The application discloses a SNP molecular marker related to a nocardia seriolae resistance character of a seriola dumerili, a method for screening nocardia seriolae-resistant seriola dumerili and application of the SNP molecular marker.
By developing SNP molecular markers related to resistance to Nocardia amberjack in spotted bass, and using PCR amplification and sequencing technologies to screen for spotted bass individuals with the AA genotype, the problem of low efficiency in traditional disease resistance breeding has been solved, achieving efficient molecular breeding and early screening, and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2025-11-05
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of effective molecular markers in existing technologies for screening for resistance to Nocardia amberjack infection in spotted bass leads to low efficiency in the selection of traditional disease resistance traits, making it difficult to meet the needs of modern high-efficiency breeding.
A SNP molecular marker associated with resistance to Nocardia amberjack in spotted bass was developed. The spotted bass genome was detected using PCR amplification and sequencing technology, and spotted bass individuals with the AA genotype were screened as disease-resistant individuals for molecular-assisted selection breeding.
This technology enables early, high-throughput typing and screening of disease resistance traits in spotted bass, significantly improving breeding efficiency, shortening the breeding cycle, and saving costs, thus providing a reliable tool for molecular breeding of disease-resistant spotted bass.
Smart Images

Figure CN121065365B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquatic organism technology, specifically relating to a SNP molecular marker related to the anti-Nocardia amberjack trait of spotted bass and a method and application for screening spotted bass resistant to Nocardia amberjack. Background Technology
[0002] Spotted sea bass ( Lateolabrax maculatus It belongs to the order Perciformes, family Lateolabracidae, and genus Lateolabracidae. Lateolabrax With the rapid development of sea bass farming, disease problems have become increasingly serious, among which Nocardia amberjack (Nicotiana spp.) N.seriolae White spot disease of the internal organs caused by infection is one of the major diseases, causing serious economic losses to the aquaculture industry and becoming a major bottleneck restricting the sustainable development of the spotted bass industry.
[0003] Nocardia amberjack is a Gram-positive bacterium. Infection with this bacterium can cause ulcers and bleeding on the body surface of sea bass, as well as the formation of white or gray nodules in the internal organs. The disease has a long epidemic season and can break out year-round, with the most severe outbreaks occurring when water temperatures are between 25 and 28°C. Due to the lack of effective treatments, the mortality rate is high, and latent infections and chronic outbreaks are easily overlooked, often leading to large-scale deaths and posing a significant threat to sea bass farming.
[0004] Traditional methods for breeding disease resistance traits rely on phenotypic screening, which are highly susceptible to environmental influences, time-consuming, and inefficient, failing to meet the demands of modern high-efficiency breeding. Molecular marker-assisted selection (MAS) technology allows for genotypic identification at an early stage in individuals, improving the accuracy and efficiency of breeding. Among these, single nucleotide polymorphism (SNP) markers, as a highly stable genetic marker covering the entire genome, have been widely used in molecular breeding of various farmed fish species. Currently, however, there is a lack of SNP markers closely related to the resistance of spotted bass to Nocardia infection. Summary of the Invention
[0005] The purpose of this invention is to provide a SNP molecular marker related to the resistance of spotted bass to Nocardia amberjack, and a method and application for screening spotted bass resistant to Nocardia amberjack. The SNP molecular marker described in this invention is an effective SNP marker for early molecular screening of spotted bass for the infection trait of Nocardia amberjack, enabling disease-resistant breeding of spotted bass and obtaining spotted bass resistant to Nocardia amberjack.
[0006] This invention provides an SNP molecular marker associated with the anti-Nocardia amberjack trait in spotted sea bass. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The 760th base of the sequence shown in SEQ ID NO.1 is the SNP site, and its base is A or G. When the SNP molecular marker is AA genotype, the spotted sea bass is identified as anti-Nocardia amberjack.
[0007] The present invention also provides the application of reagents for detecting the molecular markers described in the above technical solutions in screening or breeding sea bass resistant to Nocardia amberjack or in identifying the resistance of sea bass to Nocardia amberjack.
[0008] The present invention also provides the application of reagents for detecting the molecular markers described in the above technical solutions in screening or breeding disease-resistant perch, wherein the disease is caused by Nocardia auricula-judae.
[0009] Preferably, the reagent includes primer pairs for detecting the molecular markers described in the above technical solutions.
[0010] The present invention also provides a reagent for detecting the SNP molecular markers described in the above technical solutions, the reagent comprising primer pairs for detecting the SNP molecular markers described in the above technical solutions.
[0011] Preferably, the primer pair includes primer F and primer R; the nucleotide sequence of primer F is shown in SEQ ID NO.3, and the nucleotide sequence of primer R is shown in SEQ ID NO.4.
[0012] The present invention also provides a molecular detection product for detecting the SNP markers described in the above-mentioned technical solutions, comprising the reagents described in the above-mentioned technical solutions and PCR amplification reagents.
[0013] Preferably, the molecular diagnostic product further includes a DNA extraction reagent.
[0014] This invention also provides a method for screening spotted bass individuals or parent spotted bass resistant to Nocardia amberjack based on the SNP molecular markers described in the above technical solution, comprising the following steps:
[0015] Using the sea bass genome as a template, the sea bass genome was amplified by PCR and sequenced using the reagents or molecular detection products described in the above technical solution. When the SNP molecular marker was AA genotype, sea bass resistant to Nocardia amurensis were screened.
[0016] Preferably, each 10 μL PCR amplification system includes 0.4 μL of primer pair for detecting the SNP molecular marker described in the above technical solution, 1 μL of template, 5 μL of 2×Taq PCR Master, and the remainder water; the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.
[0017] This invention provides a SNP molecular marker associated with the resistance of spotted bass to Nocardia amberjack. Discovering functional SNP markers for early screening of disease-resistant spotted bass individuals and constructing an efficient molecular detection system has significant scientific and practical value for the precise breeding of disease-resistant spotted bass and the promotion of green and healthy aquaculture models. The SNP molecular marker described in this invention is highly correlated with the Nocardia amberjack infection trait in spotted bass. This invention clarifies the significant association between different genotypes (AA, GA, GG) and the disease resistance phenotype. The SNP molecular marker described in this invention can be used for early screening and molecularly assisted selection of Nocardia amberjack-resistant spotted bass individuals (including Nocardia amberjack-resistant spotted bass parents), which can significantly improve breeding efficiency and rapidly obtain spotted bass germplasm with excellent disease resistance traits.
[0018] This invention also provides a method for screening spotted bass resistant to Nocardia amberjack, enabling early, high-throughput typing screening of disease resistance traits in spotted bass. It can be widely applied in molecular-assisted selection (MAS) of disease-resistant spotted bass individuals (including parents), significantly improving breeding efficiency, saving costs, and shortening the breeding cycle. It provides a reliable molecular tool and theoretical basis for molecular breeding of disease-resistant spotted bass, and has important scientific research value and broad industrial application prospects. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 The spotted perch provided by the present invention tgfbr2 -Statistical chart of survival time of different genotypes at the A760G SNP locus. Detailed Implementation
[0021] tgfbr2 The fourth exon region of a gene can be named tgfbr2 -A760G, the SNP molecular marker is closely associated with the anti-Nocardia amberjack trait in spotted sea bass, SNP molecular marker tgfbr2 The dominant allele at the -A760G site is an A base. When the SNP marker at this site is AA, the individual is a target-selected individual for disease resistance. This invention does not specifically limit the source of *Nocardia amberjack*. The *Nocardia amberjack* strain used in this invention has been disclosed in an article entitled "Unveiling the molecular regulatory mechanisms of immune responses in the spleen of spotted sea bass" (…). Lateolabrax maculatus against Nocardia seriolae infection.
[0022] This invention also provides the application of reagents for detecting the molecular markers described in the above-mentioned technical solutions in screening or breeding spotted bass resistant to Nocardia amberjack or identifying the resistance of spotted bass to Nocardia amberjack. Using the reagents for detecting the molecular markers described in the above-mentioned technical solutions, it is possible to screen spotted bass individuals resistant to Nocardia amberjack and to screen spotted bass parents resistant to Nocardia amberjack, and to identify the resistance of spotted bass to Nocardia amberjack. This invention can efficiently achieve molecular-assisted breeding of spotted bass; spotted bass with the AA genotype at the SNP molecular marker site have the ability to resist Nocardia amberjack. In a specific embodiment, the reagent includes primer pairs for detecting the molecular markers described in the above-mentioned technical solutions.
[0023] This invention also provides the application of reagents for detecting the molecular markers described in the above-described technical solutions in the screening or breeding of disease-resistant spotted bass, where the disease is caused by Nocardia auricularia. In a specific embodiment, the disease caused by Nocardia auricularia includes visceral white spot disease. Using reagents for detecting the molecular markers described in the above-described technical solutions, the breeding of disease-resistant spotted bass and the screening of disease-resistant spotted bass parents can be achieved. In a specific embodiment, the reagent includes primer pairs for detecting the molecular markers described in the above-described technical solutions.
[0024] This invention also provides a reagent for detecting the SNP molecular markers described in the above-described technical solutions. The reagent comprises a primer pair for detecting the SNP molecular markers described in the above-described technical solutions. In a specific embodiment, the primer pair comprises primer F and primer R; the nucleotide sequence of primer F is shown in SEQ ID NO.3: AAGCGGCTCCTCAGTCAG, and the nucleotide sequence of primer R is shown in SEQ ID NO.4: GGTGGTAGGCTGTAATCAGCC. The gene fragment amplified using the primer pair described in this invention has the sequence shown in SEQ ID NO.2: AAGCAGGGCTCCTCAGTCAGCGAGGAGCAGGGCTTTGAGACAGTGGCCATCAAGATTTTCCAGTACGAGGAGTACGCTTCCTGGAAGAATGAGAAGGACATTTTCTCAGACGCAGACTTGAGACATGATAATGTGCTTCACTTCCTGACAGCAGAGGAAAGGAAGGTGCAGAGACAGTACTGGCTGATTACAGCCTACCACC, with the SNP molecular marker site located at position 49 bp of the sequence shown in SEQ ID NO.2.
[0025] This invention also provides a molecular diagnostic product for detecting the SNP markers described in the above-described technical solutions, comprising the reagents and PCR amplification reagents described in the above-described technical solutions. In a specific embodiment, the molecular diagnostic product further comprises DNA extraction reagents. In a specific embodiment, the molecular diagnostic product comprises a kit. The molecular diagnostic product of this invention comprises the reagents described in the above-described technical solutions and has the same application as the reagents for detecting the SNP molecular markers described in the above-described technical solutions.
[0026] This invention also provides a method for screening spotted bass individuals or parent spotted bass resistant to Nocardia amberjack based on the SNP molecular markers described in the above technical solution, comprising the following steps:
[0027] Using the sea bass genome as a template, the sea bass genome was amplified by PCR and sequenced using the reagents or molecular detection products described in the above technical solution. When the SNP molecular marker was AA genotype, sea bass resistant to Nocardia amurensis were screened.
[0028] This invention does not specifically limit the method for preparing the spotted bass genome; extraction can be performed using a conventional genome extraction kit known to those skilled in the art. The spotted bass genome of this invention is extracted from the fin rays of the spotted bass. In a specific embodiment, each 10 μL PCR amplification system includes 0.4 μL of primer pair for detecting the SNP molecular markers described in the above technical solution, 1 μL of template, 5 μL of 2×Taq PCR Master, and the remainder water; the PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min. In a specific embodiment, the method of this invention screens spotted bass with the AA genotype at the SNP molecular marker sites, which have stronger disease resistance potential compared to other genotypes.
[0029] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides a method and application for screening Nocardia amberjack-resistant sea bass and using SNP molecular markers associated with this invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0030] Example 1
[0031] Screening of SNP markers related to anti-Nocardia purpureus trait in spotted sea bass
[0032] All spotted sea bass used in the experiment were obtained from Yantai Jinghai Marine Fisheries Co., Ltd. Prior to the experiment, the fish were temporarily held for two weeks at a water temperature of 26℃±1℃. Healthy, undamaged individuals were selected for Nocardia amberjack challenge experiments. Each fish was intraperitoneally injected with 200 μL of a solution at a concentration of 6×10⁻⁶. 7 The Nocardia amberjack culture was administered at a concentration of CFU / mL for 168 hours. The survival time of each fish was recorded in hours; for fish still alive after 168 hours, their survival time was consistently recorded as 168 hours. Fin tissue was harvested from each individual fish and preserved in anhydrous ethanol for genomic DNA extraction. The specific steps are as follows:
[0033] (1) Take about 30 mg of fin tissue from the individual sea bass to be tested, cut it into pieces and place it in a 1.5 mL centrifuge tube, add 200 μL of GA buffer, and vortex for 15 s.
[0034] (2) Add 4 μL RNase A (100 mg / mL) and let stand at room temperature for 5 min.
[0035] (3) Add 20 μL Proteinase K (20 mg / mL), mix well, and then lyse the tissue thoroughly in a 56°C water bath.
[0036] (4) Add 200 μL of GB buffer and incubate at 70°C for 10 min.
[0037] (5) Transfer the above solution together with the precipitate to the DNA adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.
[0038] (6) Add 500 μL of GD buffer to wash, and repeat the centrifugation steps.
[0039] (7) Add 600 μL of PW buffer premixed with anhydrous ethanol, wash twice and centrifuge.
[0040] (8) Allow the adsorption column to stand at room temperature to fully remove residual liquid.
[0041] (9) Add 50 μL ddH2O to the center of the adsorption membrane, let stand at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, and collect the DNA solution for later use.
[0042] DNA samples were then used for library construction according to standard procedures. Qualified libraries were resequencing using the Illumina Nova 6000 platform. The obtained raw sequencing data underwent quality control and processing. All sequencing reads were then aligned to the sea bass genome using BWA software, and genotyping was performed using the standard GATK software procedure to obtain SNP loci. A total of 2,126,619 high-quality SNP loci were obtained after filtering.
[0043] Genome-wide association studies (GWAS) analysis of the Nocardia amberjack resistance trait in spotted bass was performed using a mixed linear model (MLM) in GEMMA software. Subsequently, based on Bonferroni correction, the threshold for significant SNP markers was set to P-value = 0.05 / 2,126,619 = 2.35e-8. Association analysis identified SNP locus 16,492,958 on chromosome 17 of spotted bass as significantly associated with the Nocardia amberjack resistance trait. This locus is annotated as located in the spotted bass... tgfbr2 The SNP is located in the fourth exon of the gene. To verify the association between this SNP site and the phenotypic trait of *Nocardia amberjack* in sea bass, statistical analysis was performed on population survival time and genotype. The results are as follows: Figure 1 As shown, tgfbr2 The SNP site (A / G) at 760 bp of the gene showed significant differences among different disease-resistant phenotype populations, with individuals of the AA genotype having a significantly longer survival time than those of individuals of the GA and GG genotypes.
[0044] Example 2
[0045] Primer design for detecting SNP sites associated with anti-Nocardia purpureus trait in spotted sea bass.
[0046] Based on the spotted sea bass located in Embodiment 1 of the present invention tgfbr2 Primers (SEQ ID NO. 3 and SEQ ID NO. 4) were developed based on the -A760GSNP site for marker-assisted selection breeding of disease-resistant spotted bass, aiming to obtain a spotted bass resistant to Nocardia amberjack. The nucleotide sequences of the primer pairs are as follows:
[0047] Upstream primer F: 5'-AAGCAGGGCTCCTCAGTCAG-3' (SEQ ID NO. 3);
[0048] Downstream primer R: 5'-GGTGGTAGGCTGTAATCAGCC-3' (SEQ ID NO.4).
[0049] Example 3
[0050] Application of SNP loci associated with Nocardia purpureus resistance in spotted bass in spotted bass breeding
[0051] (I) Artificial challenge experiment of spotted bass
[0052] The validation populations were all from the Rizhao Improved Breed Demonstration Base of the National Fisheries Technology Extension Center. The temporary holding and artificial challenge methods were the same as described in Example 1. Based on survival time, the 100 fish with the shortest survival time were selected as the susceptible group, and the 100 fish with the longest survival time were selected as the resistant group. Fin tissue was harvested from each individual fish and preserved in anhydrous ethanol. DNA extraction was performed using the same method as described in Example 1.
[0053] (II) PCR amplification
[0054] The PCR reaction system consisted of 0.2 μL each of upstream and downstream primers, 1 μL of DNA template, 5 μL of 2×Taq PCR Master Mix (Vazyme, China), and ddH2O to a final volume of 10 μL.
[0055] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 30 s, 32 cycles; 72℃ extension for 5 min.
[0056] (III) Genotyping of Spotted Bass
[0057] The PCR amplification product obtained in sequencing step (one) (nucleotide sequence as shown in SEQ ID NO.2) was purified and then subjected to Sanger sequencing. Based on the sequencing peak diagram, the base composition of the target site was analyzed: a single peak at 760 bp indicates A, which is the AA genotype; two peaks indicate G / A, which is the GA genotype; and a single peak indicates GG, which is the GG genotype. This was to verify the results described in Example 1 of this invention. tgfbr2The correlation between the -A760GSNP locus and the resistance of spotted sea bass to Nocardia amberjack was analyzed. The genotype frequencies at this locus were counted in the resistant and susceptible groups, and the results are listed in Table 1.
[0058] Table 1 Spotted Bass tgfbr2 Genotype frequency comparison of -A760GSNP locus
[0059]
[0060] As shown in Table 1, the frequency of the AA genotype was 100% in the resistant group, significantly higher than that in the susceptible group (53%), while the frequency of the GG genotype was 9% in the susceptible group and not observed in the resistant group; the frequency of the GA genotype was 39% in the susceptible group, significantly higher than that in the resistant group. This indicates that this SNP locus is highly associated with the disease resistance trait of spotted bass. Therefore, the present invention discloses... tgfbr2 The -A760G SNP marker (SEQ ID NO. 1, 760bp) can serve as an effective molecular tool for assisting in the breeding of disease-resistant varieties of spotted bass. Genotype can be accurately determined through PCR amplification and sequencing. When an individual is homozygous for AA at this locus, it can be identified as a disease-resistant individual and is suitable as a parent for disease-resistant breeding; while individuals with genotypes of GA or GG are individuals with lower disease resistance and are not recommended for breeding.
[0061] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of a reagent for detecting SNP molecular markers in screening or breeding spotted bass resistant to Nocardia amberjack or in identifying the resistance of spotted bass to Nocardia amberjack, wherein the polymorphism of the SNP molecular marker is that the 760th base of the sequence shown in SEQ ID NO.1 is A or G; when the SNP molecular marker is AA genotype, the spotted bass is identified as resistant to Nocardia amberjack. Lateolabrax maculatus .
2. Application of reagents for detecting SNP molecular markers in screening or breeding disease-resistant spotted bass, where the disease is caused by Nocardia amberjack, and the SNP molecular marker polymorphism is that the 760th base of the sequence shown in SEQ ID NO.1 is A or G; when the SNP molecular marker is AA genotype, the spotted bass is identified as resistant to Nocardia amberjack. Lateolabrax maculatus .
3. A method for screening spotted bass resistant to Nocardia amberjack based on SNP molecular markers Lateolabrax maculatus The method includes the following steps: Spotted sea bass Lateolabrax maculatus Using the genome as a template, reagents for detecting SNP molecular markers were used to target spotted bass. Lateolabrax maculatus The genome was amplified by PCR and sequenced. When the SNP molecular marker was identified as the AA genotype, spotted bass resistant to Nocardia amberjack were selected. Lateolabrax maculatus The polymorphism of the SNP molecular marker is that the 760th base of the sequence shown in SEQ ID NO.1 is A or G.