering substances do not interfere with the detection results.

[0128] Table 7 Detection results of interference experiment

[0129] Interfering substances Test results of the 1st batch of reagents Test results of the 2nd batch of reagents Test results of the 3rd batch of reagents Whether to meet Cholesterol + + + Yes Urea + + + Yes Chloramphenicol + + + Yes

[0130] 4.2 Cross reaction

[0131] Select plasmids containing CYP2C9 homologous gene CYP2C19 gene sequence (number C1), CYP2C9*3 containing allele CYP2C9*2, CYP2C9*5 gene sequence (number C2, C3), detect the above samples according to the method of Example 4 using three batches of kits of Example 3, repeat detection 3 times for each sample, the results are shown in Table 8, homologous genes and alleles will not produce cross reaction with detection sites.

[0132] Table 8 Cross reaction detection results

[0133] Sample number Test results of the 1st batch of reagents Test results of the 2nd batch of reagents Test results of the 3rd batch of reagents Whether to meet C1 - - - Yes C2 - - - Yes C3 - - - Yes

[0134] The kit and detection system of the present application have good analysis specificity.

[0135] In summary, the kit and detection system have the characteristics of high sensitivity, low cost, high specificity, simple operation, short detection period and the like, and can rapidly and accurately detect individual SLCO1B1, ABCG2 and CYP2C9 gene polymorphisms to meet the needs of precision medicine and health management.

[0136] The above-mentioned embodiment numbers of the present application are only for description, and do not represent the advantages and disadvantages of the embodiments.

[0137] The embodiments of the present application are described above in combination with the drawings, but the present application is not limited to the above-mentioned specific embodiments, and the above-mentioned specific embodiments are only illustrative and not restrictive. Those skilled in the art can make many forms under the inspiration of the present application without departing from the scope of the present application and the scope of protection of the claims, and these all belong to the protection of the present application.

Claims

1. A gene detection kit for evaluating statin medication, characterized by, The primers and probes for detecting the rs4149056 site of the SLCO1B1 gene, the rs2231142 site of the ABCG2 gene and the rs1057910 site of the CYP2C9 gene.

2. The gene detection kit for evaluating statin drug use as described in claim 1, characterized in that: The primer and probe sequences for detecting rs4149056 are SEQ ID NO. 1-4, the primer and probe sequences for detecting rs2231142 are SEQ ID NO. 5-8, and the primer and probe for detecting rs1057910 are SEQ ID NO. 9-12.

3. The gene detection kit for evaluating statin drug use as described in claim 2, characterized in that: The 5' end fluorescent group of the probe is FAM or VIC, and the 3' end quenching group is MGB.

4. The genetic test kit for evaluating statin medication according to claim 1, wherein the genetic test kit is a kit for evaluating statin medication comprising a genetic test kit for evaluating CYP2D6*10, CYP2D6*29, and CYP2D6*41. The kit further comprises a PCR reaction solution, a positive quality control and a negative quality control.

5. The gene detection kit for evaluating statin drug use as described in claim 4, characterized in that: The PCR reaction solution comprises the hot start taq enzyme, UNG enzyme, buffer, magnesium ions and dNTP substances required for PCR reaction.

6. A gene detection system for evaluating statin medication, characterized by: The kit further comprises a PCR reaction solution, a positive quality control and a negative quality control.

7. The gene detection kit for evaluating statin drug use as described in claim 6, characterized in that: The PCR reaction solution comprises the hot start taq enzyme, UNG enzyme, buffer, magnesium ions and dNTP substances required for PCR reaction. The PCR amplification system comprises a PCR amplification system, a PCR amplification system and a genotyping interpretation system. The conditions for PCR amplification in the PCR amplification system are as follows: The conditions for UNG enzyme reaction are 25℃ for 10 minutes; 8. The genetic test kit for evaluating statin medication according to claim 6, wherein the genetic test kit is a kit for evaluating statin medication comprising a genetic test kit for evaluating CYP2D6*10, CYP2D6*29, and CYP2D6*41. The conditions for UNG enzyme inactivation are 95℃ for 2 minutes; The conditions for system amplification are as follows: denaturation: 98℃ for 10 seconds; annealing: 60℃ for 30 seconds, set the fluorescence signal collection; extension: 72℃ for 30 seconds, cycle number is set to 40. The genotyping interpretation system comprises: under the conditions of the PCR reaction system and the cycle program, the positive quality control FAM and VIC fluorescence detection signal should form a logarithmic amplification "S" type curve; the negative quality control should have no amplification curve or the Ct value should be greater than 37; Under the above conditions, observe the amplification curve of the sample to be tested in the FAM and VIC channels, if a logarithmic amplification "S" type curve is formed, it contains the corresponding base mutation; if there is no logarithmic amplification "S" type curve or the Ct value is greater than 37, there is no corresponding base mutation.