Methods and kits for high sensitivity and multiplex detection of bladder cancer specific point mutations

Abstract

The application discloses a method and a kit for realizing high-sensitivity and multiplex detection of bladder cancer specific point mutation, and the kit comprises sequences of SEQ ID NO.1-SEQ ID NO.9; wherein: the primer of SEQ ID NO.1, the mutant primer of SEQ ID NO.2 and the wild type probe of SEQ ID NO.3 are used for high-sensitivity detection of FGFR3 S249C mutation; the primer of SEQ ID NO.4, the mutant primer of SEQ ID NO.5 and the wild type probe of SEQ ID NO.6 are used for high-sensitivity detection of PIK3CA E545K mutation; the primer of SEQ ID NO.7, the primer of SEQ ID NO.8 and the probe of SEQ ID NO.9 are used for detection of a target ACTB reference gene. The application realizes selective and efficient amplification of a mutant template through a wild type fluorescent probe and a mutant primer. The method has a detection capacity of 3 / 10,000 for a low-abundance mutation.

Description

Technical Field

[0001] This invention relates to a method and kit for detecting gene mutations. Background Technology

[0002] The molecular heterogeneity of bladder cancer leads to the presence of various specific gene mutations, which play crucial roles in tumorigenesis, development, and treatment. Fusions, point mutations, or amplifications of the FGFR3 gene occur in 60-70% of non-muscle-invasive bladder cancer (NMIBC), compared to approximately 10-20% in muscle-invasive bladder cancer (MIBC). About 20-30% of bladder cancers exhibit PIK3CA mutations, resulting in abnormalities in the PI3K / AKT / mTOR signaling pathway. Detection of these mutations is of significant importance for guiding targeted therapy and monitoring recurrence.

[0003] PCR technology, due to its stability, simplicity, and powerful functionality, has become a widely used molecular biology technique for detecting mutations. Various PCR-based point mutation detection methods, such as ARMS, ASB-PCR, HCA, BDA, and COLD-PCR, have been developed. ARMS technology achieves mutation-specific amplification by utilizing the specific binding of the 3' base of the primer to the mutation template; however, a certain probability of base mismatches leads to significant non-specific amplification, resulting in limited mutation detection sensitivity. Some studies have reported increasing the resolution of mutation detection by introducing blockers to suppress specific amplification. However, this method increases reagent costs, the probability of DNA strand cross-reactivity, and the increased amplicon length is detrimental to the detection of fragmented DNA. Summary of the Invention

[0004] The purpose of this invention is to provide a highly sensitive and low-cost method and kit for the detection of bladder cancer-specific point mutations based on quantitative real-time PCR.

[0005] The technical solution of this invention is:

[0006] A highly sensitive and multiplex detection method for bladder cancer-specific point mutations, characterized by using a kit consisting of the following sequences:

[0007] (1) Primer SEQ ID NO.1 CACCGCCGTCTGGTTG;

[0008] (2) Mutant primer SEQ ID NO.2 GGACGTGCTGGAGCGCTG;

[0009] (3) Wild-type probe SEQ ID NO.3 FAM-CCCCGCACCGGCCCATCCT-BHQ1;

[0010] (4) Primer SEQ ID NO.4 AAGGGAAAATGACAAAGAAC;

[0011] (5) Mutant primer SEQ ID NO.5 GAAAATCTTTCTCCTGCTT;

[0012] (6) Wild-type probe SEQ ID NO.6 ROX-CAGTGATTTCAGAGAGAGGATCTCG-BHQ2;

[0013] (7) Primer SEQ ID NO.7 AGGCATCCTCACCCTGAAG;

[0014] (8) Primer SEQ ID NO.8 CATTGTAGAAGGTGTGGTGCC;

[0015] (9) Probe SEQ ID NO.9 HEX-GCATCGTCACCAACTGGGACG-BHQ1;

[0016] Among them, primer SEQ ID NO.1, mutant primer SEQ ID NO.2, and wild-type probe SEQ ID NO.3 are used for highly sensitive detection of the FGFR3 S249C mutation;

[0017] Primer SEQ ID NO.4, mutant primer SEQ ID NO.5, and wild-type probe SEQ ID NO.6 are used for highly sensitive detection of the PIK3CA E545K mutation;

[0018] Primers SEQ ID NO.7, primers SEQ ID NO.8, and probe SEQ ID NO.9 are used for the detection of the ACTB reference gene.

[0019] A specialized kit for highly sensitive and multiplex detection of bladder cancer-specific point mutations, characterized by comprising the following sequences:

[0020] (1) Primer SEQ ID NO.1 CACCGCCGTCTGGTTG;

[0021] (2) Mutant primer SEQ ID NO.2 GGACGTGCTGGAGCGCTG;

[0022] (3) Wild-type probe SEQ ID NO.3 FAM-CCCCGCACCGGCCCATCCT-BHQ1;

[0023] (4) Primer SEQ ID NO.4 AAGGGAAAATGACAAAGAAC;

[0024] (5) Mutant primer SEQ ID NO.5 GAAAATCTTTCTCCTGCTT;

[0025] (6) Wild-type probe SEQ ID NO.6 ROX-CAGTGATTTCAGAGAGAGGATCTCG-BHQ2;

[0026] (7) Primer SEQ ID NO.7 AGGCATCCTCACCCTGAAG;

[0027] (8) Primer SEQ ID NO.8 CATTGTAGAAGGTGTGGTGCC;

[0028] (9) Probe SEQ ID NO.9 HEX-GCATCGTCACCAACTGGGACG-BHQ1.

[0029] The wild-type fluorescent probe is modified with fluorophores or quenchers at both ends, with a length of 15-40 bases. During the amplification reaction, the wild-type fluorescent probe is hydrolyzed, and the fluorophores or quenchers dissociate, thereby releasing a fluorescent signal.

[0030] Through the above technical solutions, this invention achieves the capability of multiplex detection of low-abundance mutations, and has the following advantages:

[0031] 1. This method achieves selective and efficient amplification of mutant templates using wild-type fluorescent probes and mutant primers. It has the capability to detect low-abundance mutations as low as 0.03%.

[0032] 3. No special reaction reagents or additional oligonucleotide chains are required, resulting in low cost and short amplicon length; no special reaction procedures or instruments are required, making operation simple. Attached Figure Description

[0033] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0034] Figure 1 This is a graph showing the effect of detecting the FGFR3 S249C mutation in Example 1;

[0035] Figure 2 This is a graph showing the effect of detecting the PIK3CA E545K mutation in Example 2;

[0036] Figure 3 This is a schematic diagram of the triple reaction system targeting the FGFR3 S249C mutation, the PIK3CA E545K mutation, and the internal control in Example 3.

[0037] Figure 4 Example 3 shows a triple reaction system targeting FGFR3 S249C mutation, PIK3CA E545K mutation, and internal reference gene, amplifying fluorescence curves at different mutation frequencies. Detailed Implementation Example 1

[0038] A highly sensitive method for detecting bladder cancer-specific point mutations, the steps for detecting FGFR3 S249C (C>G) mutations are as follows:

[0039] (1) The primer set for the S249C mutation of the FGFR3 gene (abbreviated as FGFR3 S249C) is designed based on the wild-type gene template and the mutant gene template. The nucleotide sequences of the upstream primer, the downstream primer, and the wild-type fluorescent probe are shown in SEQ ID NO.1-SEQ ID NO.3, respectively. The nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.3 are as follows from the 5' end to the 3' end:

[0040] SEQ ID NO.1: CACCGCCGTCTGGTTG;

[0041] SEQ ID NO.2: GGACGTGCTGGAGCGCTG;

[0042] SEQ ID NO.3: FAM-CCCCGCACCGGCCCATCCT-BHQ1;

[0043] (2) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.2 μM upstream primer, 0.15 μM mutant primer, 0.15 μM wild-type fluorescent probe, and 10 μL template. Each sample was packaged in a separate tube with a reaction volume of 30 μL. In this embodiment, the mutant template was synthetic plasmid DNA, the wild-type template was genomic DNA from the 293T cell line, and simulated samples with different mutation frequencies were prepared in proportion.

[0044] (3) The mutation detection system in step (2) was subjected to PCR amplification. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; 50 cycles. PCR amplification and signal acquisition were performed using the SLAN-96S system. The results are as follows: Figure 1 As shown. From Figure 1 It can be seen that this method can achieve highly sensitive detection of the FGFR3 S249C mutation (0.01% VAF). It also enables the detection of mutant DNA at an abundance of 0.01%. Example 2

[0045] A highly sensitive method for detecting PIK3CA E545K (G>A) mutations specific to bladder cancer is described below:

[0046] (1) The primer set for the E545K (G>A) mutation of the PIK3CA E545K gene (abbreviated as PIK3CA E545K) is designed based on the wild-type gene template and the mutant gene template. The nucleotide sequences of the upstream primer, the downstream primer, and the wild-type fluorescent probe are shown in SEQ ID NO.1-SEQ ID NO.3, respectively; the nucleotide sequences shown in SEQ ID NO.4-SEQ ID NO.6 are as follows from the 5' end to the 3' end:

[0047] SEQ ID NO.4: AAGGGAAAATGACAAAGAAC;

[0048] SEQ ID NO.5:GAAAATCTTTCTCCTGCTT;

[0049] SEQ ID NO.6: ROX-CAGTGATTTCAGAGAGAGGATCTCG-BHQ2;

[0050] (2) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.03 U / μL hot-start polymerase, 0.25 μM upstream primer, 0.2 μM mutant primer, 0.06 μM wild-type fluorescent probe, and 10 μL template. Each sample was packaged in a separate tube with a reaction volume of 30 μL. In this embodiment, the mutant template was synthetic plasmid DNA, and the wild-type template was genomic DNA from the 293T cell line. Simulated samples with different mutation frequencies were prepared in proportion.

[0051] (3) The mutation detection system in step (2) was subjected to PCR amplification. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; 50 cycles. PCR amplification and signal acquisition were performed using the SLAN-96S system. The results are as follows: Figure 2 As shown. From Figure 2 It can be seen that this method can achieve highly sensitive detection of the PIK3CA E545K mutation (0.03% VAF). It enables mutation identification at an abundance of 0.03%. Example 3

[0052] A highly sensitive and multiplexed method for detecting bladder cancer-specific point mutations employs a triple-reaction kit to simultaneously detect the internal control target (ACTB), as well as FGFR3 S249C and PIK3CA E545K mutations. The steps are as follows:

[0053] (1) Targeting the FGFR3 S249C mutation point, the nucleotide sequences of the upstream primer, the downstream primer, and the wild-type fluorescent probe designed based on the wild-type gene template and the mutant gene template are shown in SEQ ID NO. 1-3, respectively; targeting the PIK3CA E545K mutation point, the nucleotide sequences of the upstream primer, the downstream primer, and the wild-type fluorescent probe designed based on the wild-type gene template and the mutant gene template are shown in SEQ ID NO. 4-6, respectively; targeting ACTB (reference gene), the nucleotide sequences of the upstream primer, the downstream primer, and the fluorescent probe designed based on the template are shown in SEQ ID NO. 7-9, respectively. The nucleotide sequences shown in SEQ ID NO. 7-9 from the 5' end to the 3' end are as follows:

[0054] SEQ ID NO.7: AGGCATCCTCACCCTGAAG;

[0055] SEQ ID NO.8: CATTGTAGAAGGTGTGGTGCC;

[0056] SEQ ID NO.9: HEX-GCATCGTCACCAACTGGGACG-BHQ1;

[0057] (2) The reaction volume was 30 μL, containing 2.5 mM MgCl2, 0.2 mM dNTPs, 0.04 U / μL hot-start polymerase, 0.25 μM upstream primer targeting the FGFR3 S249C mutation, 0.15 μM mutant primer, and 0.15 μM wild-type fluorescent probe. For the PIK3CA E545K mutation site, the upstream primer was 0.25 μM, mutant primer was 0.2 μM, and wild-type fluorescent probe was 0.1 μM. For ACTB (reference gene), the upstream primer was 0.1 μM, the downstream primer was 0.1 μM, and fluorescent probe was 0.04 μM. In this embodiment, the mutant template was synthesized mutant plasmid DNA, and the wild-type template was genomic DNA from the 293T cell line. Simulated samples with different mutation frequencies were prepared according to the specified ratio. 10 μL of template was used, and the reaction volume for each tube was 30 μL.

[0058] (3) The mutation detection system in step (2) was subjected to PCR amplification. The specific procedure was as follows: enzyme activation at 95℃ for 3 min; denaturation at 95℃ for 10 s; annealing and extension at 58℃ for 20 s; 55 cycles. PCR amplification and signal acquisition were performed using the SLAN-96S system. The FGFR3 S249C mutation, PIK3CA E545K mutation, and ACTB target signals were acquired in the FAM, ROX, and HEX fluorescence channels, respectively. The results are as follows: Figure 3 As shown in Figure 4. From Figure 3 As can be seen from the fourth point, in multiple reactions, this method can achieve highly sensitive detection of FGFR3S249C and PIK3CA E545K mutations (0.03% VAF).

[0059] In the above embodiments, the wild-type fluorescent probe is modified with fluorescent groups or quenching groups at both ends, with a length of 15-40 bases. During the amplification reaction, the wild-type fluorescent probe is hydrolyzed, and the fluorescent groups or quenching groups dissociate, thereby releasing a fluorescent signal.

Claims

1. A specialized kit for highly sensitive and multiplex detection of bladder cancer-specific point mutations, characterized by: It consists of the following sequences: (1) Primer SEQ ID NO.1 CACCGCCGTCTGGTTG; (2) Mutant primer SEQ ID NO.2 GGACGTGCTGGAGCGCTG; (3) Wild-type probe SEQ ID NO.3 FAM-CCCCGCACCGGCCCATCCT-BHQ1; (4) Primer SEQ ID NO.4 AAGGGAAAATGACAAAGAAC; (5) Mutant primer SEQ ID NO.5 GAAAATCTTTCTCCTGCTT; (6) Wild-type probe SEQ ID NO.6 ROX-CAGTGATTTCAGAGAGAGGATCTCG-BHQ2; (7) Primer SEQ ID NO.7 AGGCATCCTCACCCTGAAG; (8) Primer SEQ ID NO.8 CATTGTAGAAGGTGTGGTGCC; (9) Probe SEQ ID NO.9 HEX-GCATCGTCACCAACTGGGACG-BHQ1; Among them, primer SEQ ID NO.1, mutant primer SEQ ID NO.2, and wild-type probe SEQ ID NO.3 are used for highly sensitive detection of the FGFR3 S249C mutation; Primer SEQ ID NO.4, mutant primer SEQ ID NO.5, and wild-type probe SEQ ID NO.6 are used for highly sensitive detection of the PIK3CAE545K mutation; Primers SEQ ID NO.7, primers SEQ ID NO.8, and probe SEQ ID NO.9 are used for the detection of the ACTB reference gene.

Images