Cic rearranged sarcoma detection primer set, kit and use thereof

By designing a specific primer combination for CIC rearranged sarcoma, and combining multiplex fluorescent PCR and high-resolution capillary electrophoresis, a highly efficient and sensitive detection of CIC rearranged sarcoma was achieved, solving the problem of detection difficulties in existing technologies and showing good application prospects.

CN121065340BActive Publication Date: 2026-04-10BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511324368.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-17
Publication Date
2026-04-10
Estimated Expiration
2045-09-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently, sensitively, and economically detecting the characteristic fusion genes of CIC rearrangement sarcomas, especially CIC::DUX4, CIC::NUTM1, and CIC::FOXO4, leading to difficulties in clinical diagnosis.

Method used

A primer set for CIC rearrangement sarcoma detection was designed, including primer sets A, B, C, D, E, and F. Specific primers were designed for different types of fusion genes. Combined with multiplex fluorescent PCR and high-resolution capillary electrophoresis, the simultaneous detection of 20 variant types was achieved.

Benefits of technology

It achieves sensitive detection of 20 variant types of gene fusions in three major categories: CIC::DUX4, CIC::NUTM1, and CIC::FOXO4, with a detection limit of ≤10 copies, a detection time of no more than 240 minutes, and 100% consistency between the detection results and morphological diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065340B_ABST
    Figure CN121065340B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of gene detection, and particularly relates to a CIC rearrangement sarcoma detection primer group, a kit and application thereof.The primer combination provided by the present application has good detection sensitivity and specificity.The present application combines the above primer combination with multiplex fluorescence PCR and high-resolution capillary to detect CIC rearrangement sarcoma, can detect 20 types of variation of 3 categories of gene fusion of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 at one time, the detection lower limit is ≤10 copies, and the detection time is not more than 240 minutes.In addition, 30 real tumor samples are tested by using the primer combination of the present application, the detection results are consistent with the morphological diagnosis results, the consistency reaches 100%, and further Sanger sequencing is performed on the PCR amplification products of the positive samples, and all the verification is passed.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and in particular to a CIC rearrangement sarcoma detection primer set, a kit and application thereof. BACKGROUND

[0002] CIC rearrangement sarcoma is a rare and highly invasive malignant small round cell sarcoma, which belongs to a kind of Ewing sarcoma. Its typical histological features include: tumor cells are mainly small to medium-sized round cells, arranged closely, with vacuolated nuclei, obvious nucleoli, and little cytoplasm and acidophilic cytoplasm; part of the cytoplasm is rich, the cells are epithelioid or spindle-shaped, and nuclear polymorphism and high mitotic figures are common. In addition, map-like necrosis and focal mucoid stroma are often seen, and a few areas may also appear spindle cells, clear cells or pleomorphic giant cells. Due to the rarity of the tumor, poor prognosis and complex and diverse histomorphology, it has certain similarity with Ewing sarcoma, EWSR1 non-ETS fusion round cell sarcoma, sarcoma with BCOR genetic changes, desmoplastic small round cell tumor, NUT cancer and other round cell or spindle cell sarcomas in histomorphology and immunohistochemical expression characteristics, so the difficulty of clinical diagnosis and pathological differential diagnosis is great, and therefore a sensitive and efficient detection method is urgently needed to assist in diagnosis.

[0003] Such sarcomas have characteristic fusion genes, mainly CIC::DUX4, CIC::NUTM1 and CIC::FOXO4, which have important diagnostic value. At present, the main methods for clinical detection of tumor gene variation include fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR) and next-generation sequencing technology. FISH is suitable for single fusion gene detection, but not suitable for multi-gene variation screening; although next-generation sequencing covers comprehensively, it has high cost, complex process and long cycle, and still has certain limitations in clinical routine application. In contrast, the PCR method amplifies specific nucleotide sequences by targeting primers, and detects by means of fluorescence signal or gel electrophoresis, which has the advantages of simple operation, high sensitivity and strong specificity. At present, there are few studies on the detection of CIC rearrangement sarcoma, and there is no PCR kit product that can be used to accurately detect CIC rearrangement sarcoma.

[0004] Therefore, the present application is proposed. SUMMARY

[0005] To solve the above technical problems, the present application provides a CIC rearrangement sarcoma detection primer set, a kit and application thereof.

[0006] Specifically, the technical scheme of the present application is as follows:

[0007] In a first aspect, the present application provides a CIC rearranged sarcoma detection primer set, comprising at least one of primer set A, primer set B, primer set C, primer set D, primer set E, primer set F as shown below:

[0008] The primer set A comprises upstream CIC primer 1, upstream CIC primer 2, downstream DUX4 primer 3, downstream DUX4 primer 4;

[0009] The primer set B comprises upstream CIC primer 5, downstream DUX4 primer 6, downstream DUX4 primer 7, downstream DUX4 primer 8;

[0010] The primer set C comprises upstream CIC primer 9, downstream DUX4 primer 10, downstream DUX4 primer 11, downstream DUX4 primer 12;

[0011] The primer set D comprises upstream CIC primer 13, downstream DUX4 primer 14;

[0012] The primer set E comprises upstream CIC primer 15, upstream CIC primer 16, upstream CIC primer 17, upstream CIC primer 18, downstream NUTM1 primer 19, downstream NUTM1 primer 20, downstream NUTM1 primer 21, downstream NUTM1 primer 22;

[0013] The primer set F comprises upstream CIC primer 23, upstream CIC primer 24, downstream FOXO4 primer 25, downstream FOXO4 primer 26, downstream FOXO4 primer 27;

[0014] The nucleotide sequences of the upstream CIC primer 1, the upstream CIC primer 2, the downstream DUX4 primer 3, the downstream DUX4 primer 4, the upstream CIC primer 5, the downstream DUX4 primer 6, the downstream DUX4 primer 7, the downstream DUX4 primer 8, the upstream CIC primer 9, the downstream DUX4 primer 10, the downstream DUX4 primer 11, the downstream DUX4 primer 12, the upstream CIC primer 13, the downstream DUX4 primer 14, the upstream CIC primer 15, the upstream CIC primer 16, the upstream CIC primer 17, the upstream CIC primer 18, the downstream NUTM1 primer 19, the downstream NUTM1 primer 20, the downstream NUTM1 primer 21, the downstream NUTM1 primer 22, the upstream CIC primer 23, the upstream CIC primer 24, the downstream FOXO4 primer 25, the downstream FOXO4 primer 26, the downstream FOXO4 primer 27 are shown in SEQ ID NO. 01-SEQ ID NO. 27, respectively.

[0015] Preferably, in the present application, the primer set comprises primer set A, primer set B, primer set C, primer set D, primer set E and primer set F.

[0016] The CIC-rearranged sarcoma detection primer set provided by the present application is designed on the basis of the characteristic fusion genes CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 of CIC-rearranged sarcoma.

[0017] Although the literature reports that CIC-rearranged sarcoma carries characteristic fusion genes, mainly including three types of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4, which have important auxiliary diagnostic value. However, in clinical research, the relevant fusion sequences in different individuals are still different even if they suffer from the same tumor or even the same fusion gene. Therefore, the fusion information reported in the literature cannot be directly used to guide the design of amplification primers to construct products.

[0018] The prior art does not disclose the characteristic information and combination mode of the gene segment where the tumor fusion gene frequently occurs. The present application obtains 20 combination types of the above-mentioned three fusion genes at the RNA level by studying the frequently occurring fracture fusion site region information of such tumor fusion genes, based on the differences in combination mode and combination characteristics, and further combines the characteristics of the amplicon in the PCR amplification product in the clinical field, and finally designs the above-mentioned primer set.

[0019] The above-mentioned primer combination provided by the present application has good detection sensitivity and specificity. The above-mentioned primer combination is used for combined detection of CIC-rearranged sarcoma, and through the combination of multiple primer groups and specific fluorescent groups, 20 variation types of 3 major gene fusions of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 can be detected at one time, the detection lower limit is ≤10 copies, the detection time is not more than 240 minutes, and it has good application prospect.

[0020] In the second aspect, the present application provides the use of the above-mentioned CIC-rearranged sarcoma detection primer set in the preparation of a reagent or kit for detecting or diagnosing CIC-rearranged sarcoma.

[0021] In the third aspect, the present application provides a CIC-rearranged sarcoma detection kit comprising the CIC-rearranged sarcoma detection primer set described in the first aspect.

[0022] Preferably, in the present application, the kit further comprises a fluorescent group; the fluorescent group is selected from at least one of FAM, VIC, TAMRA, ROX, HEX, TET, JOE, NED, Cy5 and Cy3.

[0023] Preferably, in the present application, the kit further comprises a positive control; the positive control is a plasmid standard containing a fusion gene fragment.

[0024] Preferably, the fusion gene fragment comprises at least one of the following gene fragments:

[0025] a CIC::DUX4 fusion gene fragment of type C1, the nucleotide sequence of which is shown as SEQ ID NO. 30;

[0026] a CIC::DUX4 fusion gene fragment of type C3, the nucleotide sequence of which is shown as SEQ ID NO. 31;

[0027] a CIC::DUX4 fusion gene fragment of type C5, the nucleotide sequence of which is shown as SEQ ID NO. 32;

[0028] a CIC::DUX4 fusion gene fragment of type C4, the nucleotide sequence of which is shown as SEQ ID NO. 33;

[0029] a CIC::NUTM1 fusion gene fragment of type C12, the nucleotide sequence of which is shown as SEQ ID NO. 34;

[0030] a CIC::FOXO4 fusion gene fragment of type C18, the nucleotide sequence of which is shown as SEQ ID NO. 35.

[0031] Preferably, in the present application, the kit further comprises a primer set G of a reference gene HPRT1, the primer set G comprising an upstream primer 28 and a downstream primer 29; the nucleotide sequences of the upstream primer 28 and the downstream primer 29 are shown as SEQ ID NO. 28-SEQ ID NO. 29 in turn.

[0032] Preferably, in the present application, the kit further comprises a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0033] In a fourth aspect, the present application provides a CIC rearranged sarcoma detection device, which uses the CIC rearranged sarcoma detection kit to amplify the sample to be tested; then determines the molecular weight of the amplification product; and finally determines whether the sample to be tested is a CIC rearranged sarcoma based on the determination result of the molecular weight. Advantages

[0034] The application provides a CIC rearrangement sarcoma detection primer group, a kit and application thereof, and the primer group comprises at least one of primer group A, primer group B, primer group C, primer group D, primer group E and primer group F. The primer combination provided by the application has good detection sensitivity and specificity. In a more specific embodiment, the application combines the above primer combination for CIC rearrangement sarcoma detection through multiplex fluorescence PCR and high-resolution capillary, can detect 20 types of variation of 3 major categories of CIC::DUX4, CIC::NUTM1 and CIC::FOXO4 gene fusions at one time, can detect ≤10 copies of lower limit, and the detection time is not more than 240 minutes. In addition, 30 real tumor samples are tested by using the primer combination of the application, the detection results are consistent with the morphological diagnosis results, and the consistency reaches 100%; further Sanger sequencing is performed on the PCR amplification product of the positive sample, and all are verified. BRIEF DESCRIPTION OF DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the application or prior art, the drawings needed to be used in the embodiments or prior art description will be described below.

[0036] Figure 1 Figure 1 is a diagram of 20 types of CIC rearrangement tumor molecular genetics determined in embodiment 1.

[0037] Figure 2 Figure 2 is a detection result of C1 type CIC::DUX4 fusion gene in embodiment 2.

[0038] Figure 3 Figure 3 is a detection result of C2 type CIC::DUX4 fusion gene in embodiment 2.

[0039] Figure 4 Figure 4 is a detection result of C3 type CIC::DUX4 fusion gene in embodiment 2.

[0040] Figure 5 Figure 5 is a detection result of C4 type CIC::DUX4 fusion gene in embodiment 2.

[0041] Figure 6 Figure 6 is a detection result of C5 type CIC::DUX4 fusion gene in embodiment 2.

[0042] Figure 7 Figure 7 is a detection result of C6 type CIC::DUX4 fusion gene in embodiment 2.

[0043] Figure 8 Figure 8 is a detection result of C7 type CIC::DUX4 fusion gene in embodiment 2.

[0044] Figure 9Results for detection of CIC::DUX4 fusion gene of type C8 in Example 2.

[0045] Figure 10 Results for detection of CIC::DUX4 fusion gene of type C9 in Example 2.

[0046] Figure 11 Results for detection of CIC::DUX4 fusion gene of type C10 in Example 2.

[0047] Figure 12 Results for detection of CIC::DUX4 fusion gene of type C11 in Example 2.

[0048] Figure 13 Results for detection of CIC::NUTM1 fusion gene of type C12 in Example 2.

[0049] Figure 14 Results for detection of CIC::NUTM1 fusion gene of type C13 in Example 2.

[0050] Figure 15 Results for detection of CIC::NUTM1 fusion gene of type C14 in Example 2.

[0051] Figure 16 Results for detection of CIC::NUTM1 fusion gene of type C15 in Example 2.

[0052] Figure 17 Results for detection of CIC::NUTM1 fusion gene of type C16 in Example 2.

[0053] Figure 18 Results for detection of CIC::NUTM1 fusion gene of type C17 in Example 2.

[0054] Figure 19 Results for detection of CIC::FOXO4 fusion gene of type C18 in Example 2.

[0055] Figure 20 Results for detection of CIC::FOXO4 fusion gene of type C19 in Example 2.

[0056] Figure 21 Results for detection of CIC::FOXO4 fusion gene of type C20 in Example 2.

[0057] Figure 22 Results for determination of performance of the kit in Example 3. DETAILED DESCRIPTION

[0058] The technical solutions provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application. If not specifically indicated, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used can be obtained from commercial channels. Example 1

[0059] This example provides a CIC sarcoma detection kit, and the process of obtaining the kit is described.

[0060] The present application comprehensively reports and local laboratory more than 100 cases of CIC rearrangement sarcoma fusion gene data, unified reference genome version and transcript information (CIC: NM_015125; DUX4: NM_001306068; NUTM1: NM_001284292; FOXO4: NM_005938), remove the unreliable cases, and divide the three fusion genes (CIC::DUX4, CIC::NUTM1 and CIC::FOXO4) into 20 types of combination types at the RNA level, see Figure 1 .

[0061] On the basis of determining the above-mentioned 20 types of variations, the present application further adopts various measures to design detection primer groups and perform experimental verification to meet the detection requirements of highly degraded and fragmented nucleic acids of the most common formalin-embedded paraffin (FFPE) tumor samples in clinical practice. In addition to meeting the specificity and compatibility of conventional multiplex primers, the present application also requires the primers to meet the following conditions: ① The upstream primer must be located within the upstream fusion gene range, and the downstream primer must be located within the downstream fusion partner gene range, and the primer cannot cross the breakpoint of the two genes to prevent the insertion and deletion of bases at this position from affecting the amplification efficiency; ② The primers used in different fusion types of the same gene should be as simple and consistent as possible to minimize non-specific cross-reactions; ③ Each tube primer combination can amplify all target fragments in the tube; ④ The total number of primers should be as small as possible to reduce unnecessary cross-reactions; ⑤ Each primer has a difference in amplification product greater than or equal to 2 bp to meet the resolution requirements of high-resolution capillary electrophoresis instruments; ⑥ The amplification fragment should be greater than 100 bp to avoid primer dimer signal interference; ⑦ Each tube primer combination has no non-specific amplification with human genomic DNA. In addition, formalin-embedded paraffin tumor samples are the most common sample type in clinical practice, and their nucleic acids, especially RNA, are highly degraded and fragmented. In order to meet the detection requirements of such samples, the present application limits the amplification fragment to be less than 350 bp.

[0062] According to the above principles, the application designs and optimizes multiple groups of primer combinations, and finally the multiple primer groups combined with specific fluorescent groups can detect 20 types of gene fusion in 3 categories at one time (Table 1), with the minimum detectable lower limit of 10 copies and the shortest detection time of 240 minutes. The kit is designed according to the type of variation, and A-D tubes detect CIC::DUX4 fusion (C1-C11 type), E tube detects CIC::NUTM1 (C12-C17 type), F tube detects CIC::FOXO4 (C18-C20 type) fusion gene and G tube detects the expression of housekeeping gene HPRT1, and the nucleic acid quality of the quality control sample.

[0063] Table 1 Design of detection kit and primer sequences used

[0064]

[0065] Table 2 Each tube reaction system (25 μL as an example)

[0066]

[0067] The kit also includes positive and negative controls, the negative control is pure water, and the positive control is a plasmid standard (1000 copies / μl) inserted with a fusion gene fragment. The gene variation corresponding to each tube positive control and its inserted nucleotide sequence are as follows:

[0068] Tube A, C1 type CIC::DUX4 fusion:

[0069] 5'-cccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatactcctccctgcggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtctaggcccggtgagagactccactccgcggagaactgcctttctttcctgggcatcccggggatcccagagccggcccaggtaccagcagacctgcgcgcagtgcgcaccccggctgacgtgcaagggagctcgctggcctctctgtgcccttgttcttccgtgaaattctggctgaatgtctccccccaccttccgacgctgtctaggcaaacctggattagagttacatctcctggatgattagttcagagatatattaaaatgccccctcc-3'.

[0070] Tube B, Type C3 CIC::DUX4 fusion:

[0071] 5'-gcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggctgccactcccacggagcagccccctggagctgaggctcctctccctgtaccgccccccactggcaccgctgctgcccctgcccccactcccagccccgcagggggccctgaccccacctcacccagctcggactctggcacggcccaggctgccccgccactgcctccacccccagagtcggggcctggacagcctggctgggagggggctccccagccctcccccccaccgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggggttgggacggggtcgggtggttcggggcagggcggtggcctctctttcgcggggaacacctggctggctacggaggggcgtgtctccgccccgccccctccaccgggctgaccggcctgggattcctgccttcta-3'.

[0072] Tube C, C5 type CIC::DUX4 fusion:

[0073] 5'-cccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatactcctccctgcggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagaggggatctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcac-3'.

[0074] Tube D, CIC::DUX4 fusion of type C4:

[0075] 5'-ggcgcaccctggaccagcgccgggccctggtcatgcagctctttcaggaccatggcttcttcccgtcagcccaggccacagccgccttccaggcccgctatgcagacatctttccctccaaggtttgtctgcagttgaagatccgtgaggtgcgccagaagatcatgcaggctgccactcccacggagcagccccctggagctgaggctcctctccctgtaccgccccccactggcaccgctgctgcccctgcccccactcccagccccgcagggggccctgaccccacctcacccagctcggactctgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcga-3'.

[0076] Tube E, CIC::NUTM1 fusion of type C12:

[0077] 5'-cctgctgaggagcggaccagcgccaagggccctgagaccatggccagcaaattccccagctcatcttcagactggcgcgtccctgggcagggcctggagaatcgtggggagcctcccactcctcccagcccggccccagctccagctgtagcccctggtggcagcagcgagagcagcagtgggcgggcagccggggacaccccggagcgcaaggaggcggctggtactggcaagaaggtgaaggtgcggcccccgcccctgaagaagacctttgactctgtggacaacagggtcctgtcagaagtggacttcgaagagcgctttgctgagttgcctgagtttcggcctgaggaggtgctgccctcccccaccctgcagtctctggccacctcaccccgggccatcctgggctcttaccgcaagaagaggaagaactccacggtgtacattccgaagaaggcagcctccaagacacgggccccccgccggcgtcagcgtaaagcccagagacctcctgctcctgaggcacccaaggagatcccaccagaagctgtgaaggagtatgttgacatcatggaatggctggtggggactcacttggccactggggagtcagatggaaaacaagaggaagaagggcagcagcaggaggaggaagggatgtatccagatccaggtctcctgagctacatcaatgagctgtgttctcagaaggtctttgtctccaa-3'.

[0078] Tube F, CIC :: FOXO4 fusion in C18 type:

[0079] 5'-gcgggcagccggggacaccccggagcgcaaggaggcggctggtactggcaagaaggtgaaggtgcggcccccgcccctgaagaagacctttgactctgtggacaacagggtcctgtcagaagtggacttcgaagagcgctttgctgagttgcctgagtttcggcctgaggaggtgctgccctcccccaccctgcagtctctggccacctcaccccgggccatcctgggctcttaccgcaagaagaggaagaactccacggacctggattcagcacccgaggaccccacctcgcccaagcgcaagatgagaagacgctccagctgcagctcggagcccaacacccccaagagtgccaagtgcgagggggacatcttcacctttgaccgtacaggtacagaagccgaggacgtgcttggggagctagagtatgacaaggtgccatgtaaagcccccaagaagaaaccatctgtgctgccagctccacccgaaggtgccactccaacgagccctgtcggccactttgccaagtggtcaggcagcccttgctctcgaaaccgtgaagaagccgatatgtggaccaccttccgtccacgaagcagttcaaatgccagcagtgtcagcacccggctgtcccccttgaggccagagtctgaggtgctggcggaggaaataccagcttcagtcagcagttatgcagggggtgtccctcccaccctcaatgaaggt-3'.

[0080] The PCR amplification procedure used for detection is shown in Table 3 below:

[0081] Table 3 Amplification procedure

[0082]

[0083] The resulting PCR amplification products were electrophoresed on an ABI 3500 Genetic Analyzer (high resolution capillary electrophoresis instrument) with HiDi and Liz600 internal size standards, and analyzed for size using Gene Mapper software.

[0084] The detection results and their interpretation criteria are shown in Table 4. First, check if the G tube has a 190 bp ROX amplification peak. If not, the nucleic acid quality control fails and the nucleic acid needs to be extracted again for the experiment. If yes, the nucleic acid quality control is passed. Second, check if the A-F tube has an amplification peak greater than 100 bp of the corresponding fluorescent color: A tube, FAM fluorescent product peak corresponds to C1 / C2 / C8 type CIC::DUX4 fusion; B tube, FAM fluorescent product peak corresponds to C3 / C10 / C11 type CIC::DUX4 fusion; C tube, FAM fluorescent product peak corresponds to C5 / C6 / C7 type CIC::DUX4 fusion; D tube, FAM fluorescent product peak corresponds to C4 / C9 type CIC::DUX4 fusion; E tube, VIC fluorescent product peak corresponds to C12 / C13 / C14 / C15 / C16 / C17 type CIC::NUTM1 fusion; F tube, TAMRA fluorescent product peak corresponds to C18 / C19 / C20 type CIC::FOXO4 fusion. If A-F tube has no product peak greater than 100 bp of the corresponding fluorescent color, it is judged as negative, and no related gene fusion is detected.

[0085] Table 4 Result interpretation criteria

[0086] Example 2

[0087] This example detects the performance of the kit provided in Example 1.

[0088] The plasmids inserted with the corresponding fusion gene fragments (C1-C20) are used as fusion gene detection standards, and are configured into standard solution of corresponding concentration (1, 10, 100, 1000 copies / μl) as amplification templates. The kit and its detection procedure are used, and the minimum detectable fusion gene is 10 copies.

[0089] The detection results of C1-C20 types are shown in Table 4, respectively. Figures 2-21

[0090] Figure 2 The results show that the kit has good detection effect for C1 type CIC::DUX4 fusion gene in the range of 1-100 copies. The standard product tested is 250 bp FAM peak, and the minimum detection limit is 1 copy.

[0091] Figure 3 The results show that the kit has good detection effect for C2 type CIC::DUX4 fusion gene in the range of 1-100 copies. The standard product tested is 317 bp FAM peak, and the minimum detection limit is 10 copies.

[0092] Figure 4 ​Results show: the kit detects C3 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 272bp FAM peak, the minimum detection limit is 10 copies.

[0093] Figure 5 Results show: the kit detects C4 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 344bp FAM peak, the minimum detection limit is 10 copies.

[0094] Figure 6 Results show: the kit detects C5 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 208bp FAM peak, the minimum detection limit is 1 copy.

[0095] Figure 7 Results show: the kit detects C6 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 259bp FAM peak, the minimum detection limit is 10 copies.

[0096] Figure 8 Results show: the kit detects C7 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 135bp FAM peak, the minimum detection limit is 10 copies.

[0097] Figure 9 Results show: the kit detects C8 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 140bp FAM peak, the minimum detection limit is 10 copies.

[0098] Figure 10 Results show: the kit detects C9 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 210bp FAM peak, the minimum detection limit is 1 copy.

[0099] Figure 11 Results show: the kit detects C10 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 123bp FAM peak, the minimum detection limit is 10 copies.

[0100] Figure 12Results show: the kit detects C11 type CIC::DUX4 fusion gene in 1-100 copies has good detection effect, using standard test product for 194bp FAM peak, the minimum detection limit is 10 copies.

[0101] Figure 13 Results show: the kit detects C12 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 356bp VIC peak, the minimum detection limit is 10 copies.

[0102] Figure 14 Results show: the kit detects C13 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 240bp VIC peak, the minimum detection limit is 10 copies.

[0103] Figure 15 Results show: the kit detects C14 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 301bp VIC peak, the minimum detection limit is 10 copies.

[0104] Figure 16 Results show: the kit detects C15 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 337bp VIC peak, the minimum detection limit is 10 copies.

[0105] Figure 17 Results show: the kit detects C16 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 227bp VIC peak, the minimum detection limit is 1 copy.

[0106] Figure 18 Results show: the kit detects C17 type CIC::NUTM1 fusion gene in 1-100 copies has good detection effect, using standard test product for 285bp VIC peak, the minimum detection limit is 10 copies.

[0107] Figure 19 Results show: the kit detects C18 type CIC::FOXO4 fusion gene in 1-100 copies has good detection effect, using standard test product for 162bp TAMRA peak, the minimum detection limit is 1 copy.

[0108] Figure 20The results show that the kit has good detection effect on C19 type CIC::FOXO4 fusion gene in the range of 1-100 copies, the standard product test product is 290bp TAMRA peak, and the minimum detection limit is 10 copies.

[0109] Figure 21 The results show that the kit has good detection effect on C20 type CIC::FOXO4 fusion gene in the range of 1-100 copies, the standard product test product is 271bp TAMRA peak, and the minimum detection limit is 1 copy. Example 3

[0110] This example uses 30 real tumor samples (21 Ewing sarcoma, 2 sarcoma with BCOR genetic abnormalities, 5 CIC rearrangement sarcoma and 2 EWSR1 non-ETS fusion round cell sarcoma) to test the detection performance of the kit provided in Example 1.

[0111] All samples pass nucleic acid quality control, and 5 CIC rearrangement sarcomas are detected FAM signal product peaks, and the PCR amplification product of the positive sample is subjected to Sanger sequencing, and the results are all CIC::DUX4 fusion, which is consistent with the detection results of the kit, as shown in Figure 22 . Figure 22 The upper graph is the FAM signal peak of the kit detecting 30 samples with CIC::DUX4 fusion, and the lower graph is the Sanger sequencing verification result.

[0112] The histological type of the sample is analyzed, and the histological diagnosis of the positive sample is consistent with CIC rearrangement sarcoma (see Table 5), and the detection results of the remaining cases are all negative.

[0113] Table 5 Detection results of 30 real tumor samples

[0114]

[0115] The kit detection results of 30 tumor samples this time are consistent with the morphological diagnosis results, and the consistency is 100%.

[0116] In summary, the application provides a primer set, kit and application for detecting CIC rearrangement sarcoma by using multiplex fluorescent PCR combined with capillary electrophoresis fragment analysis technology, which has the advantages of simple operation, accurate results and economic advantage, and is suitable for clinical auxiliary diagnosis of CIC rearrangement sarcoma, and has good application prospect.

[0117] The above-described embodiments only express several implementation manners of the present application, facilitate concrete and detailed understanding of the technical solutions of the present application, but cannot be understood as a limitation on the patent protection scope of the present application. It should be noted that, for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which all belong to the protection scope of the present application.

Claims

1. A CIC rearranged sarcoma detection primer set characterized in that, The primer group A, the primer group B, the primer group C, the primer group D, the primer group E and the primer group F as shown below; The primer group A comprises upstream CIC primer 1, upstream CIC primer 2, downstream DUX4 primer 3, downstream DUX4 primer 4; the primer group B comprises upstream CIC primer 5, downstream DUX4 primer 6, downstream DUX4 primer 7, downstream DUX4 primer 8; the primer group C comprises upstream CIC primer 9, downstream DUX4 primer 10, downstream DUX4 primer 11, downstream DUX4 primer 12; the primer group D comprises upstream CIC primer 13, downstream DUX4 primer 14; the primer group E comprises upstream CIC primer 15, upstream CIC primer 16, upstream CIC primer 17, upstream CIC primer 18, downstream NUTM1 primer 19, downstream NUTM1 primer 20, downstream NUTM1 primer 21, downstream NUTM1 primer 22; the primer group F comprises upstream CIC primer 23, upstream CIC primer 24, downstream FOXO4 primer 25, downstream FOXO4 primer 26, downstream FOXO4 primer 27; The nucleotide sequences of the upstream CIC primer 1, the upstream CIC primer 2, the downstream DUX4 primer 3, the downstream DUX4 primer 4, the upstream CIC primer 5, the downstream DUX4 primer 6, the downstream DUX4 primer 7, the downstream DUX4 primer 8, the upstream CIC primer 9, the downstream DUX4 primer 10, the downstream DUX4 primer 11, the downstream DUX4 primer 12, the upstream CIC primer 13, the downstream DUX4 primer 14, the upstream CIC primer 15, the upstream CIC primer 16, the upstream CIC primer 17, the upstream CIC primer 18, the downstream NUTM1 primer 19, the downstream NUTM1 primer 20, the downstream NUTM1 primer 21, the downstream NUTM1 primer 22, the upstream CIC primer 23, the upstream CIC primer 24, the downstream FOXO4 primer 25, the downstream FOXO4 primer 26, the downstream FOXO4 primer 27 are sequentially shown in SEQ ID NO. 01-SEQ ID NO.

27.

2. The use of the CIC rearranged sarcoma detection primer group in claim 1 in the preparation of a reagent or kit for detecting or diagnosing CIC rearranged sarcoma.

3. A CIC rearrangement sarcoma detection kit characterized in that, The CIC rearranged sarcoma detection primer group in claim 1 is included.

4. The CIC rearrangement sarcoma detection kit of claim 3, wherein, The fluorescent group is further included; the fluorescent group is selected from at least one of FAM, VIC, TAMRA, ROX, HEX, TET, JOE, NED, Cy5, Cy3.

5. The CIC rearrangement sarcoma detection kit of claim 4, wherein, The positive control is further included; the positive control is a plasmid standard of an inserted fusion gene fragment.

6. The CIC rearrangement sarcoma detection kit of claim 5, wherein, The fusion gene fragment includes at least one of the gene fragments as shown below: A C1 type CIC::DUX4 fusion gene fragment, the nucleotide sequence of which is shown in SEQ ID NO. 30; A C3 type CIC::DUX4 fusion gene fragment, the nucleotide sequence of which is shown in SEQ ID NO. 31; A CIC::DUX4 fusion gene fragment of type C5, the nucleotide sequence of which is shown as SEQ ID NO. 32; A CIC::DUX4 fusion gene fragment of type C4, the nucleotide sequence of which is shown as SEQ ID NO. 33; A CIC::NUTM1 fusion gene fragment of type C12, the nucleotide sequence of which is shown as SEQ ID NO. 34; A CIC::FOXO4 fusion gene fragment of type C18, the nucleotide sequence of which is shown as SEQ ID NO.

35.

7. The CIC rearrangement sarcoma detection kit of claim 6, wherein, The primer set G of the internal reference gene HPRT1 also includes the upstream primer 28 and the downstream primer 29; the nucleotide sequences of the upstream primer 28 and the downstream primer 29 are shown as SEQ ID NO. 28-SEQ ID NO. 29 in turn.

8. The CIC rearrangement sarcoma detection kit of claim 7, wherein, The negative control, the PCR reaction buffer, the nucleic acid template and the ddH2O are also included.

Citation Information

Patent Citations

  • Sarcoma fusion gene and / or mutation joint detection primer group and kit

    CN112094915A