Application of a KASP molecular marker in identifying red / yellow skin traits in melons
By using PCR amplification and fluorescence detection of KASP molecular markers RY-1 and RY-2, the problems of low efficiency and long cycle in the breeding of melon peel color were solved, and rapid and efficient identification of red/yellow peel traits in melons was achieved.
Patent Information
- Application Number
- CN202511196160.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-26
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-08-26
AI Technical Summary
In existing technologies, the selection of melon peel color relies on traditional phenotypic observation, which is inefficient, time-consuming, and makes it difficult to quickly and accurately identify red/yellow peel traits.
Using KASP molecular markers RY-1 and RY-2, red/yellow skin traits were identified by PCR amplification and fluorescence detection using melon genomic DNA, and specific SNP site primer pairs were designed for genotyping.
It enables rapid, simple, and efficient identification of red/yellow skin traits in melons, simplifies the detection process, avoids complex steps such as enzyme digestion and electrophoresis, and improves breeding efficiency.
Smart Images

Figure CN120683308B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of molecular marker technology, specifically relating to the application of a KASP molecular marker in identifying the red / yellow skin trait of melons. Background Technology
[0002] Muskmelon (Cucumis melo L.) is one of the important economic crops of the Cucurbitaceae family and has a long history of cultivation in my country. Muskmelon is divided into two subspecies: thick-skinned muskmelon (Cucumis melo L.spp. melo) and thin-skinned muskmelon (Cucumis melo L.spp. agrestis). As one of the secondary centers of origin for muskmelon, my country possesses extremely rich germplasm resources. These germplasm resources exhibit significant diversity in morphology, physiology, and genetic characteristics, with the differences in muskmelon rind color being particularly prominent.
[0003] Peel color is an important commercial trait of melons, and understanding its regulatory mechanism is of great significance for variety improvement, market segmentation, and germplasm resource utilization. Currently, the breeding of melon peel color mainly relies on traditional phenotypic observation, which suffers from problems such as long cycle and low efficiency. Summary of the Invention
[0004] The purpose of this application is to provide an application of KASP molecular markers in identifying red / yellow skin traits in melons. The aim is to use KASP molecular markers to identify seeds or seedlings of red / yellow skin melons, thereby improving the breeding efficiency of melons with target traits and shortening the breeding cycle.
[0005] To achieve the above objectives, this application provides an application of the KASP molecular marker in identifying the red / yellow skin trait of melons, wherein the identification of the red / yellow skin trait of melons includes the following steps:
[0006] Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was performed based on primer pairs of KASP molecular markers RY-1 or RY-2 to obtain the gene type of the target melon. Based on the detected gene type, the trait of the target melon was determined.
[0007] The KASP molecular marker RY-1 was designed based on the SNP site at Chr04:469552;
[0008] The KASP molecular marker RY-2 was designed based on the SNP site at Chr04:760234.
[0009] As some optional embodiments of this application, the nucleotide sequence of the SNP site at Chr04:469552 is shown in SEQ ID NO.1; the nucleotide sequence of the SNP site at Chr04:760234 is shown in SEQ ID NO.2.
[0010] As some optional embodiments of this application, the polymorphism of the KASP molecular marker is A or B, the AA genotype or AB genotype is red-skinned, and the BB genotype is yellow-skinned.
[0011] As some optional embodiments of this application, the gene type is obtained based on the following reaction system: 1 μL of 2×KASP Master Mix, 0.003 μL each of primer F1 and primer F2 at a concentration of 100 μM, 0.008 μL of primer R, and 1 μL of DNA template.
[0012] As some optional embodiments of this application, the PCR amplification includes:
[0013] Pre-denaturation at 94℃ for 15 min;
[0014] Denaturation at 94℃ for 20 seconds
[0015] Annealing and extending at 61℃-55℃ for 60 seconds, 10 cycles;
[0016] 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, 26 cycles.
[0017] As some optional embodiments of this application, the primer pair of the KASP molecular marker RY-1 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers;
[0018] The two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.5.
[0019] As some optional embodiments of this application, the primer pair of the KASP molecular marker RY-2 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers;
[0020] The two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.8.
[0021] As some optional embodiments of this application, the primer pairs of the KASP molecular markers RY-1 or RY-2 can be used to prepare kits for identifying KASP molecular markers that identify red or yellow traits in melons.
[0022] As some optional embodiments of this application, the primer pair of the KASP molecular marker RY-1 or RY-2 can be used for melon molecular breeding or variety purity detection.
[0023] In summary, this application has the following advantages:
[0024] Compared with existing technologies, this application has successfully developed a KASP molecular marker RY-1 or RY-2 for identifying the red or yellow skin trait of melons. The RY-1 molecular marker consists of two forward primers RY-1-F1 and RY-1-F2 with lengths of 46bp and 47bp respectively, and a reverse primer RY-1-R with a length of 30bp. The RY-2 molecular marker consists of two forward primers RY-2-F1 and RY-2-F2 with lengths of 48bp and 49bp respectively, and a reverse primer RY-2-R with a length of 29bp.
[0025] This application utilizes KASP molecular markers RY-1 or RY-2 for genotyping of red-skinned and yellow-skinned melons. Identification of the target melon DNA requires only a single PCR amplification, and the entire detection process is simple, eliminating the need for complex steps such as enzyme digestion, electrophoresis, and sequencing. A high-throughput genotyping system can rapidly obtain genotyping maps and values, enabling rapid identification of the target plant's genotype. Therefore, the KASP molecular markers RY-1 or RY-2 in this application can be easily, rapidly, and efficiently applied to molecular-assisted breeding or variety purity testing in melons. Attached Figure Description
[0026] Figure 1 This is a schematic diagram of an extreme yellow-skinned mixed pool in the F2 population in this application embodiment;
[0027] Figure 2 This is a schematic diagram of an extreme red-skinned mixed pool in the F2 population in this application embodiment;
[0028] Figure 3 A schematic diagram of the SNP-index-based Δ association analysis of melon peel color;
[0029] Figure 4 This diagram illustrates the validation of KSAP molecular markers RY-1, RY-2, RY-3, RY-4, RY-5, RY-6, and RY-7 in the parents and F1 generation; where KSAP molecular markers RY-1, RY-2, RY-3, RY-4, RY-5, RY-6, and RY-7 correspond to... Figure 4(a) Figure 4 (b) Figure 4 (c) Figure 4 (d) Figure 4 (e) Figure 4 (f) and Figure 4 (g);
[0030] Figure 5 This is a schematic diagram showing the genotyping results of KASP molecular markers RY-1 and RY-2 in the F2 population. Figure 5 (a) and Figure 5 (b) represents the RY-1 typing result. Figure 5 (c) and Figure 5 (d) represents the RY-2 typing result. Detailed Implementation
[0031] The principles and features of this application are described below with reference to embodiments. The examples are for illustrative purposes only and are not intended to limit the scope of this application. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0032] Molecular marker technology has been widely applied in gene mapping. Currently, RFLP, RAPD, AFLP, SSR, InDel, and SNP are commonly used methods in molecular marker technology. Kompetitive allele-specific PCR (KASP), as a mainstream high-throughput SNP technology, has achieved high-precision genotyping of biallelic alleles (SNPs and InDels) due to its excellent stability and accuracy. With the rapid development of sequencing technology in my country, InDel and SNP markers can be converted into high-throughput competitive allele-specific PCR markers (KASP) for genotyping of biological populations. This technological advancement will greatly promote the progress of gene mapping and molecular-assisted breeding.
[0033] To explore the genetic mechanism of melon peel color, especially the rare red peel trait, the applicant conducted relevant hybridization experiments: using yellow-skinned melon as the male parent and red-skinned melon as the female parent, the applicant obtained the F1 generation through hybridization. The F1 generation was then self-crossed to obtain the F2 genetically segregating population. At the melon maturity stage, the peel color trait of the F2 population was investigated, and 30 plants with extreme red peel trait and 30 plants with extreme non-red peel trait were selected to construct a mixed pool of extreme traits. By extracting DNA from the two parents and the extreme mixed pool for BSA sequencing analysis, the key gene controlling the red peel trait was preliminarily located in the interval 500,407bp-1,799,822bp (approximately 1.3Mb) on chromosome 4. Based on this location interval, this application further developed 7 KASP (Kompetitive Allele-Specific PCR) molecular markers, and these 7 KASP molecular markers were verified to be polymorphic among the parents. Meanwhile, the effectiveness of molecular markers was validated using F2 and F3 populations. The results showed that the genotyping accuracy of the RY-1 marker reached 95.2%, and that of the RY-2 marker reached 93.8%, both showing a high correlation with the red-skin trait. These findings provide an important technical foundation for marker-assisted breeding of red-skin traits in melons, and hold promise for rapid seedling identification of melon peel color, offering novel technical means for variety purity testing and gene editing target screening.
[0034] Specifically, in the first aspect, a KASP molecular marker for identifying the red / yellow skin trait in melons in this application has been identified as KASP molecular marker RY-1 or KASP molecular marker RY-2. Among them,
[0035] (1) The KASP molecular marker RY-1 was designed based on a single nucleotide polymorphism (SNP) at position 469552 on chromosome Chr04 in the melon genome (DHL92-V4), and the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1.
[0036] Further analysis revealed that the base at this SNP site was mutated from thymine T to cytosine C, and its nucleotide sequence can be found in the sequence identifier SEQ ID NO.1.
[0037] The sequence identifier SEQ ID NO.1 and its corresponding variant sites are detailed below:
[0038] >chr04:469552=TATATAGACAGGGTTATTATATTATACGCAGAACTCTTCTTTTTATGTCTC[T / C]ATACTCGTCAGAATAAAAGAAGATGTTAGGTGAAGTGTTGTGGTACT.
[0039] (2) The KASP molecular marker RY-2 was designed based on a single nucleotide polymorphism (SNP) at position 760234 on chromosome Chr04 in the melon genome (DHL92-V4), and the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.2.
[0040] Further analysis revealed that the base at this SNP site was mutated from cytosine C to thymine T, and its nucleotide sequence can be found in the sequence identifier SEQ ID NO.2.
[0041] The sequence identifier SEQ ID NO.2 and its corresponding variant sites are detailed below:
[0042] >chr04:760234=CAGAAATCTTTTCCCATGTATGGAAACAGTGGTAATTATCACACATATAC[C / T]GGTTCAAACATAAATGCCTCTTCATTGTCTCTTAAACCCCAACCTCATGA.
[0043] Secondly, the primer pair for identifying the red / yellow skin trait of melons in this application includes:
[0044] (1) RY-1-F1 as shown in SEQ ID NO.3, RY-1-F2 as shown in SEQ ID NO.4 and RY-1-R as shown in SEQ ID NO.5:
[0045] Specifically, RY-1-F1 (SEQ ID NO.3):
[0046] GAAGGTGACCAAGTTCATGCTCGCAGAACTCTCTTTTTATGTCTCC.
[0047] RY-1-F2 (SEQ ID NO.4):
[0048] GAAGGTCGGAGTCAACGGATTACGCAGAACTCTCTTTTTATGTCTCT.
[0049] RY-1-R (SEQ ID NO.5):
[0050] AACATCTTCTTTTATTATTCTGACGAGTAT.
[0051] (2) RY-2-F1 as shown in SEQ ID NO.6, RY-2-F2 as shown in SEQ ID NO.7, and RY-2-R as shown in SEQ ID NO.8:
[0052] RY-2-F1 (SEQ ID NO.6):
[0053] GAAGGTGACCAAGTTCATGCTAATGAAGAGGCATTTATGTTTGAACCG.
[0054] RY-2-F2 (SEQ ID NO.7):
[0055] GAAGGTCGGAGTCAACGGATTCAATGAAGAGGCATTTATGTTTGAACCA.
[0056] RY-2-R (SEQ ID NO.8):
[0057] CTTTTCCCATGTATGGAAACAGTGGTAAT.
[0058] Furthermore, this application includes a kit for identifying KASP molecular markers for red / yellow skin traits in melons, comprising primer pairs for the KASP molecular marker RY-1 or KASP molecular marker RY-2 as described above, namely RY-1-F1 as shown in SEQ ID NO.3, RY-1-F2 as shown in SEQ ID NO.4, RY-1-R as shown in SEQ ID NO.5, RY-2-F1 as shown in SEQ ID NO.6, RY-2-F2 as shown in SEQ ID NO.7, and RY-2-R as shown in SEQ ID NO.8. Among these, RY-1-F1, RY-1-F2, RY-2-F1, and RY-2-F2 as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.6, and SEQ ID NO.7 are forward primers, while RY-1-R as shown in SEQ ID NO.5 and RY-2-R as shown in SEQ ID NO.8 are reverse primers.
[0059] The method for identifying the red / yellow skin trait of melons according to this application comprises the following steps:
[0060] First, genomic DNA was extracted from the target melon. Then, using the genomic DNA as a template, PCR amplification and fluorescence detection were performed using primer pairs labeled with KASP for RY-1 or RY-2.
[0061] The PCR amplification procedure is as follows:
[0062] Pre-denaturation at 94℃ for 15 min;
[0063] Denaturation at 94℃ for 20 seconds
[0064] Annealing and extending at 61℃-55℃ for 60 seconds, 10 cycles;
[0065] 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, 26 cycles;
[0066] Based on the gene type in the test results, the traits of the target melon are determined.
[0067] Specifically, if the detected gene type is AA or AB, the target melon is determined to have a red-skinned genotype; if the detected gene type is BB, the target melon is determined to have a yellow-skinned genotype. The red-skinned genotype refers to a fluorescence detection result whose distance to the Y-axis is less than its distance to the X-axis, meaning the fluorescence detection result is closer to the Y-axis. Conversely, the yellow-skinned genotype refers to a fluorescence detection result whose distance to the Y-axis is greater than its distance to the X-axis, meaning the fluorescence detection result is closer to the X-axis. The genotype located between the X-axis and Y-axis is the F1 genotype (AB).
[0068] In a specific embodiment, the primer pair of the KASP molecular marker RY-1 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; the two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.5.
[0069] In a specific embodiment, the primer pair of the KASP molecular marker RY-2 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers; the two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.8.
[0070] The technical solutions described above in this application will be explained in detail below with reference to specific embodiments.
[0071] Example 1
[0072] This example provides a more detailed explanation of the BSA-seq mapping analysis of genes responsible for the red / yellow skin trait in melons:
[0073] Step 1: Constructing a genetic population
[0074] In this study, a high-generation inbred line of red-skinned melon (dark green in the young fruit stage and orange-red in the mature fruit stage) was used as the female parent, and a high-generation inbred line of yellow-skinned melon (light green in the young fruit stage and bright yellow in the mature fruit stage) was used as the male parent. The F1 generation was obtained through hybridization, and the F2 segregating population (n=440) was obtained by self-pollination of the F1 generation.
[0075] Step 2: Extreme Phenotype Screening Method
[0076] 1) Phenotypic evaluation criteria
[0077] Developmental dynamics observation: Record the changes in fruit peel color during the young fruit stage (15 days after pollination) and the mature fruit stage (35 days after pollination).
[0078] Objective measurement: L, a* and b* color values were measured using a spectrophotometer (model: TS7708, Sanenshi, Guangdong). Three sites were measured for each fruit, and the average value was taken.
[0079] Subjective verification: Color grading was conducted independently by 3 professionals.
[0080] 2) Screening for extreme individuals
[0081] Based on colorimeter data measurement and subjective evaluation, plants with dark green young fruit and orange-red ripe fruit were selected from the F2 population to construct an extreme red-skinned mixed pool (n=30) (e.g. Figure 2 (as shown)
[0082] Based on colorimeter data measurements and subjective evaluation, plants with light green young fruit and bright yellow mature fruit were selected from the F2 population to construct an extreme yellow-skinned mixed pool (n=30). Figure 1 (As shown).
[0083] Step 3: BSA-seq localization analysis
[0084] 1) DNA extraction
[0085] DNA was extracted from the parents and two extreme pools using the CTAB method (concentration ≥50 ng / μL, OD260 / 280 = 1.8-2.0). Specifically:
[0086] 1.1) Weigh 0.1-0.3g of fresh leaves and grind them into powder in liquid nitrogen. Transfer the powder to a 2mL centrifuge tube, add 500μL of DNA extraction buffer, and vortex thoroughly to mix.
[0087] 1.2) Incubate in a constant temperature water bath at 65℃ for 15-20 minutes, vortexing the sample once every 5 minutes;
[0088] 1.3) Add an equal volume of chloroform-isoamyl alcohol and mix slowly on a shaker for 10-15 minutes;
[0089] 1.4) Centrifuge at 4℃ and 7500 rpm for 15 min;
[0090] 1.5) Transfer the supernatant to a new 1.5 mL Eppendorf tube, extract once with an equal volume of 500 μL of phenol / chloroform mixture, and then extract once with an equal volume of chloroform.
[0091] 1.6) Carefully transfer the supernatant to a new 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol, invert the tube several times, and let it stand at -20°C for 10 min;
[0092] 1.7) Centrifuge at 12000 rpm for 5 min to precipitate DNA, and discard excess liquid;
[0093] 1.8) Wash the DNA with 75% ethanol, discard the ethanol, and air dry thoroughly.
[0094] 1.9) Dissolve the DNA in 30-50 μL of TER (TE+RNase, final RNase concentration 50 µg / mL) buffer. Perform library construction and sequencing on the Illumina NovaSeq platform in PE150 mode with an average depth ≥30×. The TER buffer is a mixture of Tris-HCl (tris(hydroxymethyl)aminomethane) hydrochloride and EDTA (ethylenediaminetetraacetic acid). Tris-HCl maintains a stable pH, while EDTA chelates metal ions, inhibiting DNase activity and preventing DNA degradation. RNase is a ribonuclease that specifically degrades residual RNA in the sample, ensuring higher purity of the final extracted DNA product and reducing RNA interference in subsequent experiments (such as PCR and sequencing).
[0095] 2) Data Analysis
[0096] SNP detection: GATK 4.1 standard procedure, filtering parameters (QD < 2.0 | FS > 60.0 | MQ < 40.0).
[0097] Association analysis: The SNP-index algorithm was used with a window step size of 10kb and a significance threshold Δ(SNP-index) > 0.4.
[0098] 3) Location results
[0099] A significant association signal was obtained in the 500407bp-1799822bp region (approximately 1.3Mb) of chromosome 4 in melon. Figure 3 Within this interval, there are a total of 121 polymorphic genes (including 31 non-synonymous mutant genes, as shown in Table 1).
[0100] Table 1 Gene numbers and gene annotations within the BSA localization interval.
[0101]
[0102] Example 2
[0103] This embodiment provides a more detailed explanation of the identification of genes responsible for the red / yellow skin trait in melons and the development of KASP markers:
[0104] Step 1: KASP Tag Development
[0105] Based on the preliminary BSA-seq localization results in Example 1, KASP primers were designed using professional software such as PrimerPicker within the candidate region of chromosome 4 of melon, from 500407bp to 1799822bp, according to the SNP variation information within the region.
[0106] In the design process, seven sets of KASP primers were first developed at a uniform spacing of 0.2 Mb (primer sequences are shown in Table 2). Each set of KASP molecular markers contains three primers: two forward primers (F1 and F2) and one reverse primer (R). The FAM fluorescent group was added to the 5' end of primer F1, and the HEX fluorescent group was added to the 5' end of primer F2.
[0107] Table 2
[0108]
[0109] Step 2: Validation Group
[0110] Ten parents (red-skinned melon female parent and yellow-skinned melon male parent) and ten F1 plants were selected to verify the polymorphism of the seven KASP molecular markers. The results showed that all seven markers exhibited clear polymorphism among the parents: in the genotyping results, the genotype tending towards the Y-axis was the maternal homozygous type (AA), the genotype tending towards the X-axis was the paternal homozygous type (BB), and the genotype in between was the F1 heterozygous type (AB). This indicates that the seven KASP molecular markers developed all conform to the law of genetic segregation and can be used for subsequent genotyping experiments.
[0111] Step 3: Genotyping Process
[0112] 1) Extract DNA, as in Example 1.
[0113] 1.1) Weigh 0.1g-0.3g of fresh leaves, grind them into powder in liquid nitrogen, transfer them to a 2mL centrifuge tube, add 500μL of DNA extraction buffer, and vortex thoroughly to mix.
[0114] 1.2) Incubate in a constant temperature water bath at 65℃ for 15-20 minutes, vortexing the sample once every 5 minutes;
[0115] 1.3) Add an equal volume of chloroform-isoamyl alcohol and mix slowly on a shaker for 10-15 minutes;
[0116] 1.4) Centrifuge at 4℃ and 7500 rpm for 15 min;
[0117] 1.5) Transfer the supernatant to a new 1.5 mL Eppendorf tube, extract once with an equal volume of 500 μL of phenol / chloroform mixture, and then extract once with an equal volume of chloroform.
[0118] 1.6) Carefully transfer the supernatant to a new 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol, invert the tube several times, and let it stand at -20°C for 10 min;
[0119] 1.7) Centrifuge at 12000 rpm for 5 min to precipitate DNA, and discard excess liquid;
[0120] 1.8) Wash the DNA with 75% ethanol, discard the ethanol, and air dry thoroughly.
[0121] 1.9) Dissolve the DNA in 30-50 μL of TER (TE+RNase, final RNase concentration 50 µg / mL) buffer. Perform library construction and sequencing on the Illumina NovaSeq platform, PE150 mode, with an average depth ≥30×.
[0122] 2) PCR reaction system (2.014 μL total system)
[0123] Includes: 1 μL of 2×KASP Master Mix, 0.014 μL of 100 μM primer mixture (0.003 μL for F1 and F2, and 0.008 μL for R), and 1 μL of DNA template.
[0124] 3) Amplification program
[0125] Pre-denaturation at 94℃ for 15 min;
[0126] Denaturation at 94℃ for 20 seconds
[0127] Annealing and extending at 61℃-55℃ for 60 seconds, 10 cycles;
[0128] 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, 26 cycles.
[0129] 4) Testing platform
[0130] The Matrix Arrayer 2250 (Hanchen Guangyi) detection system was used to collect and analyze fluorescence signals of PCR products. Based on the fluorescence typing results, the characteristics of melon peel were accurately classified, providing an efficient and stable detection tool for molecular breeding.
[0131] Step 4: Calculation of classification accuracy
[0132] Formula used:
[0133] Accuracy = (Number of correctly genotyped samples / Total number of samples) × 100%, which is used to quantitatively evaluate the genotyping effect of the marker. "Correctly genotyped" refers to samples whose molecular marker genotyping results are consistent with the actual phenotypic observation results.
[0134] Step 5: Label Validity Screening and Verification
[0135] Seven KASP markers were screened using plants with extreme phenotypes (red and yellow skin) in the F3 population, such as... Figure 4 As shown, the results indicate that five marker groups (RY-1, RY-2, RY-3, RY-5, and RY-6) can be successfully used for genotyping. RY-1 and RY-2 showed relatively high genotyping accuracies, at 84.2% and 73.7% respectively, suggesting a strong linkage between RY-1 and RY-2 and the target gene. The remaining markers had genotyping accuracies of 68.4% for RY-3, 65% for RY-5, and 44.4% for RY-6.
[0136] To further verify the reliability of the above markers, melon samples with red and yellow skin phenotypes from the F2 population were selected for expanded validation. The results showed that the genotyping accuracy of the RY-1 molecular marker increased to 95.2%, and the genotyping accuracy of the RY-2 molecular marker increased to 93.8%, both showing a high correlation with the red / yellow skin trait (e.g., Figure 5 (As shown). In summary, RY-1 and RY-2 molecular markers can be reliably used for the accurate identification of red and yellow traits in melon peel.
[0137] While specific embodiments of this application have been described in detail, this should not be construed as limiting the scope of protection of this application. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims still fall within the scope of protection of this application.
Claims
1. The application of a KASP molecular marker in identifying the red / yellow skin trait of melons, characterized in that, The identification of red / yellow skin characteristics in melons includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was performed based on primer pairs of KASP molecular markers RY-1 or RY-2 to obtain the gene type of the target melon. Based on the detected gene type, the trait of the target melon was determined. The KASP molecular marker RY-1 was designed based on the SNP site at the 51st base of the nucleotide sequence shown in SEQ ID NO.1, where the base at the SNP site was mutated from T to C. The KASP molecular marker RY-2 was designed based on the SNP site at the 51st base of the nucleotide sequence shown in SEQ ID NO.2, where the base at the SNP site was mutated from C to T. For the KASP molecular marker RY-1, the TT or TC genotype is marked as red skin type, and the CC genotype is marked as yellow skin type; For the KASP molecular marker RY-2, the TT or TC genotype is marked as red skin type, and the CC genotype is marked as yellow skin type; The melons mentioned are advanced inbred lines of red-skinned melons, advanced inbred lines of yellow-skinned melons, and / or their hybrid offspring.
2. The application according to claim 1, characterized in that, The PCR amplification includes: Pre-denaturation at 94℃ for 15 min; Denaturation at 94℃ for 20 seconds Annealing and extending at 61℃-55℃ for 60 seconds, 10 cycles; 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, 26 cycles.
3. The application according to claim 1, characterized in that, The primer pair for the KASP molecular marker RY-1 includes two forward primers and one reverse primer, with fluorescent reporter groups FAM and HEX added to the 5' ends of the two forward primers; The two forward primers include RY-1-F1 as shown in SEQ ID NO.3 and RY-1-F2 as shown in SEQ ID NO.4, and the reverse primer is RY-1-R as shown in SEQ ID NO.
5.
4. The application according to claim 1, characterized in that, The primer pair for the KASP molecular marker RY-2 includes two forward primers and one reverse primer, with fluorescent reporter groups FAM and HEX added to the 5' ends of the two forward primers; The two forward primers include RY-2-F1 as shown in SEQ ID NO.6 and RY-2-F2 as shown in SEQ ID NO.7, and the reverse primer is RY-2-R as shown in SEQ ID NO.
8.
5. The application according to claim 3 or 4, characterized in that, The gene type was obtained based on the following reaction system: 1 μL of 2×KASP Master Mix, 0.003 μL each of primer F1 and primer F2 at a concentration of 100 μM, 0.008 μL of primer R, and 1 μL of DNA template.
6. The application according to claim 3 or 4, characterized in that, The primer pairs for the KASP molecular markers RY-1 or RY-2 can be used to prepare kits for identifying KASP molecular markers that indicate the red or yellow phenotype of melons.
Citation Information
Patent Citations
APRR2 gene related to green peel traits of melons
CN110106186A
Molecular marker related to peel color of muskmelon as well as method and application thereof
CN112375839A