A genetic transformation method of ammodendron nonvregianum

Abstract

This invention provides a genetic transformation method for *Ilex chinensis* from Xinjiang, belonging to the field of plant biotechnology. The method involves obtaining young hydroponic seedlings from *Ilex chinensis* seeds through a process of protecting the hypocotyl and lower part of the seedlings from light. After removing all roots from these seedlings, the remaining hypocotyl and cotyledon regions are transformed using *Agrobacterium* containing the gene to be introduced. The resulting expression plants are then induced to develop roots, thus completing the genetic transformation of *Ilex chinensis*. This method not only possesses efficient and intuitive localization capabilities but also provides important technical support for elucidating the function of key proteins in the unique stress tolerance mechanism of *Ilex chinensis*, especially applicable to functional genes that are difficult to accurately simulate or lack observable phenotypes in model plants.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, and in particular relates to a genetic transformation method for Xinjiang sand holly. Background Technology

[0002] *Ammopiptanthus nanus* (M. Pop.) Cheng f., commonly known as Xinjiang sand holly, is an evergreen shrub belonging to the genus *Ammopiptanthus* in the legume family (Fabaceae). It possesses extremely strong resistance to cold, drought, and wind erosion, surviving temperatures as low as -30°C in winter and as high as 40°C in summer. It prefers gravelly or sandy-gravelly soils with a thin layer of sand cover. It has a well-developed root system with root nodules, which help to stabilize sand and improve soil quality. *Ammopiptanthus nanus* has the following applications:

[0003] Ecological value: Xinjiang sand holly is an excellent windbreak and sand-fixing plant. It can effectively reduce wind speed and reduce the erosion of soil by wind and sand. Its developed root system can fix the soil and prevent water and soil loss, playing an important role in maintaining the stability of desert ecosystems.

[0004] Ornamental value: The tree has a beautiful shape, dense branches and leaves, bluish-green leaves, and golden-yellow flowers, which are very bright. The fruit is bean-shaped and remains green until it splits open when ripe. It has high ornamental value and can be used as an important tree species resource for greening urban areas, gardens, mining areas and courtyards.

[0005] Medicinal value: Its stems and leaves can be used as medicine, and have the effects of relaxing muscles and promoting blood circulation, dispelling wind and dampness. It has a certain curative effect on treating diseases such as abdominal pain and cough.

[0006] Scientific value: Xinjiang sand holly is a Tertiary relict plant and an important material for studying paleogeology, paleontology, paleoclimatology and the evolution of flora. It has important scientific significance for understanding the occurrence and development of flora in the desert area of ​​southwestern Xinjiang, as well as changes in paleogeography and paleoclimate.

[0007] However, due to a past lack of understanding of the scientific value of *Haloxylon ammodendron*, extensive logging for medicinal purposes led to a shrinking distribution area and declining population, threatening its eventual extinction. In recent years, with the establishment of nature reserves, protection efforts have been strengthened. Simultaneously, relevant research institutions are actively conducting artificial breeding research to expand its population. However, as the only evergreen deciduous shrub in Northwest China and a Tertiary relict plant with extremely strong resilience, *Haloxylon ammodendron* exhibits low transformation efficiency. Furthermore, its thick cell walls, high degree of lignification, and weak ability to absorb exogenous genes during transformation further reduce genetic transformation efficiency, especially when using Agrobacterium-mediated transformation, where the low infection efficiency of Agrobacterium often needs to be overcome. Therefore, a heritage transformation system for *Haloxylon ammodendron* has not yet been established. Summary of the Invention

[0008] To address the above problems, this invention provides a genetic transformation method for Xinjiang sand holly.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] A genetic transformation method for Xinjiang sand holly, wherein the genetic transformation method involves taking sand holly seedlings germinated from sand holly seeds and hydroponically cultivating them by treating the part below the hypocotyl in the dark. After removing all roots from the young hydroponic seedlings, the remaining hypocotyl and cotyledon regions are transformed by Agrobacterium tumefaciens containing the gene to be transformed. The resulting expression plants are then induced to develop roots, thus completing the genetic transformation of Xinjiang sand holly.

[0011] Furthermore, the Agrobacterium-mediated transformation process containing the gene to be transferred includes:

[0012] The preserved hypocotyl and cotyledon regions were coated with expression colonies containing Agrobacterium tumefaciens, the gene to be transferred, and inserted into the holes and buried in soil.

[0013] The expression bacterial solution containing Agrobacterium tumefaciens, the gene to be transferred, was drawn up with a pipette and drip-irrigated onto the seedlings to obtain expression plants.

[0014] Furthermore, the process for obtaining Agrobacterium containing the gene to be transferred is as follows:

[0015] Using seamless cloning technology, the gene to be transferred was ligated into the pCAMBIA1302 vector, and the resulting ligation product was transformed into E. coli DH5α competent cells to obtain a single-clone extraction plasmid.

[0016] Plasmids were extracted from single clones and transformed into strain K599 to obtain the expression strain;

[0017] One day before inoculation, the expression strain activated in YT liquid medium was spread onto solid TY medium and cultured to obtain expression colonies containing the Agrobacterium to be transformed on solid plates. Freshly cultured plates help improve infection efficiency.

[0018] The expression strain was transferred to liquid TY medium for culture, and the resulting liquid culture expression broth was resuspended in MES buffer and diluted to obtain an expression broth containing the Agrobacterium to be transformed.

[0019] Furthermore, the genetic transformation method includes the following specific steps:

[0020] S1. Preparation of young hydroponic seedlings of *Ilex pubescens*

[0021] Selected seeds of *Ilex sabina* were surface-sterilized and germinated under sterile conditions to produce seedlings.

[0022] When the roots of the *Ilex pubescens* seedlings have grown to about 3 cm in length after 2 days of cultivation, they are transferred to a liquid culture system for hydroponics. During the hydroponic process, the part of the seedlings below the hypocotyl is protected from light. In order to reduce the lignification of the rhizomes, the part of the seedlings below the hypocotyl is placed in a light-proof hydroponic bottle for light protection. This light protection helps to keep the rhizomes tender and reduce their lignification, thereby improving the induction efficiency of hairy roots and obtaining stable and tender hydroponic seedlings.

[0023] S2. Preparation and inoculation of Agrobacterium tumefaciens

[0024] Using seamless cloning technology, the gene to be transferred was ligated into the pCAMBIA1302 vector, and the resulting ligation product was transformed into E. coli DH5α competent cells to obtain a single-clone extraction plasmid.

[0025] Plasmids were extracted from single clones and transformed into strain K599 to obtain the expression strain;

[0026] One day before inoculation, the expression strain activated in YT liquid medium was spread onto solid TY medium and cultured to obtain expression colonies containing the Agrobacterium to be transformed on solid plates; freshly cultured plates help to improve infection efficiency.

[0027] The expression strain was transferred to liquid TY medium for culture, and the resulting liquid culture expression broth was resuspended in MES buffer and diluted to obtain an expression broth containing the Agrobacterium to be transformed into.

[0028] S3. Remove the native roots and prepare for inoculation.

[0029] Carefully cut off all the roots of the tender hydroponic seedlings with sterile scissors, leaving the complete hypocotyl and cotyledon area intact. Apply expression colonies containing Agrobacterium tumefaciens to be transferred onto a solid plate, insert it into the pre-made hole, and cover it with soil.

[0030] The expression bacterial solution containing Agrobacterium tumefaciens containing the gene to be transferred was extracted and drip-irrigated onto the seedlings. At this time, the bacterial solution flowed from the stem into the soil, resulting in inoculated expression plants.

[0031] S4. Callus induction and rooting culture

[0032] The inoculated expression plants were inserted into the culture medium for induction culture;

[0033] After 4-6 weeks of induction culture and inoculation, obvious rooting was observed, resulting in rooted plants. The roots of these rooted plants grew from near the hypocotyl and exhibited a typical hairy root structure, thus completing the genetic transformation of Xinjiang sandy holly.

[0034] Furthermore, the genetic transformation method also includes: positive screening and fluorescence detection of the rooted plants.

[0035] Furthermore, the positive screening and fluorescence detection process for rooted plants is as follows:

[0036] Each rooted plant was initially screened for GFP fluorescence signal;

[0037] When obvious green fluorescence is observed in the root tip, root hair or other parts, it is preliminarily determined that the plant has successfully integrated and expressed the GFP fusion target gene, and the plant is a positive transformation material.

[0038] If no fluorescent signal is observed in the root tip, root hairs or other parts, the rooted plant is considered negative transformation material and should be discarded.

[0039] After initial screening, samples with high fluorescence intensity were selected from the positively transformed materials for further cellular-level observation.

[0040] Furthermore, in step S3, the pre-made cave is dug out of soil made by mixing black soil and vermiculite in a volume ratio of 1:0.95~1.05.

[0041] The soil in the buried soil is made by mixing black soil and vermiculite in a volume ratio of 1:0.95~1.05.

[0042] Furthermore, in step S4, the induction culture conditions are a constant temperature of 26-30°C and 16 hours of light / 8 hours of darkness.

[0043] Furthermore, in step S2, the solid TY culture medium contains tryptone, yeast extract, CaCl2, and agar powder;

[0044] Tryptone, yeast extract, and CaCl2 in liquid TY medium;

[0045] The MES buffer contains MES-KOH, MgCl2 and acetylsuccinone;

[0046] OD of diluted liquid culture expression bacterial suspension 600 It ranges from 0.4 to 0.6.

[0047] Furthermore, in step S1, the liquid culture system is prepared by diluting 500×1 / 2 Hogland macro-elements, 500×1 / 2 Hogland micro-elements, and 500×1 / 2 Hogland pH buffer purchased from Coollab Company in equal proportions, and adjusting the pH to about 5.6 with PBS buffer.

[0048] The beneficial effects of the genetic transformation method for Xinjiang sand holly of the present invention are as follows:

[0049] This invention employs a species-native expression system, resulting in more biologically relevant localization results. The expression of *Ilex shamrock* protein in heterologous systems (such as tobacco and Arabidopsis thaliana) may be affected by differences in cellular environment, post-translational modifications, and protein folding pathways. However, using *Ilex shamrock*'s own tissue as an expression platform can more accurately reflect the subcellular distribution of its protein under natural physiological conditions, thereby improving the reliability and explanatory power of subcellular localization.

[0050] The present invention has high root transformation efficiency (70% of the tested roots showed green fluorescence, proving successful transformation) and clear tissue structure, which is suitable for fluorescence observation. The root tissue cells of the present invention are arranged regularly, which is especially suitable for precise subcellular positioning by high-resolution imaging techniques such as confocal microscopy.

[0051] This invention is applicable to the localization and functional study of proteins unique to *Ilex shamiana*. As a typical stress-tolerant woody plant, *Ilex shamiana* has evolved various unique molecular mechanisms to adapt to extreme environments such as drought, strong light, and salinity, containing a large number of specific proteins related to stress responses, such as functional genes involved in atypical signal transduction, membrane homeostasis maintenance, antioxidant regulation, or cell structure remodeling. Because these genes often lack high homology with known genes in model plants, their functions cannot be annotated solely based on sequence inference. Furthermore, due to the species-specific nature of the stress phenotype in *Ilex shamiana*, the functions of many genes are difficult to directly verify or reconstruct using heterologous systems such as *Arabidopsis thaliana*. This invention employs a method based on the specific proteins of *Ilex shamiana*. By combining GFP labeling with confocal microscopy, the subcellular localization of target proteins can be directly observed against a natural background through the dermal root system. Protein localization information is of great significance for inferring their functions, including: nuclear localization tendency suggests that it may be involved in transcriptional regulation; membrane system localization may be related to ion transport, hormone sensing, or signal transduction; and organelle (such as chloroplasts, mitochondria, and peroxisomes) localization may be involved in functions such as energy metabolism or redox balance. This invention, by performing in situ localization analysis in *Ilex spp.*, can preserve its natural regulatory environment to the greatest extent, improve the accuracy of functional prediction, and provide a basis for subsequent functional studies such as target validation and interaction protein screening.

[0052] Therefore, the method of the present invention not only has efficient and intuitive localization capabilities, but also provides important technical support for elucidating the function of key proteins in the unique stress resistance mechanism of *Ilex shamiana*, and is especially suitable for functional genes that are difficult to accurately simulate or lack observable phenotypes in model plants. Attached Figure Description

[0053] Figure 1This is the construction process of the *Ilex spp.* transformation system in Example 1 of this invention; wherein, Figure A shows *Ilex spp.* hydroponic seedlings that have grown for 2 weeks; Figure B shows *Ilex spp.* seedlings that have been rooted and are ready to be inoculated with *Agrobacterium rhizogenes*; Figure C shows *Ilex spp.* seedlings that have been inoculated and then cultured in soil; Figure D shows rooted plants of *Ilex spp.*, the two seedlings on the right in Figure D represent the roots that have grown from *Ilex spp.* one month after inoculation (some roots are broken due to being dug out of the soil), and the roots on the left are those of normally cultured seedlings; Figure E shows the results of GFP expression detection using a confocal microscope under 488 laser and bright field channel, the left image in Figure E represents the image under the GFP fluorescence channel, the middle image represents the image under the bright field channel, and the right image represents the image of the two channels overlapping; the scale bar in Figures A to D represents 2 cm, and the scale bar in Figure E represents 50 μm;

[0054] Figure 2 It is the GFP expression vector in Example 1 of this invention;

[0055] Figure 3 It is the monoclonal extraction plasmid pCAMBIA1302-WRKY40 in Example 2 of this invention;

[0056] Figure 4 The results are GFP fluorescence signals of WRKY40-expressing rooted plants in Example 2 of this invention; where BL represents the bright field result; GFP represents the result of the GFP signaling pathway; Merged represents the result of the overlap between GFP and the bright field; the scale bar in the figure is 50 μm. Detailed Implementation

[0057] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.

[0058] Example 1: A genetic transformation method for Xinjiang sand holly

[0059] The genetic transformation method of Ammopiptanthus mongolicus of this invention utilizes root transformation technology mediated by Agrobacterium rhizogenes, successfully achieving transgenic expression in the roots of Ammopiptanthus mongolicus. This system is suitable for subcellular localization, functional verification, and downstream molecular mechanism research of target proteins (such as transcription factors). The specific steps of the genetic transformation method of this invention are as follows:

[0060] S1. Preparation of young hydroponic seedlings of *Ilex pubescens*

[0061] Selected seeds of *Ilex sabina* were surface-sterilized and then germinated under sterile conditions to produce seedlings.

[0062] After the roots of the *Clerodendrum sylvestris* seedlings have grown to about 3 cm in length after 2 days of cultivation, they are transferred to a hydroponic bottle containing a liquid culture system (the liquid culture system is prepared by diluting 500×1 / 2 Hogland macronutrients, 500×1 / 2 Hogland micronutrients, and 500×1 / 2 Hogland pH buffer purchased from Coollab Company in equal proportions, and adjusting the pH to about 5.6 with PBS buffer). The hydroponics is carried out at room temperature, and the part of the seedling below the hypocotyl is protected from light during the hydroponic process.

[0063] To reduce rhizome lignification, this invention involves placing the portion of the seedling below the hypocotyl in a light-protected hydroponic bottle. This light-protection treatment helps maintain the tenderness of the rhizome, reducing its lignification and thus improving the efficiency of hairy root induction.

[0064] After two weeks of hydroponic cultivation, healthy and stable hydroponic seedlings were obtained (e.g. Figure 1 (As shown in Figure A). The hydroponic seedlings are developing well and are suitable for subsequent transformation operations.

[0065] This invention obtains seedlings of *Ilex sabina* through hydroponics, placing the portion below the hypocotyl in a light-proof hydroponic bottle during the process. This method ensures that the seedlings receive sufficient water and nutrients during growth, while reducing the lignification of the hypocotyl portion during subsequent transformation, thus laying a good foundation for subsequent tissue culture.

[0066] S2. Preparation and inoculation of Agrobacterium tumefaciens

[0067] The empty Pcambia1302 vector was ligated into the GFP vector to obtain the following: Figure 2 The GFP expression vector shown directly expresses the GFP protein and serves as the experimental group; the empty Pcambia1302 vector is used as the control vector.

[0068] The K599 strain (Weidi Biotechnology) was transformed into the GFP expression vector and the Pcambia1302 empty vector respectively using conventional transformation methods to obtain the corresponding expression strains.

[0069] One day before inoculation, 100 μL of the corresponding expression strain activated in YT liquid medium was spread onto solid TY medium and cultured to obtain colonies on solid plates. Agrobacterium activated one day in advance has strong viability, which is conducive to subsequent infection. At the same time, freshly cultured plate bacteria help improve infection efficiency.

[0070] The solid TY medium contains 5 g / L tryptone, 3 g / L yeast extract, 1.11 g / L CaCl2 (added after sterilization and dispensing), and 15 g / L agar powder, with a pH of 7.0.

[0071] Simultaneously, 100 μL of the corresponding expression strain was transferred to liquid TY medium for culture to obtain liquid culture broth; wherein, the liquid TY medium contained 5 g / L tryptone, 3 g / L yeast extract and 1.11 g / L CaCl2 (added after aliquoting and sterilization), pH=7.0;

[0072] After cultivation, the liquid culture was resuspended in MES buffer (containing 10 mM MES-KOH (pH=5.2), 10 mM MgCl2, and 100 μM acetylsylgenone) and diluted to OD values. 600 Approximately 0.4~0.6 yields the corresponding liquid bacterial solution.

[0073] S3. Remove the native roots and prepare for inoculation.

[0074] Soil made by mixing black soil and vermiculite in a 1:1 volume ratio, and then excavating holes for later use; This invention, by using a specific ratio of vermiculite and black soil mixture, can maintain the air permeability suitable for the growth of Ilex sabina, while also providing specific nutrients suitable for the growth of Ilex sabina.

[0075] Carefully remove all the roots of the young hydroponic seedlings using sterile scissors, leaving only the intact hypocotyl and cotyledonary region (e.g., Figure 1 As shown in Figure B), the colonies on the solid plate were smeared, inserted into pre-made holes, and buried in soil. In this invention, during the transformation process, the roots of young hydroponic seedlings are cut off, thereby stimulating their regeneration. Simultaneously, cutting off the roots of the young hydroponic seedlings provides wounds for infection, facilitating infection and thus improving transformation efficiency. Furthermore, this invention uses young hypocotyls and cotyledonary regions as transformation materials, which have strong vitality and promote later root development, further improving transformation efficiency.

[0076] A total of 5 mL of liquid bacterial solution was drawn up with a pipette and dripped onto the seedlings. The bacterial solution then flowed from the stem into the soil formed by vermiculite and black soil, resulting in the corresponding inoculated plants.

[0077] S4, callus induction (i.e., Agrobacterium-mediated transformation) and rooting culture

[0078] The inoculated plants were inserted into a culture medium containing an appropriate amount of moist nutrient soil (the culture medium containing an appropriate amount of moist nutrient soil is a mixture of PINDSTRUPPI brand black soil and vermiculite in a 1:1 weight ratio), and induced to grow under constant temperature of approximately 28°C and 16 hours of light / 8 hours of darkness. Figure 1(As shown in Figure C).

[0079] After 4-6 weeks of induction culture and inoculation, obvious rooting is observed, resulting in rooted plantlets. The roots of these rooted plantlets emerge from near the hypocotyl and exhibit a typical hairy root structure, such as... Figure 1 As shown in Figure D, the two plants on the right are transformed roots formed one month after inoculation in the experimental group. Their number and growth status are significantly different from the untransformed seedlings in the control group on the left.

[0080] S5. Positive screening and fluorescence detection

[0081] After obtaining germinating plants through Agrobacterium-mediated transformation, each germinating plant in the experimental group was initially screened for GFP fluorescence signals. During this initial screening, a fluorescence stereomicroscope (e.g., Leica M165FC) was used to observe the GFP signal at appropriate wavelengths (excitation wavelength 488 nm, emission wavelength 510–530 nm). If obvious green fluorescence was observed in the root tip, root hairs, or other sites, it was preliminarily determined that the germinating plant had successfully integrated and expressed the GFP fusion target gene. Samples without observed fluorescence signals were considered negative and discarded. Typically, at least 10–20 germinating plants were screened for each construction to ensure the acquisition of positive transformation material.

[0082] After initial screening, samples with high fluorescence intensity were selected from the positively transformed materials for further cellular-level observation. During cellular-level observation, root cells from the positively transformed materials were extracted, prepared, and then finely imaged using a laser confocal microscope (e.g., Nikon A1R) under 488 nm laser and bright field channel conditions to detect GFP expression. Based on the expected localization of the target protein, the root tip meristem, elongation zone, or root hair zone could be selected as the observation area. Under the confocal microscope, GFP signals (e.g., GFP expression) could be clearly observed in the cytoplasm and nucleus. Figure 1 As shown in Figure E), this indicates that GFP was successfully transferred into the roots of *Ilex spp.*

[0083] Example 2: Stability verification of a genetic transformation method for Xinjiang sand holly

[0084] Furthermore, to verify the stability of this system, the present invention used the same method to transform the transcription factor WRKT40 fused with GFP-expressed protein, as follows:

[0085] S1. Preparation of young hydroponic seedlings of *Ilex pubescens*

[0086] Selected seeds of *Ilex sabina* were surface-sterilized and then germinated under sterile conditions to produce seedlings.

[0087] After the roots of the *Clerodendrum thomsoniae* seedlings have grown to about 3 cm in length after 2 days of cultivation, they are transferred to a hydroponic bottle containing a liquid culture system (the liquid culture system is prepared by diluting 500×1 / 2 Hogland macronutrients, 500×1 / 2 Hogland micronutrients, and 500×1 / 2 Hogland pH buffer purchased from Coollab Company in equal proportions, and adjusting the pH to about 5.6 with PBS buffer). The seedlings are then hydroponically cultured at 28℃, and the portion below the hypocotyl is kept out of the light during the hydroponic process.

[0088] To reduce rhizome lignification, this invention involves placing the portion of the seedling below the hypocotyl in a light-protected hydroponic bottle. This light-protection treatment helps maintain the tenderness of the rhizome, reducing its lignification and thus improving the efficiency of hairy root induction.

[0089] After two weeks of hydroponic cultivation, healthy and stable hydroponic seedlings were obtained. The seedlings developed well and were suitable for subsequent conversion operations.

[0090] This invention obtains seedlings of *Ilex sabina* through hydroponics, placing the portion below the hypocotyl in a light-proof hydroponic bottle during the process. This method ensures that the seedlings receive sufficient water and nutrients during growth, while reducing the lignification of the hypocotyl portion during subsequent transformation, thus laying a good foundation for subsequent tissue culture.

[0091] S2. Preparation and inoculation of Agrobacterium tumefaciens

[0092] Using seamless cloning technology, the WRKY40 gene of *Ilex pubescens* (the sequence of the WRKY40 gene is shown in SEQ ID NO: 1) was ligated into the pCAMBIA1302 vector, and the WRKY40 sequence was inserted before GFP to achieve fusion expression of the WRKY40 and GFP fusion protein. The specific operation is as follows: using the cDNA of the *Ilex pubescens* WRKY40 gene as a template, PCR amplification was performed using primer pairs (1302-WRKY40-F: ACGGGGGGACTCTTGACCATGGATGCAATCAACATGTGTGG and 1302-WRKY40-R: AGTTCTTCTCCTTTACTAGTCCATTTTGCCACAGTTGTC) to obtain two PCR amplification fragments.

[0093] The PCR amplification system consisted of: KOD One™ PCR Master Mix: 25 μL; primer 1302-WRKY40-F (10 μM): 1 μL; primer 1302-WRKY40-R (10 μM): 1 μL; Ilex pubescens cDNA: 2 μL; and ddH2O to bring the total to 50 μL.

[0094] The PCR amplification program was as follows: initial denaturation: 94℃, 2 min; cycling reaction (30 cycles); denaturation: 98℃, 10 s; annealing: 57℃, 10–30 s; extension: 68℃, 1.5 min; final extension: 68℃, 10 min; storage: 4℃.

[0095] The pCAMBIA1302 vector was digested with NcoI and SpeI enzymes. The resulting plasmid, along with two PCR amplification fragments, was ligated using the Novizan ClonExpress II One Step Cloning Kit to obtain the ligation product. The ligation product was transformed into *E. coli* DH5α competent cells. Single clones were selected for colony PCR identification and sequencing verification. The plasmid pCAMBIA1302-WRKY40 (e.g., ...) was extracted from the verified single clones. Figure 3 (As shown).

[0096] The plasmid pCAMBIA1302-WRKY40 was extracted from a single clone and transformed into strain K599 (Weidi Biotechnology) using conventional transformation methods to obtain the WRKY40 expression strain.

[0097] One day before inoculation, 100 μL of WRKY40 expression strain activated in YT liquid medium was spread onto solid TY medium and cultured to obtain WRKY40 expression colonies on solid plates. WRKY40 expression strains activated one day in advance have strong viability, which is conducive to subsequent infection. At the same time, freshly cultured WRKY40 expression strains help to improve infection efficiency.

[0098] 100 μL of the WRKY40 expression strain was transferred to liquid TY medium and cultured to obtain a liquid culture WRKY40 expression bacterial suspension.

[0099] After culturing, the WRKY40 expression bacterial culture was resuspended in MES buffer and diluted to OD. 600 Approximately 0.4~0.6 μL yields a liquid WRKY40 expression culture.

[0100] S3. Remove the native roots and prepare for inoculation.

[0101] Soil prepared by mixing black soil and vermiculite in a volume ratio of 1:0.95~1.05 (in this embodiment, the soil is prepared by mixing black soil and vermiculite in a volume ratio of 1:1), and then excavating holes for later use; by using a specific ratio of vermiculite and black soil, this invention can maintain the air permeability suitable for the growth of *Ilex chinensis*, while also providing specific nutrients suitable for the growth of *Ilex chinensis*.

[0102] Carefully remove all roots of the young hydroponic seedlings using sterile scissors, leaving only the intact hypocotyl and cotyledonary region. Apply WRKY40 expression colonies from a solid agar plate, insert the seedlings into pre-prepared holes, and cover with soil. In this invention, by cutting off the roots of the young hydroponic seedlings during the transformation process, regeneration is stimulated. Simultaneously, the removal of the roots provides wounds for infection, facilitating infection and thus improving transformation efficiency. Furthermore, this invention uses the young hypocotyl and cotyledonary region as transformation material, which has strong vitality and promotes subsequent root development, further enhancing transformation efficiency.

[0103] 5 mL of liquid WRKY40 expression bacterial solution was drawn with a pipette and dripped onto the seedlings. The bacterial solution then flowed from the stem into the soil formed by vermiculite and black soil, resulting in inoculated WRKY40 expression plants.

[0104] S4, callus induction (i.e., Agrobacterium-mediated transformation) and rooting culture

[0105] The inoculated WRKY40 expression plants were inserted into a culture medium containing an appropriate amount of moist nutrient soil (the culture medium containing an appropriate amount of moist nutrient soil was obtained by mixing PINDSTRUPPI brand black soil and vermiculite in a weight ratio of 1:1), and induced culture was carried out under a constant temperature of about 26~30°C (the constant temperature in this example was 28°C) and 16h light / 8h dark conditions.

[0106] After 4-6 weeks of induction culture and inoculation, obvious rooting was observed, resulting in WRKY40-expressing rooted plants. The roots of these rooted plants grew from near the hypocotyl and exhibited a typical hairy root structure.

[0107] S5. Positive screening and fluorescence detection

[0108] After obtaining rooted plants through Agrobacterium-mediated transformation, the GFP fluorescence signal of each WRKY40-expressing rooted plant was observed according to the method in Example 1. Figure 4 As shown, high GFP signals were observed in both the nucleus and cytoplasm of *Ilex pubescens* cells, which is consistent with the characteristic of transcription factors functioning in the nucleus. This demonstrates the stability of the system in the *Ilex pubescens* system.

[0109] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A genetic transformation method for *Ilex chinensis* from Xinjiang, characterized in that, The genetic transformation method includes the following specific steps: S1. Preparation of young hydroponic seedlings of *Ilex pubescens* Selected seeds of *Ilex sabina* were surface-sterilized and germinated under sterile conditions to produce seedlings. When the roots of the *Ilex sabina* seedlings reach 3 cm in length, they are transferred to a liquid culture system for hydroponics. During the hydroponic process, the portion of the seedlings below the hypocotyl is kept out of the light to obtain healthy and stable young hydroponic seedlings. The liquid culture system is prepared by diluting 500 × 1 / 2 Hoagland macronutrients, 500 × 1 / 2 Hoagland micronutrients, and 500 × 1 / 2 Hoagland pH buffer in equal proportions, and adjusting the pH to 5.6 with PBS buffer. S2. Preparation and inoculation of Agrobacterium tumefaciens Using seamless cloning technology, the gene to be transferred was ligated into the pCAMBIA1302 vector, and the resulting ligation product was transformed into E. coli DH5α competent cells to obtain a single-clone extraction plasmid. Plasmids were extracted from single clones and transformed into strain K599 to obtain the expression strain; One day before inoculation, the expression strain activated in YT liquid medium was spread onto solid TY medium and cultured to obtain expression colonies containing the Agrobacterium to be transformed on solid plates. The solid TY medium contained 5 g / L tryptone, 3 g / L yeast extract, 1.11 g / L CaCl2 and 15 g / L agar powder, pH=7.0; the liquid TY medium contained 5 g / L tryptone, 3 g / L yeast extract and 1.11 g / L CaCl2, pH=7.

0. The expression strain was transferred to liquid TY medium and cultured. The resulting liquid culture expression broth was resuspended in MES buffer and diluted to OD200. 600 The pH is 0.4~0.6, which yields an expression culture containing Agrobacterium tumefaciens to be transformed into; the MES buffer contains 10 mM MES-KOH, 10 mM MgCl2 and 100 μM acetylsylgenone, pH=5.2; S3. Remove the native roots and prepare for inoculation. Carefully remove all roots of the young hydroponic seedlings with sterile scissors, preserving the complete hypocotyl and cotyledonary region. Apply expression colonies containing the Agrobacterium tumefaciens to be transferred onto a solid plate, insert the seedlings into pre-prepared holes, and cover them with soil. The pre-prepared holes are dug in soil prepared by mixing black soil and vermiculite in a volume ratio of 1:0.95~1.

05. The soil used for covering the seedlings is prepared by mixing black soil and vermiculite in a volume ratio of 1:0.95~1.

05. The expression bacterial solution containing Agrobacterium tumefaciens containing the gene to be transferred was extracted and drip-irrigated onto the seedlings. At this time, the bacterial solution flowed from the stem into the soil, resulting in inoculated expression plants. S4. Callus induction and rooting culture The inoculated expression plants were inserted into the culture medium and induced to grow under constant temperature of 26-30°C and 16h light / 8h dark conditions. After 4-6 weeks of induction culture and inoculation, obvious rooting was observed, and rooted plants were obtained, thus completing the genetic transformation of Xinjiang sand holly.

2. The genetic transformation method for *Ilex chinensis* from Xinjiang according to claim 1, characterized in that, The genetic transformation method also includes: positive screening and fluorescence detection of the rooted plants.

3. The genetic transformation method of *Ilex chinensis* from Xinjiang according to claim 2, characterized in that, The process of positive screening and fluorescence detection for rooted plants is as follows: Each rooted plant was initially screened for GFP fluorescence signal; When obvious green fluorescence is observed in the root tip, root hair or other parts, it is preliminarily determined that the plant has successfully integrated and expressed the GFP fusion target gene, and the plant is a positive transformation material. If no fluorescent signal is observed in the root tip, root hairs or other parts, the rooted plant is considered negative transformation material and should be discarded. After initial screening, samples with high fluorescence intensity were selected from the positively transformed materials for further cellular-level observation.

Images