A umad1 gene molecular marker associated with chicken connected production traits and application thereof
By using UMAD1 gene molecular marker primers, and combining whole-genome resequencing and PCR amplification with Sanger sequencing, the problem of identifying continuous egg production traits in chicken breeding was solved, thus improving breeding efficiency and egg production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2025-11-17
- Publication Date
- 2026-06-12
AI Technical Summary
Current technologies lack gene molecular markers that can accurately identify the continuous laying trait in chickens, making breeding selection difficult and hindering the rapid screening of high-quality chicken breeds.
We provided primers for the UMAD1 gene molecular marker, and screened out the UMAD1 gene molecular markers that were significantly associated with the total consecutive laying length in chickens through whole-genome resequencing and whole-genome association analysis. We then used PCR amplification and Sanger sequencing to detect the SNP genotypes in chickens.
It enables rapid and accurate identification of chicken laying traits, improves the efficiency of breeding selection and egg production, and provides a scientific basis for early selection of high-quality chicken breeds.
Smart Images
Figure CN121109618B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a molecular marker primer for the UMAD1 gene associated with the continuous laying trait in chickens and its application, belonging to the field of biotechnology. Background Technology
[0002] Follicle development is a continuous process: once the primordial follicle is activated, a clear hierarchical system forms within the ovary based on its functional state. Near ovulation, 5-7 yellow pre-ovulatory follicles arranged in a stepped distribution can be observed; these follicles release eggs sequentially, with an average interval of 24-27 hours between adjacent ovulations, and a minimum interval slightly longer than 21 hours. This ovulation rhythm causes the hen to lay eggs continuously.
[0003] The total length of consecutive laying periods in chickens is positively correlated with egg production. Numerous studies both domestically and internationally have shown that continuous selection for this trait can effectively increase egg production. The ovulation rhythm in poultry is dominated by the biological clock and regulated by the daily light-dark cycle. A luteinizing hormone (LH) peak occurs before ovulation, accompanied by follicle growth and maturation. A longer total length of consecutive laying periods indicates higher egg production, making it a crucial indicator of poultry reproductive performance. Currently, there is a lack of gene molecular markers that can accurately identify the consecutive laying trait in chickens and apply them to breeding selection for rapid identification and early screening. Summary of the Invention
[0004] The purpose of this invention is to address the deficiencies of existing technologies by providing a molecular marker primer for the UMAD1 gene associated with the continuous laying trait in chickens and its application, which can rapidly detect and screen for the continuous laying trait in chickens.
[0005] This invention records the individual egg production records of recessive White Locker chickens from the start of laying to 36 weeks of age, calculates the total continuous laying length, uses whole-genome resequencing technology to perform SNP genotyping, and screens the UMAD1 gene molecular marker, which is significantly associated with the total continuous laying length trait of chickens, through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of chicken continuous laying trait.
[0006] The UMAD1 gene, located on the short arm of chromosome 2, is a protein-coding gene that functions as both an "endosome-ubiquitin homeostasis regulator" and a "synaptic plasticity regulator." The UMAD1 gene is associated with quantitative trait loci related to eggshell color. This suggests that UMAD1 influences the neuroendocrine axis by regulating synaptic plasticity and endosome-ubiquitin homeostasis, thereby regulating gonadotropin-releasing hormone / luteinizing hormone (GnRH / LH) secretion and cumulus length. Furthermore, its signaling in obesity GWAS suggests that it can affect the energy balance required for egg production via the energy metabolism-insulin pathway. Simultaneously, the gene co-localizes with eggshell color QTLs, suggesting it may be a pleiotropic locus, where the same variation can simultaneously affect eggshell pigment deposition and cumulus length.
[0007] The present invention solves the technical problem through the following technical solution: First, it provides a molecular marker primer for the UMAD1 gene associated with the continuous laying trait in chickens. The molecular marker is located at the 24741087th base on chicken chromosome 2, with the base mutated to G or T. The sequence is shown as the 252nd base in SEQ ID NO: 3 or SEQ ID NO: 4. The nucleotide sequences of the chicken DNA-specific primer pairs required for molecular marker detection are shown in SEQ ID NO: 1 and SEQ ID NO: 2.
[0008] This invention further provides applications of the aforementioned specific primers, including the detection of SNP genotypes associated with the continuous laying trait in recessive White Locker chickens. Specifically, a method for detecting SNP genotypes associated with the continuous laying trait in chickens using PCR amplification combined with Sanger sequencing includes the following steps:
[0009] Step 1: Provide a chicken DNA sample to be tested, and perform PCR amplification using DNA-specific primers to obtain the amplification product. The chicken DNA sample to be tested contains an SNP molecular marker at position 24741087 of chromosome 2 of chicken.
[0010] The second step is to perform Sanger sequencing on the PCR products.
[0011] The third step is to determine the SNP molecular marker genotype at position 24741087 of chromosome 2 of the chicken based on the sequencing results from the second step.
[0012] The deoxyribonucleotide sequence of the chicken DNA-specific primer pair mentioned in the first step is as follows:
[0013] Upstream primer: 5'-TGAGTAAAGTCTGCCCGAAGA-3' (SEQ ID NO: 1)
[0014] Downstream primer: 5'-CTGTTTGGAGTTTGTGTAGTAGC-3' (SEQ ID NO: 2)
[0015] The amplification product described in the first step is 366 bp in length and contains the 24741087th base on chicken chromosome 2.
[0016] The final volume of the reaction system (25 μl) is:
[0017] Chicken DNA 50ng to be tested
[0018] 2 x Accurate Taq Master Mix 12.5μl
[0019] 1 μl of upstream primer
[0020] 1 μl of downstream primer
[0021] Add sterile water to a final volume of 25 μl.
[0022] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 27 cycles; 72℃ extension for 5 min; and storage at 4℃.
[0023] The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:4.
[0024] In the third step, the criterion is that the total continuous laying length of chickens with the SNP site T / T genotype is higher than that of individuals with the G / T and G / G genotypes, and the total continuous laying length of chickens with the G / T genotype is higher than that of individuals with the G / G genotype.
[0025] This invention uses the UMAD1 gene molecular marker to detect the genotype of chickens with a continuous egg production trait. It found that chickens with the T / T genotype had a longer total continuous egg production length than those with the G / T and G / G genotypes, and vice versa. Using the genomic DNA of the chickens as a template, specific primers were used for PCR amplification. The PCR amplification products were then subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, selection for the continuous egg production trait can be achieved. In breeding, according to breeding objectives, individuals with the G / G and G / T genotypes can be culled while those with the T / T genotype are retained. The beneficial effect is that this molecular marker can serve as a genetic marker for chicken breeding, efficiently and rapidly identifying the continuous egg production trait and increasing the total egg production of the flock, providing a scientific basis for early selection and breeding, and is of great value for chicken breeding. Furthermore, the detection method disclosed in this invention is simple and easy to operate, and can be carried out in a laboratory. Attached Figure Description
[0026] Figure 1 This is a Manhattan plot of genome-wide association analysis of total lay length in chickens.
[0027] Figure 2 These are Sanger sequencing results of PCR amplification products from three genotypes. Detailed Implementation
[0028] The following examples are applicable to chicken breeding.
[0029] Example 1
[0030] This embodiment statistically analyzed the total consecutive laying length from the onset of laying to 36 weeks of age in recessive White Locker hens. Genome-wide SNP genotyping was performed using next-generation sequencing technology. Genome-wide association analysis was used to screen for the UMAD1 gene molecular marker, which was significantly associated with consecutive laying traits. The results are as follows: Figure 1 As shown.
[0031] This embodiment uses the following experiments to identify and apply the molecular marker of the UMAD1 gene, which is related to the continuous laying trait in chickens.
[0032] 1. Phenotyping and Genotyping
[0033] (1) Experimental materials and phenotypic determination
[0034] 2598 recessive White Locker hens were selected as experimental animals and raised under the same feeding conditions. Throughout the process, they were allowed free access to feed and water. The laying time of each hen was continuously recorded from the start of egg production, and the total continuous laying length was calculated as phenotypic data.
[0035] (2) Extraction of genomic DNA
[0036] Blood was collected from the subwing vein of the individuals to be tested, and after anticoagulation, the blood was lysed, digested with proteinase K, extracted using the saturated sodium chloride method, dissolved in TE, and stored at -20°C.
[0037] (3) PCR amplification
[0038] Using the extracted genomic DNA as a template, the fragment containing base 24741087 of chromosome 2 was amplified.
[0039] Upstream primer: 5'-TGAGTAAAGTCTGCCCGAAGA-3' (SEQ ID NO: 1)
[0040] Downstream primer: 5'-CTGTTTGGAGTTTGTGTAGTAGC-3' (SEQ ID NO: 2)
[0041] The final volume of the reaction system (25 μl) is:
[0042] DNA to be tested 50ng
[0043] 2x Accurate Taq Master Mix 12.5μl
[0044] 1 μl of upstream primer
[0045] 1 μl of downstream primer
[0046] Add sterile water to a final volume of 25 μl.
[0047] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 27 cycles; 72℃ extension for 5 min; storage at 4℃; 10 μl was used for agarose gel assay, and an amplification product with a single target band length of 366 bp was obtained, containing the SNP molecular marker at position 24741087 of chicken chromosome 2; the sequence of the amplified product is as follows:
[0048] SEQ ID NO: 3
[0049] TGAGTAAAGTCTGCCCGAAGATTAGCTGCTGTACTGTTTTTGCCTTTTCGAGGACAGAGTAAATGGATTTATGTTTTATTTTATGTGGAGACTGCCTAATTCTTAACCTCTTTTGTTGGTTTGCCTTTAGATTTTAGATCTCCTTCCTGAGGCTGAGGGAGTTCAGAAGGTTGTAGCAATAA AATGAAATTAATGTTCTAAAACCAAAACTGATGTATCAAGGAGCTTTAGAGGTAGAGGTGCCTGAATAAGGTCTTATAATTGCTTTTGGATGTAGGTTTTCCTTCTTTCATGTTTACAACCATTGTGTAAAACCTTTAGATTTATTCATAAGCTTGTATTTGCTACTACACAAACTCCAAACAG
[0050] SEQ ID NO: 4
[0051] TGAGTAAAGTCTGCCCGAAGATTAGCTGCTGTACTGTTTTTGCCTTTTCGAGGACAGAGTAAATGGATTTATGTTTTATTTTATGTGGAGACTGCCTAATTCTTAACCTCTTTTGTTGGTTTGCCTTTAGATTTTAGATCTCCTTCCTGAGGCTGAGGGAGTTCAGAAGGTTGTAGCAATAA AATGAAATTAATGTTCTAAACCAAAACTGATGTATCAAGGAGCTTTAGAGGTAGAGGTGCCTGAATAATGTCTTATAATTGCTTTTGGATGTAGGTTTTCCTTCTTTCATGTTTACAACCATTGTGTAAAACCTTTAGATTTATTCATAAGCTTGTATTTGCTACTACACAAACTCCAAACAG.
[0052] (4) Sanger sequencing and genotyping
[0053] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagrams of different genotypes were obtained as follows: Figure 2 As shown.
[0054] 2. Correlation analysis
[0055] Correlation analysis was performed on 2598 recessive White Locker hens with clear phenotypic records. The ANOVA test function of R4.2 statistical plotting software was used for statistical testing. Pairwise comparison of means was selected to statistically test the genotype and total laying length of the experimental flock. P < 0.05 indicated a significant difference. The results are shown in Table 1. The average total laying length of T / T genotype individuals was 61.76 days, higher than that of G / T genotype individuals (59.24 days, P < 0.05) and G / G genotype individuals (57.11 days, P < 0.05). The total laying length of G / T genotype individuals was higher than that of G / G genotype individuals. The results indicate that the chicken UMAD1 gene molecular marker is significantly correlated with the laying length phenotypic trait in chickens. Based on actual breeding goals, T / T genotype individuals can be selected to breed chickens with a larger total laying length, thereby improving the overall laying length and uniformity of the flock and increasing breeding efficiency.
[0056] Table 1. Association analysis between UMAD1 gene molecular markers and continuous yield traits.
[0057] Note: Data with the same subtitle in the same column indicate no significant difference, while data with different subtitles indicate significant difference (P<0.05).
[0058] Example 2
[0059] Genotype frequency of different varieties
[0060] 1. Blood sample collection
[0061] Blood samples were collected from eight breeds of chickens, including Recessive White Locker, Wenchang Chicken, Beijing Oil Chicken, Wuding Chicken, Daweishan Miniature Chicken, Jingxing Yellow Chicken, Bearded Chicken, and Big Bone Chicken, using the subwing vein blood collection method. The samples were stored at -20℃ for later use.
[0062] 2. Extraction of genomic DNA
[0063] Take the tissue sample obtained in the first step and extract genomic DNA using Omega's tissue genomic DNA extraction kit, following the standard operating procedure provided by Omega.
[0064] 3. Genotyping
[0065] Using the genomic DNA obtained in the second step as a template, PCR amplification and Sanger sequencing were performed using primer pairs consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the individual's G / G genotype, G / T genotype and T / T genotype.
[0066] 4. Results Analysis
[0067] Wenchang chicken, Beijing oil chicken, Wuding chicken, Daweishan miniature chicken, bearded chicken, and Dagu chicken are well-known local Chinese chicken breeds. They have not undergone long-term selective breeding, have high genetic diversity, low egg production, but good egg quality, a low proportion of abnormal eggs, and a relatively short total laying length. Jingxing yellow chicken is a yellow-feathered broiler breed developed from local Chinese resources. It has excellent meat flavor, high growth rate, and reproductive performance similar to other local Chinese breeds. Recessive white-lipped broiler chicken is a popular commercial breed, often used as a specialized strain in medium-growth yellow-feathered broiler breeders. Its main breeding objectives are to improve growth rate, feed conversion ratio, and egg production performance. It has a relatively high T allele frequency. This SNP marker exhibits polymorphism in different breed types and is suitable for selecting total laying length in various breeds / strains to accelerate the progress of reproductive performance selection. The allele frequency distribution of the UMAD1 gene molecular marker in different breeds is shown in Table 2.
[0068] Table 2. Allelic frequency distribution of UMAD1 gene molecular markers in different varieties. .
[0069] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.
Claims
1. The application of a molecular marker primer for the UMAD1 gene associated with the continuous laying trait in chickens, characterized in that: The molecular marker primers were used to detect chicken reproductive traits, and the detection method included the following steps: Step 1: The chicken DNA sample to be tested was subjected to PCR amplification using the molecular marker primers shown in SEQ ID NO:1-2 to obtain the amplification product. The amplification product was 366 bp in length and contained the 24741087th base of chromosome 2 of the chicken reference genome GRCg7b version. The second step is to perform Sanger sequencing on the PCR products. The third step is to determine the SNP molecular marker genotype at position 24741087 on chromosome 2 of the reference genome GRCg7b version based on the sequencing results of the second step. The criteria for determination are that the total continuous laying length of chickens with the SNP site T / T is higher than that of individuals with the G / T and G / G genotypes, and the total continuous laying length of chickens with the G / T genotype is higher than that of individuals with the G / G genotype.
2. The application of the UMAD1 gene molecular marker primers related to chicken continuous laying traits as described in claim 1, characterized in that: The PCR reaction system is in 25 μl increments, and the system is as follows: Chicken DNA 50ng to be tested 2x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Add sterile water to a final volume of 25 μl; The PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 27 cycles; 72℃ extension for 5 min; storage at 4℃; the nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:4.