Biomarker Compositions for Evaluating the Efficacy of Mesenchymal Stem Cell Therapy for Atopic Dermatitis and Their Applications

By detecting the mRNA expression levels of Ighg1, Mfsd4a, and Selenbp1 genes and combining this with computer prediction, the complexity and inaccuracy of existing mesenchymal stem cell efficacy evaluation technologies have been resolved, enabling precise assessment of the treatment effect of atopic dermatitis.

CN121109581BActive Publication Date: 2026-03-06HANGZHOU S EVANS BIOSCI LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511679308.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-03-06
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

Current technologies lack effective methods to evaluate the efficacy of mesenchymal stem cells in the treatment of atopic dermatitis. Traditional methods, such as skin epidermal scoring and blood tests, are complex and imprecise.

Method used

Using mRNA from the Ighg1, Mfsd4a, and Selenbp1 genes as biomarkers, the expression levels of these genes were detected by quantitative PCR, and the results were used to predict and evaluate the efficacy of stem cell therapy.

Benefits of technology

It provides a more intuitive, accurate, and sensitive method for evaluating therapeutic efficacy, simplifies the sampling process, improves the accuracy and sensitivity of the evaluation, and can reflect the significant effects of stem cell therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109581B_ABST
    Figure CN121109581B_ABST
Patent Text Reader

Abstract

This invention provides a biomarker composition for evaluating the efficacy of mesenchymal stem cell therapy for atopic dermatitis and its application, relating to the field of biotechnology. The biomarker composition includes the Ighg1 gene, Mfsd4a gene, and Selenbp1 gene. This biomarker composition is used to prepare products for evaluating the therapeutic effect of mesenchymal stem cell therapy on atopic dermatitis in subjects, alleviating the problem of the lack of existing methods for evaluating the efficacy of mesenchymal stem cell therapy for atopic dermatitis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a biomarker composition for evaluating the efficacy of mesenchymal stem cell therapy for atopic dermatitis and its application. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] Atopic dermatitis (AD), also known as atopic eczema, is a chronic, relapsing, itchy, inflammatory skin disease characterized by recurrent episodes of intense itching and dry skin. Currently, AD treatment typically involves the topical and / or systemic use of moisturizers, corticosteroids, and immunosuppressants. However, topical corticosteroids have limited effectiveness in moderate to severe AD patients, while systemic immunosuppressants carry risks such as bone marrow suppression and increased susceptibility to infection. Therefore, developing novel, safe, and effective treatments for AD is essential.

[0004] Mesenchymal stem cells (MSCs) are adult stem cells derived from the mesoderm and can be obtained from various tissues such as bone marrow, adipose tissue, placenta, and umbilical cord. Increasing research indicates that MSC transplantation can significantly improve the repair of damaged tissues, including bone defects, brain injury, myocardial infarction, acute liver and lung injury, and ulcerative colitis. Studies have shown that MSCs possess potent immunomodulatory functions, particularly inhibiting excessive Th2 responses, promoting Tregs, suppressing mast cells, and reducing IgE. MSCs also possess tissue repair functions, promoting barrier protein expression and improving keratinocyte function. Previous studies have shown that MSC injection can regulate skin barrier function, significantly reducing dermal inflammatory cell infiltration (eosinophils, mast cells, and lymphocytes), and promoting inflammation resolution and tissue repair at the site of skin lesions. By intervening in the core pathological aspects of Alzheimer's disease (AD) through multiple targets and pathways, the ultimate goal is to significantly improve clinical symptoms and histopathological damage. Currently, the mechanism of action and efficacy evaluation methods of MSCs in treating AD still require further investigation.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The purpose of this invention is to provide a biomarker composition for evaluating the efficacy of mesenchymal stem cell therapy for atopic dermatitis and its application, so as to alleviate the problem of the lack of existing methods for evaluating the efficacy of mesenchymal stem cell therapy for atopic dermatitis.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] In a first aspect, there is an application of a substance for detecting a biomarker composition in the preparation of a product for evaluating the therapeutic effect of atopic dermatitis in a subject, the biomarker composition comprising a first biomarker, a second biomarker and a third biomarker;

[0009] The first biomarker is the mRNA of the Ighg1 gene;

[0010] The second biomarker is the mRNA of the Mfsd4a gene;

[0011] The third biomarker is the mRNA of the Selenbp1 gene;

[0012] The subjects received mesenchymal stem cell therapy.

[0013] In a second aspect, a kit is provided for evaluating the therapeutic effect of atopic dermatitis in a subject, the kit comprising the substance of the detection biomarker composition described in the first aspect, wherein the subject has been treated with mesenchymal stem cells.

[0014] Thirdly, an apparatus for evaluating the therapeutic effect of atopic dermatitis in a subject is provided, the apparatus comprising a detection module and a prediction module, wherein the subject has undergone mesenchymal stem cell therapy; the detection module is used to detect the biomarker composition described in the first aspect;

[0015] The prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, and the amounts of the second and third biomarkers are higher, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This invention reveals that mesenchymal stem cells (MSCs) can improve skin pathological damage and reduce skin lesion scores in a model of atopic dermatitis, demonstrating a significant therapeutic effect. Furthermore, through transcriptome sequencing, a group of upregulated genes, Mfsd4a and Selenbp1, and downregulated gene Ighg1, highly correlated with the therapeutic effect of MSCs, were identified for the first time. Quantitative PCR confirmed that this group of genes can be used to evaluate the efficacy of MSCs in treating atopic dermatitis.

[0018] Based on this discovery, this invention uses the identified genomic marker composition as a biomarker composition. This biomarker composition is significantly correlated with atopic dermatitis lesions and treatment in mice, providing new data support and research ideas for the pathogenesis of atopic dermatitis, and improving the evaluation system for mesenchymal stem cell therapy for atopic dermatitis. Existing technologies typically analyze atopic dermatitis through skin epidermal scoring, blood tests, and even pathological biopsies. Compared to existing technologies, this invention simplifies the traditional sampling and evaluation methods for atopic dermatitis treatment by verifying the high correlation between the expression of the biomarker composition and skin epidermal scoring results, while obtaining a more intuitive, accurate, and sensitive evaluation of efficacy.

[0019] In summary, this invention provides methodological support for evaluating the efficacy of mesenchymal stem cells in the treatment of atopic dermatitis and offers new insights for developing precise and sensitive techniques for evaluating the efficacy of stem cell therapy. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 The skin tissue morphology of mice in each experimental group in Example 2;

[0022] Figure 2 The skin epidermal score is a representative score of the mice in Example 2;

[0023] Figure 3 This represents the relative expression level of the mouse Slc38a5 gene in Example 4;

[0024] Figure 4 The relative expression level of the mouse Ighg1 gene in Example 4;

[0025] Figure 5 The relative expression level of the mouse Mfsd4a gene in Example 4;

[0026] Figure 6 The relative expression level of the Selenbp1 gene in mice in Example 4;

[0027] Figure 7 The ROC curve was used to verify the correlation between gene composition expression and histological score in Example 6. Detailed Implementation

[0028] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Unless otherwise specified, all embodiments and preferred embodiments mentioned herein can be combined to form new technical solutions. All technical features and preferred features mentioned herein can be combined to form new technical solutions. The components involved, or their preferred components, can be combined to form new technical solutions.

[0030] In this document, unless otherwise stated, any numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbering first, second, third, and fourth.

[0031] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0032] In this article, the terms "each...independently selected" and "...independently selected" are interchangeable and should be interpreted broadly. They can mean that in different sets, the specific options expressed by elements of the same kind do not affect each other, or that in the same set, the specific options expressed by elements of the same kind do not affect each other.

[0033] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0034] In this document, the terms “patient,” “subject,” or “individual” are used interchangeably and include human or non-human animals, or cells, blood, tissues, body fluids, or secretions derived from human or non-human animals, such as humans, monkeys, mice, rats, rabbits, donkeys, cattle, horses, pigs, or dogs.

[0035] In this article, the term "gene expression product" refers to the product produced by a gene through processes such as transcription and translation. It can be a direct product or a product of a direct product after splicing, recombination, replication, or metabolism. Exemplary "gene expression products" include, but are not limited to, RNA or polypeptides.

[0036] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those familiar to a person skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be used herein.

[0037] In a first aspect, a substance for detecting a biomarker composition is provided for use in the preparation of a product for evaluating the therapeutic effect of atopic dermatitis in a subject, said biomarker composition comprising a first biomarker, a second biomarker, and a third biomarker. The subject is treated with mesenchymal stem cells. Optionally, the subject is treated with umbilical cord mesenchymal stem cells.

[0038] The first biomarker includes the Ighg1 gene and / or its expression product. The Ighg1 gene (the immunoglobulin heavy chain γ1 constant region gene) is crucial for the production of IgG1 antibodies with potent effector functions and is a key executor in the adaptive immune response to clear pathogens and abnormal cells. Optionally, the Ighg1 gene expression product includes at least one of mRNA and a polypeptide, preferably including mRNA.

[0039] The second biomarker includes the Mfsd4a gene and / or its expression product. The Mfsd4a gene (major facilitator superfamily domain-containing 4A) may be involved in regulating neuronal communication or synaptic function and belongs to the solute transporter family. Optionally, the expression product of the Mfsd4a gene includes at least one of mRNA and a polypeptide, preferably mRNA.

[0040] The third biomarker includes the Selenbp1 gene and / or its expression product. The Selenbp1 (Selenium-binding protein 1) gene catalyzes the oxidation of methanethiol, participates in sulfur metabolism and redox balance, and plays a regulatory role in cancer suppression and cardiovascular diseases. Optionally, the expression product of the Selenbp1 gene includes at least one of mRNA and a polypeptide, preferably including mRNA.

[0041] In an optional embodiment, the biomarker composition includes a fourth biomarker comprising the Slc38a5 gene and / or the expression product of Slc38a5, the Slc38a5 (Solute Carrier Family 38 Member 5) gene encoding a 12-transmembrane Na+. +This is a amino acid-dependent transporter protein expressed in tissues such as the liver, kidneys, brain (astrocytes), and umbilical cord, participating in physiological processes such as amino acid metabolism, cellular nutrient supply, acid-base balance regulation, and the neurotransmitter precursor (glutamate / γ-aminobutyric acid) cycle. Optionally, the expression product of the Slc38a5 gene includes at least one of mRNA and polypeptide, preferably including mRNA.

[0042] In optional embodiments, the substances in the detection biomarker composition include one or more of the following: probes, reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents, and reverse transcription reagents. Depending on the specific detection method, those skilled in the art can select the substances in the detection biomarker composition based on methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents; this invention does not limit this selection. Specific examples include, but are not limited to, at least one of the following: enzymes for amplification reactions, enzymes for reverse transcription, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primers for gene amplification, probes, positive controls, and negative controls.

[0043] In an optional embodiment, the biomarker composition includes mRNA from the Ighg1 gene, mRNA from the Mfsd4a gene, and mRNA from the Selenbp1 gene.

[0044] In an optional embodiment, the biomarker composition includes mRNA of the Ighg1 gene, mRNA of the Mfsd4a gene, mRNA of the Selenbp1 gene, and mRNA of the Slc38a5 gene.

[0045] The substance in the detection marker composition includes at least one of (i) to (iv):

[0046] (i) The upstream and downstream primers for detecting the first marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0047] (ii) The upstream and downstream primers for detecting the second marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0048] (iii) The upstream and downstream primers for detecting the third marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.5, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0049] (iv) The upstream and downstream primers for detecting the fourth marker, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.7, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0050] In an optional embodiment, the substances in the detection biomarker composition further include an upstream primer and a downstream primer for detecting the internal reference GAPDH. The nucleotide sequence of the upstream primer for detecting GAPDH is shown in SEQ ID NO.9, and the working concentration is preferably 8-12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer for detecting GAPDH is shown in SEQ ID NO.10, and the working concentration is preferably 8-12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0051] In a second aspect, a kit is provided for evaluating the therapeutic effect of atopic dermatitis in a subject, the kit comprising the substance of the detection biomarker composition described in the first aspect, the subject being treated with mesenchymal stem cells.

[0052] In an optional embodiment, the kit comprises one or more of the following: probes, reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents, and reverse transcription reagents. Depending on the specific detection method, those skilled in the art can select the composition of the reagents in the kit according to methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents; this invention does not limit this selection. Optionally, the kit includes, but is not limited to, at least one of the following: enzymes for amplification reactions, enzymes for reverse transcription, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primers for gene amplification, probes, quality control reagents, positive controls, and negative controls.

[0053] In an optional embodiment, the kit comprises at least one of (i) upstream and downstream primers for detecting a first biomarker, (ii) upstream and downstream primers for detecting a second biomarker, (iii) upstream and downstream primers for detecting a third biomarker, and (iv) upstream and downstream primers for detecting a fourth biomarker.

[0054] Thirdly, an apparatus for evaluating the therapeutic effect of atopic dermatitis in a subject is provided, the apparatus comprising a detection module and a prediction module, wherein the subject has undergone mesenchymal stem cell therapy; the detection module is used to detect the biomarker composition described in the first aspect;

[0055] The prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, and the amounts of the second and third biomarkers are higher, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

[0056] In an optional embodiment, the prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, the amounts of the second and third biomarkers are higher, and the amount of the fourth biomarker is lower, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

[0057] In optional embodiments, the amount of the biomarker composition includes, but is not limited to, the amount of a gene transcribed into mRNA or the amount of a gene translated into a polypeptide or protein.

[0058] In an optional embodiment, the first biomarker is the mRNA of the Ighg1 gene, the second biomarker is the mRNA of the Mfsd4a gene, the third biomarker is the mRNA of the Selenbp1 gene, and optionally the fourth biomarker is the mRNA of the Selenbp1 gene. The detection module includes amplifying mRNA using nucleic acid amplification reagents or obtaining cDNA from mRNA through reverse transcription, and the amount of the biomarker composition includes the expression level of the mRNA.

[0059] In an optional embodiment, the amplification reagent includes the upstream and downstream primers of the aforementioned nucleotide sequences as shown in SEQ ID NO. 1-6, respectively, used for amplifying the first to third markers.

[0060] In an optional embodiment, the amplification reagent includes the upstream and downstream primers of the aforementioned nucleotide sequences as shown in SEQ ID NO. 1-8, respectively, used for amplifying the first to fourth markers.

[0061] In an optional implementation, the detection module is used to implement the quantitative real-time PCR reaction procedure, including the following steps: reverse transcription of mRNA extracted from the sample to be tested into cDNA, and performing quantitative real-time PCR (qRT-PCR) reaction using cDNA as a template; collecting the fluorescence signal and Ct value of qRT-PCR, and combining the two for analysis of the prediction and judgment module results.

[0062] In an optional implementation, the amplification reaction procedure is as follows: First step, pre-denaturation at 95℃ for 5 min; second step, cyclic reaction, 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; final step, melting curve, 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s.

[0063] In an optional implementation, the relative expression level of mRNA in the sample is calculated as the amount of the biomarker composition based on the Ct value of the sample to be tested, using conventional calculation methods known in the art.

[0064] In an optional implementation, GAPDH is used as an internal reference for calculating the relative expression level of mRNA, wherein the GAPDH is amplified by primers with the aforementioned nucleotide sequences as shown in SEQ ID NO. 9 and 10.

[0065] In an optional implementation, the amount of the biomarker composition in untreated subject samples and the amount of the biomarker composition in mesenchymal stem cell-treated subject samples are obtained from the same detection process; or, the amount of the biomarker composition in the untreated subject samples is preset in the prediction and judgment module.

[0066] In an optional implementation, the test sample may be derived from conventional samples used for clinical testing in the art, including but not limited to cells, blood (plasma or serum), cells, tissues, body fluids and secretions, preferably including at least one of tissues and blood.

[0067] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0068] Example 1

[0069] Establishment of a mouse model of atopic dermatitis and HUCMSC (human umbilical cord mesenchymal stem cells) therapy:

[0070] Six SPF-grade BALB / c mice (female, 4-6 weeks old) were randomly selected for each group and kept under a 12-hour light / dark cycle at 22±2℃ with humidity maintained at 50%-60%.

[0071] (1) Sensitization by intraperitoneal injection:

[0072] Dissolve 100 μg of ovalbumin (OVA) in physiological saline to a concentration of 1 μg / μl, and mix with 100 μl of alum adjuvant (40 mg / ml). Administer the mixture intraperitoneally once a week for three weeks (days 0, 7, and 14).

[0073] (2) Skin irritation:

[0074] Mice were shaved on the back and neck, and after disinfection, gauze soaked in sterile water at a concentration of 1 mg OVA (10 μg / μl) was fixed to the shaved skin surface (1.2 cm × 1.2 cm). The dressing was changed 2-3 times a week for two weeks, and repeated exposure was used to induce AD. A mouse AD model was established by combining intraperitoneal injection of OVA and skin stimulation.

[0075] Two to three days after inducing AD-like symptoms, HUCMSC preparations were subcutaneously injected into the skin model on days 31, 33, and 35 of the experiment. The HUCMSC dose was 0.3 × 10⁻⁶. 7 Cells / kg. After treatment, the same skin stimulation was applied to the back lesions for 7 days. Three days after the stimulation was completed, the edema, erythema, and crusting on the surface of the mouse skin lesions were observed. The animals were then sacrificed, and full-thickness skin lesion specimens were taken for further analysis.

[0076] Example 2

[0077] Histological examination and RNA-Seq:

[0078] I. Histological examination:

[0079] The skin epidermis of mice in each group in Example 2 was observed and scored. The skin epidermis scoring criteria are as follows:

[0080] 0 points: No abnormalities;

[0081] 1 point: Mild erythema / slight thickening;

[0082] 2 points: Moderate erythema / thickening with localized desquamation;

[0083] 3 points: Severe erythema / significant thickening with extensive crusting;

[0084] 4 points: Severe edema, erosion with blood crusts.

[0085] Table 1. Skin epidermal scoring results

[0086]

[0087] The skin tissue morphology of mice in each experimental group is as follows: Figure 1 As shown in Table 1, the skin epidermal scores of mice are presented, and representative epidermal score images of mice are shown in the figure. Figure 2 As shown, the results indicate that subcutaneous injection of HUCMSCs can effectively improve skin tissue damage in mice with OVA-induced atopic dermatitis by combining peritoneal and skin treatments, and reduce epidermal scores.

[0088] 2. RNA-Seq:

[0089] Total RNA was extracted from full-thickness skin tissue of BALB / c mice (n=3) using TRIzol reagent (Invitrogen). RNA purity and integrity were analyzed using an Agilent Bioanalyzer 2100 (Agilent Technologies). RNA sequencing was performed using an Illumina HiSeq 4000 sequencing system. RNA-Seq data mapping was performed using the MapSplice program. Expression levels of each gene were measured per kilobase per million transcripts. The quality of the paired-end data fastq (.gz) files was analyzed using fastqc next-generation sequencing data quality analysis software. The filtered fastq.qz data files (containing cDNA sequences) were aligned with the corresponding reference genome using hisat2 to generate the corresponding sam files. Subsequent steps included assembly screening of differentially expressed genes, GO annotation and KEGG analysis, protein-protein interaction network analysis, and key gene analysis.

[0090] Differential gene analysis of RNA-Seq data revealed that four genes were selected as candidate genes for both upregulation and downregulation, showing significant upregulation and downregulation effects. In mice treated with subcutaneous injection of HUCMSCs, the expression of Slc38a5 and Ighg1 genes was upregulated compared to normal mice, while the expression of Mfsd4a and Selenbp1 genes was downregulated.

[0091] Table 2 Gene Analysis Results

[0092]

[0093] Example 3

[0094] A set of gene compositions for evaluating umbilical cord mesenchymal stem cell therapy for Alzheimer's disease is provided, including primer combinations as described in Table 3:

[0095] Table 3 Primer Sequences

[0096]

[0097] Where B represents A or G, Y represents C or T, and M represents A or C. The primer sequences in the degenerate primers are mixed in equimolar proportions.

[0098] Example 4

[0099] RT-PCR verification:

[0100] The atopic dermatitis model and HUCMSC treatment experiment of Example 1 were repeated. Five weeks later, full-thickness skin tissue was obtained, and total RNA was extracted using TRIzol reagent (Invitrogen), followed by reverse transcription to obtain cDNA. Quantitative real-time PCR (qRT-PCR) was performed using the primer sequences provided in Table 3 and the internal reference gene GADPH primer sequences SAD ID NO. 9 and SAD ID NO. 10 to determine the relative mRNA levels of candidate genes. qPCR amplification was performed in a total volume of 10 μL according to the kit instructions.

[0101] Forward and reverse primers for the GADPH gene:

[0102] The forward primer is: F: AATGGATTTGGACGCATTGGT (SAD ID NO. 9);

[0103] The reverse primer is: R: TTTGCACTGGTACGTGTTGAT (SAD ID NO.10).

[0104] The amplification conditions for qRT-PCR are as follows: Step 1, pre-denaturation at 95℃ for 5 min; Step 2, cycling reaction: 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; Step 3, melting curve: 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. (Using 2...) -ΔΔCT The method uses GAPDH as an internal reference.

[0105] Each sample was evaluated in triplicate, and measurements were repeated independently at least three times. Data analysis was then performed based on the average threshold (Ct).

[0106] Each sample was evaluated in triplicate, and measurements were performed independently at least three times. The results are as follows: Figures 3-6 As shown, the results indicate that the expression level of Slc38a5 gene mRNA in the HUCMSC group was downregulated compared to the model group. Figure 3 Ighg1 gene mRNA expression was downregulated relative to the model group. Figure 4 The expression levels of Mfsd4a gene mRNA and Selenbp1 gene mRNA were upregulated relative to the model group. Figure 5 and Figure 6 ).

[0107] Example 5

[0108] Correlation analysis between gene expression and skin histology score:

[0109] The CORREL function was used to analyze the correlation between changes in candidate gene expression and skin histology scores. A correlation coefficient close to 1 or -1 indicates a strong correlation; close to 1 indicates a positive correlation; close to -1 indicates a negative correlation; a correlation coefficient of 0 indicates no correlation; below 0.4 indicates a low correlation; 0.4–0.7 indicates a significant correlation; and above 0.7 indicates a high correlation. The results showed that changes in Ighg1 gene expression were highly positively correlated with skin histology scores, changes in Mfsd4a and Selenbp1 gene expression were highly negatively correlated with skin histology scores, and changes in Slc38a5 gene expression were lowly correlated with skin histology scores. This indicates that changes in the gene combination Ighg1, Mfsd4a, and Selenbp1 are highly correlated with pathological histology scores.

[0110] Table 4 Gene Correlation Coefficient Results

[0111]

[0112] Example 6

[0113] Validation of the correlation between gene expression and skin epidermal score:

[0114] The atopic dermatitis model establishment and HUCMSC treatment experiment in Example 1 were repeated, with the number of mice in each group increased to 30. After five weeks, full-thickness skin tissue was obtained, and total RNA was extracted using TRIzol reagent (Invitrogen). Quantitative real-time PCR (qRT-PCR) was performed using the primer sequences provided in Table 3 and the internal reference gene primer sequences SAD ID NO. 9 and SAD ID NO. 10 to determine the relative mRNA levels of candidate genes. qPCR amplification was performed in a total volume of 10 μL according to the kit instructions.

[0115] The amplification conditions for qRT-PCR are as follows: Step 1, pre-denaturation at 95℃ for 5 min; Step 2, cycling reaction: 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; Step 3, melting curve: 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. (Using 2...) -ΔΔCT The method uses GAPDH as an internal reference. Each sample is evaluated in triplicate, and measurements are repeated independently at least three times. Finally, data analysis is performed based on the average threshold (Ct).

[0116] When the Ct value of the test sample is less than 40 and there is an obvious amplification curve, and the Ct value of the blank control (the model group without HUCMSC treatment) is greater than 40 and there is no obvious amplification curve, the fluorescence signal is used for the result analysis of mRNA expression level.

[0117] The HUCMSC treatment was deemed effective if the expression level of the Ighg1 gene in the model group was significantly lower than that in the untreated model group, and the expression levels of the Mfsd4a and Selenbp1 genes were significantly higher than those in the untreated model group. If at least one of these three gene expression levels did not meet the criteria, the HUCMSC treatment was deemed ineffective. ROC curves were plotted to validate the gene composition based on histological scoring and PCR results. The ROC curves were analyzed to obtain... Figure 7 AUC value = 96.73%, P < 0.0001.

[0118] In summary, the results indicate that HUCMSCs can alleviate AD damage induced by combined intraperitoneal and skin OVA to a certain extent, demonstrating a therapeutic effect on AD. Functional analysis of candidate genes showed that mice injected subcutaneously with HUCMSCs exhibited improved immune regulation and reduced inflammation levels. RT-PCR analysis confirmed a high correlation between changes in this gene composition and skin histological scores. Therefore, the biomarker composition and kit provided by this invention can reflect the therapeutic effect of HUCMSCs on AD to a certain extent and can be used for evaluating the efficacy of AD treatment.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for detecting expression of a marker composition in the preparation of a product for evaluating treatment effect of atopic dermatitis of a subject, the marker composition comprising a first marker, a second marker and a third marker; the first marker is mRNA of Ighg1 gene; the second marker is mRNA of Mfsd4a gene; the third marker is mRNA of Selenbp1 gene; the subject is treated by umbilical cord mesenchymal stem cells. The substance for detecting expression of the marker composition comprises one or more of reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents and reverse transcription reagents. The substance for detecting expression of the marker composition comprises (i), (ii) and (iii): (i) upstream and downstream primers for detecting the first marker, the nucleotide sequences of which are shown in SEQ ID NO. 1 and 2, respectively; (ii) upstream and downstream primers for detecting the second marker, the nucleotide sequences of which are shown in SEQ ID NO. 3 and 4, respectively; 2. Use according to claim 1, characterized in that, (iii) upstream and downstream primers for detecting the third marker, the nucleotide sequences of which are shown in SEQ ID NO. 5 and 6, respectively; 3. Use according to claim 2, characterized in that, Wherein, B in the nucleotide sequence represents A or G. The substance for detecting expression of the marker composition further comprises an upstream primer with a nucleotide sequence shown in SEQ ID NO. 9 and a downstream primer with a nucleotide sequence shown in SEQ ID NO. 10 for detecting an internal reference. The working concentration of each of the upstream primers is independently 8-12 μM; and / or, the working concentration of each of the downstream primers is independently 8-12 μM. The subject is treated by umbilical cord mesenchymal stem cells. The detection module is used for detecting expression of the marker composition of any one of claims 1-5; the prediction and judgment module comprises a computer readable medium recording a judgment rule, the computer readable medium is processed and executed to compare expression of the marker composition of the subject treated by umbilical cord mesenchymal stem cells with that of the subject without treatment; if expression of the first marker of the subject treated by umbilical cord mesenchymal stem cells is lower than that of the subject without treatment, and expression of the second marker and the third marker is higher, it is determined that the subject treated by umbilical cord mesenchymal stem cells is effectively treated.

4. Use according to claim 2, characterized in that, ​ 5. Use according to claim 3 or 4, characterized in that, ​ 6. A kit for evaluating the therapeutic effect of atopic dermatitis in a subject, characterized by, ​ 7. A device for evaluating the effect of treatment of atopic dermatitis in a subject, characterized by, ​ ​

Citation Information

Patent Citations

  • Method for detecting atopic dermatitis

    CN115485390A

  • Application of MSCs and AMP in preparation of atopic dermatitis intervention product and preparation

    CN116059246A