Variant nucleic acid library of mast cells

Abstract

Provided herein are antibodies and antibody fragments that are related to SIGLEC-8 and CD117. Provided herein are methods and compositions related to a library of SIGLEC-8 and / or CD117, the library having a nucleic acid encoding a scaffold comprising a SIGLEC-8 and / or CD117 domain. The SIGLEC-8 and / or CD117 libraries described herein encode immunoglobulins, such as antibodies.

Description

Cross-references

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 486,754, filed on February 24, 2023, which is incorporated herein by reference in its entirety. Background Technology

[0002] Mast cells (also known as mastocytes or labrocytes) are connective tissue cells that are part of the immune system. Mast cells are involved in wound healing, angiogenesis, immune tolerance, defense against pathogens, and vascular permeability. Sialic acid-binding Ig-like lectin 8 (SIGLEC-8) is a protein expressed by mast cells involved in asthma and allergies. Differentiation cluster 117 (CD117), also known as tyrosine protein kinase KIT and mast cell / stem cell growth factor receptor (SCFR), is a receptor tyrosine kinase that can be used for the diagnosis of mast cells and other tumors.

[0003] Both SIGLEC-8 and CD117 play important roles in various mast cell-related diseases and conditions, including cancer and immune disorders (e.g., asthma, allergies), and therapeutic antibodies targeting mast cells, SIGLEC-8, and / or CD117 have clinical significance. Antibodies possess the ability to bind to biological targets with high specificity and affinity. However, the design of therapeutic antibodies is challenging due to the balance between immunological effects and efficacy. Therefore, there is a need to develop compositions and methods for generating antibodies for use in therapeutic agents. Incorporate by reference

[0004] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference, as each individual publication, patent or patent application is specifically and individually indicated to the extent of its inclusion herein by reference. Summary of the Invention

[0005] This document provides antibodies and antibody fragments comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence shown in any one of SEQ ID NO: 1-450. In some embodiments, the antibody or antibody fragment comprises an amino acid sequence that is at least about 95% identical to the amino acid sequence shown in any one of SEQ ID NO: 1-450. In some embodiments, the antibody or antibody fragment comprises an amino acid sequence as shown in any one of SEQ ID NO: 1-450. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotype (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some implementations, the antibody or antibody fragment is in Kc of less than 75 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding with SIGLEC. In some embodiments, the antibody or antibody fragment is in K+ of less than 10 nM. D Combined with SIGLEC.

[0006] This document provides antibodies or antibody fragments that bind to SIGLEC, comprising an immunoglobulin heavy chain containing an amino acid sequence that is at least about 90% identical to the amino acid sequence shown in any one of SEQ ID NO: 151-200. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least about 95% identical to the amino acid sequence shown in any one of SEQ ID NO: 151-200. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence as shown in any one of SEQ ID NO: 151-200. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotypic (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some embodiments, the antibody or antibody fragment thereof is chimeric or humanized. In some embodiments, the antibody or antibody fragment is expressed at a Kc concentration of less than 75 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding with SIGLEC. In some embodiments, the antibody or antibody fragment is in K+ of less than 10 nM. D Combined with SIGLEC.

[0007] This document provides antibodies or antibody fragments that bind to SIGLEC, comprising an immunoglobulin light chain containing an amino acid sequence that is at least about 90% identical to the amino acid sequence shown in any one of SEQ ID NO: 351-400. In some embodiments, the immunoglobulin light chain contains an amino acid sequence that is at least about 95% identical to the amino acid sequence shown in any one of SEQ ID NO: 351-400. In some embodiments, the immunoglobulin light chain contains an amino acid sequence as shown in any one of SEQ ID NO: 351-400. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotypic (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some embodiments, the antibody or antibody fragment thereof is chimeric or humanized. In some embodiments, the antibody or antibody fragment is expressed at a Kc concentration of less than 75 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding with SIGLEC. In some implementations, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding with SIGLEC. In some embodiments, the antibody or antibody fragment is in K+ of less than 10 nM. D Combined with SIGLEC.

[0008] This document provides antibodies and antibody fragments comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence shown in any one of SEQ ID NO: 451-639. In some embodiments, the antibody or antibody fragment comprises an amino acid sequence that is at least about 95% identical to the amino acid sequence shown in any one of SEQ ID NO: 451-639. In some embodiments, the antibody or antibody fragment comprises an amino acid sequence as shown in any one of SEQ ID NO: 451-639. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotype (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some implementations, the antibody or antibody fragment is in Kc of less than 75 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in Kc at a concentration of less than 10 nM. D Combined with CD117.

[0009] This document provides antibodies and antibody fragments that bind CD117, comprising an immunoglobulin heavy chain containing at least about 90% identical amino acid sequences to those shown in any one of SEQ ID NO: 514-534. In some embodiments, the immunoglobulin heavy chain contains at least about 95% identical amino acid sequences to those shown in any one of SEQ ID NO: 514-534. In some embodiments, the immunoglobulin heavy chain contains amino acid sequences as shown in any one of SEQ ID NO: 514-534. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotypic (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some embodiments, the antibody or antibody fragment thereof is chimeric or humanized. In some embodiments, the antibody or antibody fragment is expressed at a Kc concentration of less than 75 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in Kc at a concentration of less than 10 nM. D Combined with CD117.

[0010] This document provides antibodies and antibody fragments that bind CD117, comprising an immunoglobulin light chain containing at least about 90% identical amino acid sequences to those shown in any one of SEQ ID NO: 598-618. In some embodiments, the immunoglobulin light chain contains at least about 95% identical amino acid sequences to those shown in any one of SEQ ID NO: 598-618. In some embodiments, the immunoglobulin light chain contains amino acid sequences as shown in any one of SEQ ID NO: 598-618. In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fvs (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibody, anti-idiotypic (anti-Id) antibody, or an ab antigen-binding fragment thereof. In some embodiments, the antibody or antibody fragment thereof is chimeric or humanized. In some embodiments, the antibody or antibody fragment is expressed at a Kc concentration of less than 75 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 50 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in K+ of less than 25 nM. D Binding to CD117. In some embodiments, the antibody or antibody fragment is in Kc at a concentration of less than 10 nM. D Combined with CD117.

[0011] This document provides methods for treating diseases or conditions, including the administration of any of the antibodies or antibody fragments disclosed herein. In some embodiments, the disease is a mast cell disease. In some embodiments, the disease is cancer. In some embodiments, the disease is an immune disease. In some embodiments, the disease is an allergy. In some embodiments, the disease is asthma.

[0012] Some non-restrictive implementation schemes are provided below. Attached Figure Description

[0013] Figure 1 A schematic diagram illustrating the steps of an exemplary process workflow for gene synthesis as disclosed herein is presented.

[0014] Figure 2 An example of a computer system is shown.

[0015] Figure 3It is a block diagram that shows the architecture of a computer system.

[0016] Figure 4 It is a diagram showing a network configured to incorporate multiple computer systems, multiple cellular phones and personal data assistants, and network attached storage (NAS).

[0017] Figure 5 It is a block diagram of a multiprocessor computer system that uses a shared virtual address space.

[0018] Figure 6A The SIGLEC-8 box pTT5-SIGLEC-8 P2A mVenus is depicted. Figure 6B The SIGLEC-8 box pTT5-SIGLEC-8 mVenus is depicted. Figure 6C Sketches depicting both SIGLEC-8 and CD117 positioning methods are provided. Figure 6D The fluorescence of the boxed pTT5-SIGLEC-8 mVenus is shown. Figure 6E The fluorescence of the boxed pTT5-SIGLEC-8 P2A mVenus is shown. Figure 6F The results of SIGLEC-8 titration are shown. Figure 6G The transient expression of SIGLEC-8 was shown when the amount was increased during titration.

[0019] Figure 7A The screening strategy for SIGLEC-8 antibodies was described. Figure 7B The phage recovery after each round of screening is shown.

[0020] Figure 8A The results of the clone ELISA screening after the third round of selection are described. Figure 8B The results of the clone ELISA screening after the fourth round of selection are described. Figure 8C The results of clone ELISA screening across rounds 3 and 4 are summarized.

[0021] Figure 9A The expression yield of SIGLEC-8 antibody was depicted. Figure 9B A gel depicting the relative expression of purified SIGLEC-8 antibody was described. Figure 9C Another gel was depicted, showing the relative expression of the purified SIGLEC-8 antibody.

[0022] Figure 10A Carterra dynamics data for each SIGLEC-8 clone were depicted. Figure 10B The Cartera dynamics data are summarized.

[0023] Figure 11A-11OThe antibody SIGLEC-8-48 against SIGLEC-8 was shown. Figure 11A ), SIGLEC-8-49 ( Figure 11B ), SIGLEC-8-50 ( Figure 11C ), SIGLEC-8-51 ( Figure 11D ), SIGLEC-8-52 ( Figure 11E ), SIGLEC-8-53 ( Figure 11F ), SIGLEC-8-54 ( Figure 11G ), SIGLEC-8-55 ( Figure 11H ), SIGLEC-8-56 ( Figure 11I ), SIGLEC-8-57 ( Figure 11J ), SIGLEC-8-58 ( Figure 11K ), SIGLEC-8-59 ( Figure 11L ), SIGLEC-8-60 ( Figure 11M ) and SIGLEC-8-61 ( Figure 11N Titration determination of ). Figure 11O The K-line of the SIGLEC-8 antibody was described. D With EC 50 Summarizing the regression data.

[0024] Figure 12A The SIGLEC gene associated with SIGLEC-8 was depicted. Figure 12B A comparison of different SIGLEC sequences (SEQ ID NO: 644-649) is depicted.

[0025] Figure 13A The kinetic data of the Anamorlon clone are shown. Figure 13B The dynamic data of the sub-nanomoloclone were summarized. Figure 13C The cross-reactivity profile of SIGLEC-8 mAb with the closely related SIGLEC protein was depicted.

[0026] Figure 14A The boxed prototype of SIGLEC-8 is depicted. Figure 14B The correlations of various SIGLEC-8 antibodies are shown.

[0027] Figure 15A The results of the study on immobilized leiralimab (an antibody known to bind to SIGLEC-8) are described. Figure 15B The results of immobilized SIGLEC-8-40 antibody were described.

[0028] Figure 16A The CD117 box pTT5-CD117 P2A mVenus is depicted. Figure 16B The CD117 box pTT5-CD117 mVenus is depicted. Figure 16C The fluorescence of the cassette-sized pTT5-CD117 mVenus is shown. Figure 16D The fluorescence of the cassette pTT5-CD117 P2A mVenus was shown.

[0029] Figures 17A-17E The CD117 antibody CD117-1 ( Figure 17A CD117-2 Figure 17B CD117-3 Figure 17C ) and CD117-4 ( Figure 17D The result of the instantaneous expression of ). Figure 17E The specific binding of FACS to CD117 transient cells was demonstrated.

[0030] Figure 18A The screening strategy for CD117 antibodies was described. Figure 18B The phage recovery after each round of screening is shown.

[0031] Figures 19A-19B The fourth round of selection is shown. Figure 19A ) and the 5th round of selection ( Figure 19B Cluster enrichment in ). Figure 19C-19E This shows the period between the second and third rounds of selection ( Figure 19C Between the third and fourth rounds of selection ( Figure 19D ) and between the fourth and fifth rounds of selection ( Figure 19E CDR3 enrichment of ).

[0032] Figure 20A The binding of transient cell lines via FACS is shown. Figure 20B Further binding of transient cell lines via FACS is shown. Figure 20C This compilation summarizes the top CD117 antibodies identified through FACS.

[0033] Figure 21A-21X The antibody CD117-2 (shown via FACS) Figure 21A CD117-9 Figure 21B ), CD117-1 ( Figure 21C CD117-7 Figure 21D CD117-3 Figure 21E CD117-5 Figure 21F CD117-21 Figure 21G CD117-10 Figure 21H CD117-17 Figure 21I CD117-15 Figure 21J CD117-13 Figure 21K ), CD117-11 ( Figure 21L CD117-18 Figure 21M ,), CD117-20 ( Figure 21N CD117-19 Figure 21O CD117-14 Figure 21P CD117-12 Figure 21Q CD117-4 Figure 21R CD117-16 Figure 21S CD117-8 Figure 21T CD117-6 Figure 21U ), Control 1 ( Figure 21V ), Control 2 ( Figure 21W ) and control 4 ( Figure 21X ) specific binding. The box diagram represents the functional screening lead compound.

[0034] Figures 22A-22D CD117-2 (shown) Figure 22A CD117-14 Figure 22B CD117-6 Figure 22C ) and CD117-9 ( Figure 22D EC50 results. Figure 22E It summarizes the top results of the EC50.

[0035] Figure 23 The titration curve of stem cell factor (also known as SCF or c-KIT ligand) is shown.

[0036] Figure 24A The titration of the control antibody against a standard 585 pM concentration of SCF is shown. Figure 24B The results of the control group are shown, in which the effects of CD117 and SIGLEC antibodies on EGF signaling were tested.

[0037] Figure 25A ERK activation is shown, with top hits highlighted. Figure 25B A concentration screening chart of the top hits is shown. Figure 25C The MFI binding screening results of the top hits are shown.

[0038] Figure 26A A control titration for ERK activation is shown. Figure 26B A control titration for serum factor response (SRF) signals is shown.

[0039] Figures 27A-27C The top antagonist CD117-6 was shown. Figure 27A CD117-14 Figure 27B ) and CD117-7 ( Figure 27C The SFR signal results. Figure 27D This compilation summarizes the IC50 data for top-tier antagonists.

[0040] Figures 28A-28H It shows the target CD117-131 ( Figure 28A CD117-10 Figure 28B CD117-79 Figure 28C CD117-125 Figure 28D CD117-11 Figure 28E CD117-17 Figure 28F CD117-18 Figure 28G ) and CD117-150 ( Figure 28H ( ) another titration.

[0041] Figures 29A-29B The binding kinetics of the anti-CD117 antibody to CD117 in humans, cynomolgus monkeys, and mice are shown.

[0042] Figure 30 The frequency (A) and number (B) of mCD45+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown from left to right in the bar chart.

[0043] Figure 31 The frequency (A) of mCD3+ cells in mCD45+ mice and the number of mCD3+ cells per milliliter of BALF (B) are shown in the figure. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0044] Figure 32 The frequency (A) of mCD3- cells in mCD45+ and the number of mCD3- cells per milliliter of BALF (B) are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0045] Figure 33 The frequency (A) of mCD3- NK cells and the number of NK cells per milliliter of BALF (B) are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0046] Figure 34The frequency (A) and number (B) of Siglec-F+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0047] Figure 35 Serum IgE (ng / mL) in mice treated with SIGLEC-8 antibody or as a control is shown. The groups listed from top to bottom in the legend are displayed in the bar chart from left to right.

[0048] Figure 36 The frequency (A) of mCD19+ cells in mCD3- and the number of mCD19+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown from left to right in the bar chart.

[0049] Figure 37 The frequency (A) and number (B) of mCD11b+ cells in CD3- cells are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0050] Figure 38 The frequency (A) of macrophages in mCD11b+ cells and the number of macrophages in mCD11b+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right.

[0051] Figure 39 The frequency (A) of mCD11c+ cells in mCD45+ cells and the number of mCD11c+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown from left to right in the bar chart.

[0052] Figure 40 The frequency (A) of macrophages in mCD11c+ cells and the number of macrophages in mCD11c+ cells per milliliter of BALF are shown in mice administered SIGLEC-8 antibody or control. The groups listed from top to bottom in the legend are shown in the bar chart from left to right. Detailed Implementation

[0053] Unless otherwise stated, this disclosure employs conventional molecular biology techniques within the scope of the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0054] Overview This article discloses antibodies or antigen-binding fragments thereof that bind to antigens of interest (e.g., sialic acid-binding Ig-like lectin 8 (SIGLEC-8) and differentiation cluster 117 (CD117)). The antibodies or antigen-binding fragments thereof described herein may be used to treat the diseases or conditions described herein. In some cases, the antibodies or antigen-binding fragments thereof described herein may be used to treat diseases or conditions associated with mast cells or eosinophils.

[0055] Mast cells (MCs) and eosinophils are important cells in the immune system. MCs may be associated with allergic inflammation, during which MC activation may play a role in driving type 2 inflammatory diseases such as eosinophilic asthma, atopic dermatitis, and eosinophilic gastrointestinal disorders. They may also be involved in non-allergic diseases such as inflammatory bowel disease, irritable bowel syndrome, functional dyspepsia, idiopathic pulmonary fibrosis, and chronic obstructive pulmonary disease. In these diseases, mast cells and eosinophils can be activated by inflammatory mediators such as cytokines, Toll-like receptor ligands, and neuropeptides. Upon activation, mast cells and eosinophils release mediators that can attract or activate other immune cells and mediate acute and chronic inflammatory responses such as vasodilation, vasculitis, cardiovascular disease, angiogenesis, plasma extravasation, smooth muscle contraction, sensory nerve stimulation, tissue eosinophilia, epithelial barrier disruption, and cancer (solid tumors and hematologic malignancies).

[0056] Mast cells (MCs) are distributed in all normal human tissues, while eosinophils are commonly found in the gastrointestinal tract, secondary lymphoid tissue and adipose tissue, thymus, mammary glands, and uterus. Despite having different myeloid progenitor cells, MCs and eosinophils share common surface markers such as sialic acid-binding Ig-like lectin 8 (SIGLEC-8) and differentiation cluster 117 (CD117), also known as tyrosine protein kinase KIT and mast cell / stem cell growth factor receptor (SCFR), a receptor tyrosine kinase. This application demonstrates that using antibodies or their antigen-binding fragments as targeted therapies to modulate SIglec-8 and CD117 function allows for the treatment of a variety of immune-related conditions, including cancer. Therefore, this application addresses a significant unmet medical need in the field of diseases related to mast cell and eosinophil biology and their corresponding surface markers.

[0057] definition Throughout this disclosure, various embodiments are presented in a scope format. It should be understood that this scope format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiment. Therefore, unless the context explicitly specifies otherwise, a description of a scope should be considered as having specifically disclosed all possible sub-scopes and individual values ​​within that scope up to one-tenth of the lower limit. For example, a description of scopes such as 1 to 6 should be considered as having specifically disclosed sub-scopes such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and individual values ​​within that scope, such as 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the scope. The upper and lower limits of these intermediate scopes may be independently included in smaller scopes and also covered within this disclosure, subject to any explicitly excluded limits within the stated scope. Where a stated scope includes one or two limits, the scope excluding any one or both of those included limits is also included in this disclosure, unless the context explicitly specifies otherwise.

[0058] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit any embodiments. As used herein, unless the context clearly indicates otherwise, the singular forms “a / an” and “the” are also intended to include the plural forms. It will be further understood that, when used in this specification, the terms “comprises and / or comprising” specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, the term “and / or” includes any and all combinations of one or more associated listed items.

[0059] Unless explicitly stated or obvious from the context, as used herein, the term “about” for values ​​listed in the range shall be understood to mean the stated value plus or minus 10%, or 10% below the lower limit and 10% above the upper limit listed.

[0060] Unless explicitly stated otherwise, as used herein, the term "nucleic acid" encompasses both double-stranded and triple-stranded nucleic acids as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands need not be co-extended (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Unless otherwise stated, nucleic acid sequences are listed in a 5' to 3' orientation when provided. The methods described herein provide for the generation of isolated nucleic acids. The methods described herein also provide for the generation of isolated and purified nucleic acids. The term "nucleic acid" as used in this article may contain at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 or more bases in length. Furthermore, this article provides methods for synthesizing any number of polypeptide segments encoding nucleotide sequences, including sequences encoding nonribosomal peptides (NRPs), sequences encoding nonribosomal peptide synthase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins (such as antibodies), and polypeptide segments from other protein families (including noncoding DNA or RNA, such as regulatory sequences, e.g. promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest). The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene segments, intergenic DNA, loci defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), micronucleolar RNA, ribozymes, complementary DNA (cDNA), which is the DNA representation of mRNA usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. cDNA encoding the genes or gene segments mentioned herein may contain at least one region encoding an exon sequence that does not contain intercalated intron sequences in its genomic equivalent sequence.

[0061] antibody library This document provides methods, compositions, and systems for generating antibodies. The methods, compositions, and systems described herein for optimizing antibodies include ratio-variant methods that reflect the natural diversity of antibody sequences. In some instances, the optimized antibody library contains variant antibody sequences. In some instances, the variant antibody sequences are engineered to contain variant CDR regions. In some instances, variant antibody sequences containing variant CDR regions are generated by recombining natural CDR sequences in a llama, humanized, or chimeric framework. In some instances, such libraries are synthesized, cloned into expression vectors, and the activity of the translational products (antibodies) is evaluated. In some instances, fragments of the synthesized sequences are subsequently assembled. In some instances, the expression vector is used to display and enrich desired antibodies, such as phage display. In some instances, the phage vector is a Fab phageparticle vector. In some instances, the selection pressures used during enrichment include binding affinity, toxicity, immune tolerance, stability, or other factors. Such expression vectors allow for the selection of antibodies with specific properties (“panning”), and subsequent propagation or amplification of such sequences can enrich the library with these sequences. The rinsing rounds can be repeated any number of times, such as 1, 2, 3, 4, 5, 6, 7 rounds or more. In some instances, each rinsing round involves multiple washes. In some instances, each rinsing round involves at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more washes.

[0062] This document describes methods and systems for computer-simulated (in-silico) library design. In some instances, the libraries described herein are designed based on databases containing multiple antibody sequences. In some instances, the database contains multiple variant antibody sequences against various targets. In some instances, the database contains at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some instances, the database contains primary and memory B cell receptor sequences. In some instances, the primary and memory B cell receptor sequences are human, mouse, or primate sequences. In some instances, the primary and memory B cell receptor sequences are human sequences. In some instances, position-specific variations in the database are analyzed. In some instances, the antibodies described herein contain position-specific variations in the CDR region. In some instances, the CDR region contains multiple variant sites.

[0063] This document describes libraries containing variations in the CDR region. In some instances, the CDR is a variable heavy chain CDR1, CDR2, or CDR3. In some instances, the CDR is a variable light chain CDR1, CDR2, or CDR3. In some instances, the library contains multiple variants encoding CDR1, CDR2, or CDR3. In some instances, the library as described herein encodes at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR1 sequences. In some instances, as described herein, the library encodes at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR2 sequences. In some instances, as described herein, the library encodes at least 50, 100, 200, 300, 400, 500, 1000, 1200, 1500, 1700, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 CDR3 sequences. In some instances, a computer-simulated antibody library is synthesized, assembled, and enriched with the desired sequences.

[0064] In some instances, after synthesizing CDR1, CDR2, and CDR3 variants, the CDR1, CDR2, and CDR3 variants are shuffled to generate diverse libraries. In some instances, the diversity of the libraries generated by the methods described herein has at least or about 10. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 or more than 10 18 Theoretical diversity of sequences. In some instances, the library has at least or about 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 1017 10 18 or more than 10 18 The final library diversity of each sequence.

[0065] The phylogenetic sequence corresponding to the variant sequence can also be modified to generate sequences in the library. For example, sequences generated by the methods described herein contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 mutations from the phylogenetic sequence. In some instances, the generated sequences contain no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or no more than 18 mutations from the phylogenetic sequence. In some instances, the generated sequences contain approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or approximately 18 mutations relative to the phylogenetic sequence.

[0066] antibody library This article provides libraries generated by the methods described herein. The antibodies described herein result in improved functional activity, structural stability, expression, specificity, or combinations thereof. In some instances, the antibody is a single-domain antibody. In some instances, the single-domain antibody contains a heavy chain variable domain. In some instances, the single-domain antibody is a VHH antibody.

[0067] As used herein, the term antibody will be understood to include one or more fragments of a protein having the characteristic two-armed Y-shape of a typical antibody molecule and retaining the ability to bind specifically to an antigen. Exemplary antibodies include, but are not limited to, monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplanted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelified antibodies, single-chain Fvs (scFv) (including fragments in which VL and VH are linked by a synthetic or natural linker using a recombinant method, the synthetic or natural linker enabling them to be prepared as a single protein chain in which the VL and VH regions pair to form a monovalent molecule, including single-chain Fab and scFab), single-chain antibodies, Fab fragments (including monovalent fragments containing VL, VH, CL, and CH1 domains), F(ab')2 fragments (including bivalent fragments containing two Fab fragments linked by a disulfide bridge at the hinge region), Fd fragments (including fragments containing VH and CH1 fragments), Fv fragments (including fragments containing the VL and VH domains of the antibody's single arm), and single-domain antibodies (dAb or sdAb). (Including fragments containing VH domains), separate complementarity-determining regions (CDRs), bimeric antibodies (including fragments containing divalent dimers (such as two VL and VH domains that bind to each other and recognize two different antigens), fragments containing only a single monomeric variable domain, disulfide-linked Fvs (sdFv), intracellular antibodies, anti-idiotypic (anti-Id) antibodies, or their ab antigen-binding fragments. In some instances, the libraries disclosed herein contain nucleic acids encoding antibodies, wherein the antibody is an Fv antibody, comprising Fv antibodies consisting of minimal antibody fragments containing complete antigen recognition and antigen-binding sites. In some embodiments, the Fv antibody consists of a dimer of a tightly non-covalently associated heavy chain variable domain and a light chain variable domain, and three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, six hypervariable regions confer antigen-binding specificity to the antibody. In some embodiments, a single variable domain (or half of an Fv containing only three hypervariable regions specific to the antigen, including single-domain antibodies containing a heavy-chain variable domain isolated from camels, such as VHH antibodies or nanobodies) has the ability to recognize and bind to antigens. In some instances, the libraries disclosed herein contain nucleic acids encoding antibodies, wherein the antibody is a single-chain Fv or scFv, comprising antibody fragments containing a VH domain, a VL domain, or both VH and VL domains, wherein both domains are present in a single polypeptide chain. In some embodiments, the Fv polypeptide further includes a polypeptide linker between the VH and VL domains, which allows the scFv to form the desired structure for antigen binding. In some instances, the scFv is linked to an Fc fragment or the VHH is linked to an Fc fragment (including microantibodies).In some instances, antibodies comprise immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, such as molecules containing antigen-binding sites. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1, and IgA 2), or subclass.

[0068] In some implementations, the library contains immunoglobulins adapted to the species of the intended therapeutic target. Typically, these methods involve “mammalianization” and include methods for transferring donor antigen-binding information to a less immunogenic mammalian antibody receptor to generate a useful therapeutic treatment. In some instances, mammals are mice, rats, horses, sheep, cattle, primates (e.g., ， Animals included include chimpanzees, baboons, gorillas, orangutans, monkeys, dogs, cats, pigs, donkeys, rabbits, and humans. In some instances, this paper provides libraries and methods for the feline and canine derivatization of antibodies.

[0069] A “humanized” form of a nonhuman antibody can be a chimeric antibody containing a minimal sequence derived from a nonhuman antibody. A humanized antibody is typically a human antibody (recipient antibody) in which residues from one or more CDRs are replaced by residues from one or more CDRs from a nonhuman antibody (donor antibody). The donor antibody can be any suitable nonhuman antibody, such as mouse, rat, rabbit, chicken, or nonhuman primate antibodies with the desired specificity, affinity, or biological effect. In some instances, selected frame region residues of the recipient antibody are replaced by corresponding frame region residues from the donor antibody. Humanized antibodies may also contain residues not present in either the recipient or donor antibody. In some instances, these modifications are made to further improve antibody performance.

[0070] "Canine derivatization" can include methods for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody receptor to generate a therapeutic agent usable in dogs. In some instances, the canine derivatized form of the non-canine antibody described herein is a chimeric antibody containing a minimal sequence derived from the non-canine antibody. In some instances, the canine-derived antibody is a canine antibody sequence ("receptor" or "acceptor" antibody) in which hypervariable residues of the acceptor are replaced by hypervariable residues from a non-canine species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary camel, shark, non-human primate, human, humanized, recombinant sequence, or engineered sequence with desired properties. In some instances, the frame region (FR) residues of the canine antibody are replaced by corresponding non-canine FR residues. In some instances, the canine-derived antibody contains residues not found in the acceptor antibody or in the donor antibody. In some instances, these modifications are performed to further improve antibody performance. Canine-derived antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of a canine antibody.

[0071] "Feline derivatization" can include methods for transferring non-feline antigen binding information from a donor antibody to a less immunogenic feline antibody receptor to generate a therapeutic agent usable in cats. In some instances, the feline-derived form of the non-feline antibody described herein is a chimeric antibody containing a minimal sequence derived from a non-feline antibody. In some instances, the feline-derived antibody is a feline antibody sequence ("receptor" or "acceptor" antibody) in which hypervariable residues of the acceptor are replaced by hypervariable residues from a non-feline species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary camel, shark, non-human primate, human, humanized, recombinant sequence, or engineered sequence with desired properties. In some instances, frame region (FR) residues of the feline antibody are replaced by corresponding non-feline FR residues. In some instances, the feline-derived antibody contains residues not found in the acceptor antibody or in the donor antibody. In some instances, these modifications are performed to further improve antibody performance. Feline antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of a feline antibody.

[0072] The methods described herein can be used to generate libraries encoding non-immunoglobulins. In some instances, the library contains antibody mimics. Exemplary antibody mimics include, but are not limited to, anticalin, affilin, affinity molecules, affimier, affitin, alpha antibodies, avimer, atrimer, DARPins, fynomer, Kunitz domain-based proteins, monoclonal antibodies, anticalin, knottin, armadillo repeat protein-based proteins, and bicyclic peptides.

[0073] The library of nucleic acids encoding antibodies described herein contains variations in at least one region of the antibody. Exemplary regions of the antibody used for variation include, but are not limited to, complementarity-determining regions (CDRs), variable domains, or constant domains. In some instances, the CDR is CDR1, CDR2, or CDR3. In some instances, the CDR is a heavy domain, including but not limited to CDRH1, CDRH2, and CDRH3. In some instances, the CDR is a light domain, including but not limited to CDRL1, CDRL2, and CDRL3. In some instances, the variable domain is a light chain variable domain (VL) or a heavy chain variable domain (VH). In some instances, CDR1, CDR2, or CDR3 belongs to a light chain variable domain (VL). CDR1, CDR2, or CDR3 of a light chain variable domain (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. CDR1, CDR2, or CDR3 of a heavy chain variable domain (VH) may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some instances, the VL domain contains either a κ or λ chain. In some instances, the constant domain is a light chain constant domain (CL) or a heavy chain constant domain (CH).

[0074] This document provides libraries containing nucleic acids encoding antibodies, wherein the library contains variations in at least one region of the antibody, wherein the region is a CDR region. In some instances, the antibody is a single-domain antibody containing a heavy chain variable domain, such as a VHH antibody. In some instances, the VHH antibody contains variations in one or more CDR regions. In some instances, the VHH library described herein contains at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3. For example, the library contains at least 2000 sequences of CDR1, at least 1200 sequences of CDR2, and at least 1600 sequences of CDR3. In some instances, each sequence is different.

[0075] The libraries described herein may contain CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, or combinations thereof of amino acids of varying lengths at translation. In some instances, the lengths of the amino acids CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, or combinations thereof at translation are at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 amino acids.

[0076] Libraries containing nucleic acids encoding antibodies having variant CDR sequences as described herein contain amino acids of varying lengths at translational time. In some instances, the length of each of these amino acid fragments, or the average length of the synthesized amino acids, can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some instances, the amino acid length is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some instances, the amino acid length is about 22 to about 75 amino acids. In some instances, the antibody contains at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids. In some instances, the library is a VHH library. In some instances, the library is an antibody library.

[0077] As described in this article, the library encoding VHH antibodies contains variant CDR sequences, which are shuffled to generate a library with at least or about 10 CDRs. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 or more than 10 18 Libraries with theoretical diversity of sequences. In some instances, libraries have at least or about 10 sequences. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 or more than 10 18 The final library diversity of each sequence.

[0078] As described herein, libraries encoding antibodies or immunoglobulins contain variant CDR sequences, which are shuffled to generate libraries with at least or about 10 CDRs. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 or more than 10 18 Libraries with theoretical diversity of sequences. In some instances, libraries have at least or about 10 sequences. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 or more than 10 18 The final library diversity of each sequence.

[0079] The methods described herein provide for the synthesis of libraries comprising nucleic acids encoding antibodies or immunoglobulins, wherein each nucleic acid encodes a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences that encode at least a single codon variation, such that a standard translation process generates multiple distinct variants of a single residue in a subsequent protein encoded by the synthesized nucleic acid. In some instances, the antibody library comprises distinct nucleic acids that co-encode variations at multiple positions. In some instances, the variant library comprises sequences encoding at least a single codon variation of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some instances, the variant library comprises sequences encoding variations of multiple codons of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domain. In some instances, the variant library contains sequences of variations encoding multiple codons of frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). Exemplary numbers of codons used for variations include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.

[0080] In some instances, at least one region of the antibody used for mutation originates from the heavy chain V-gene family, the heavy chain D-gene family, the heavy chain J-gene family, the light chain V-gene family, or the light chain J-gene family. In some instances, the light chain V-gene family includes the immunoglobulin κ (IGK) gene or the immunoglobulin λ (IGL) gene. Exemplary regions for antibody mutation include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some instances, the gene is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some instances, the gene is both IGHV1-69 and IGHV3-30. In some instances, the region of the antibody used for mutation is IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some instances, the region of the antibody used for mutation is IGHJ3, IGHJ6, IGHJ, or IGHJ4. In some instances, at least one region of the antibody used for mutation is IGHV1-69, IGHV3-23, IGKV3-20, IGKV1-39, or a combination thereof. In some instances, at least one region of the antibody used for mutation is IGHV1-69 or IGHV3-23. In some instances, at least one region of the antibody used for mutation is IGKV3-20 or IGKV1-39. In some instances, at least one region of the antibody used for mutation is IGHV1-69 and IGKV3-20; in some instances, at least one region of the antibody used for mutation is IGHV1-69 and IGKV1-39. In some instances, at least one region of the antibody used for mutation is IGHV3-23 and IGKV1-39.

[0081] This article provides libraries containing nucleic acids encoding antibodies, wherein the libraries are synthesized using various numbers of fragments. In some instances, the fragments contain CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some instances, the fragments contain frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). In some instances, antibody libraries are synthesized using at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length of each of these nucleic acid fragments, or the average length of the synthesized nucleic acid, can be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some instances, the length is about 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.

[0082] Libraries containing nucleic acids encoding antibodies or immunoglobulins as described herein contain amino acids of varying lengths at translational time. In some instances, the length of each of these amino acid fragments, or the average length of the synthesized amino acids, can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some instances, the amino acid length is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some instances, the amino acid length is about 22 to about 75 amino acids. In some instances, the antibody contains at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0083] Numerous variant sequences for at least one region of the antibody are synthesized de novo using the methods described herein. In some instances, numerous variant sequences are synthesized de novo against CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some instances, numerous variant sequences are synthesized de novo against frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). The number of variant sequences can be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some instances, the number of variant sequences is at least or about 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000 sequences. In some instances, the number of variant sequences is approximately 10 to 500, 25 to 475, 50 to 450, 75 to 425, 100 to 400, 125 to 375, 150 to 350, 175 to 325, 200 to 300, 225 to 375, 250 to 350, or 275 to 325 sequences.

[0084] In some instances, the variant sequence of at least one region of the antibody varies in length or sequence. In some instances, at least one region synthesized de novo is used for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some instances, at least one region synthesized de novo is used for frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). In some instances, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids compared to the wild type. In some instances, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some instances, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids than the wild type. In some instances, the library contains at least or about 10 1 10 2 103 10 4 10 5 10 6 10 7 10 8 10 9 10 10 or more than 10 10 One variant.

[0085] After synthesizing an antibody library, the antibody library can be used for screening and analysis. For example, the displayability and panning of the antibody library can be determined. In some instances, displayability is determined using selectable tags. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other tags or labels known in the art. In some instances, the tags are histidine, multihistidine, myc, hemagglutinin (HA), or FLAG. In some instances, the antibody library is determined by sequencing using various methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electron sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing-by-synthesis. In some instances, the antibody library is displayed on the surface of cells or phages. In some instances, phage display is used to enrich the antibody library with sequences of desired activity.

[0086] In some instances, the functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or combinations thereof, of an antibody library are measured. In some instances, the foldable antibodies within the antibody library are measured. In some instances, the functional activity, structural stability, expression, specificity, folding, or combinations thereof, of regions of an antibody are measured. For example, the functional activity, structural stability, expression, specificity, folding, or combinations thereof, of the VH or VL regions are measured.

[0087] Antibodies or IgG generated by the methods described herein contain improved binding affinity. In some instances, the antibodies contain binding affinity of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM (e.g., K). D In some instances, the antibody contains Kc less than 400 nM, less than 350 nM, less than 300 nM, less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 15 nM, or less than 10 nM.D In some instances, the antibody contains less than 1 nM of K. D In some instances, the antibody contains less than 1.2 nM of K. D In some instances, the antibody contains less than 2 nM of K. D In some instances, the antibody contains less than 5 nM of K. D In some instances, the antibody contains less than 10 nM of K. D In some instances, the antibody contains less than 13.5 nM of K. D In some instances, the antibody contains less than 15 nM of K. D In some instances, the antibody contains less than 20 nM of K. D In some instances, the antibody contains less than 25 nM of K. D In some instances, the antibody contains less than 30 nM of K. D .

[0088] In some instances, the affinity of the antibody or IgG generated by the methods described herein is at least 1.5-fold, 2.0-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, or more than 200-fold improved compared to the comparative antibody. In some instances, the affinity of the antibody or IgG generated by the methods described herein is at least 1.5-fold, 2.0-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, or more than 200-fold improved compared to the comparative antibody. In some instances, the comparative antibody is an antibody with a similar structure, sequence, or antigenic target.

[0089] In some implementations, EC in T cell cytotoxicity assays compared to reference antibody or IgG 50 In contrast, variant antibodies or IgG generated by methods described herein resulted in ECGs in T-cell cytotoxicity assays. 50 Reduced. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG. 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 5-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 8-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 10-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 20-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 25-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 30-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibody or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 The reduction is at least 40-fold. In some implementations, EC in T-cell cytotoxicity assays compared to reference antibodies or IgG... 50 In comparison, variant antibodies or IgG showed lower ECG values ​​in T cell cytotoxicity assays. 50 Reduced by at least 50 times.

[0090] In some instances, the methods described herein result in an increased yield of antibody or IgG. In some instances, the yield is at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more than 80 micrograms (ug). In some instances, the yield is in the range of about 5 to about 80, about 10 to about 75, about 15 to about 60, about 20 to about 50, or about 30 to about 40 micrograms (ug).

[0091] Expression system This article provides libraries containing nucleic acids encoding antibodies with binding domains, wherein these libraries exhibit improved specificity, stability, expression, folding, or downstream activity. In some instances, the libraries described herein are used for screening and analysis.

[0092] This document provides libraries containing nucleic acids encoding antibodies with binding domains, wherein these nucleic acid libraries are used for screening and analysis. In some instances, screening and analysis include in vitro, in vivo, or ex vivo assays. Cells used for screening include primary cells derived from living subjects or cell lines. Cells may be derived from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, those from mice, rabbits, primates, and insects. In some instances, cells used for screening include cell lines including, but not limited to, the Chinese hamster ovary (CHO) cell line, the human embryonic kidney (HEK) cell line, or the young hamster kidney (BHK) cell line. In some instances, the nucleic acid libraries described herein may also be delivered to multicellular organisms. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0093] The nucleic acid libraries described herein can be screened for various pharmacological or pharmacokinetic properties. In some instances, in vitro, in vivo, or ex vivo assays are used to screen the libraries. For example, the screened in vitro pharmacological or pharmacokinetic properties include, but are not limited to, binding affinity, binding specificity, and binding concentration. Exemplary in vivo pharmacological or pharmacokinetic properties screened for the libraries described herein include, but are not limited to, therapeutic efficacy, activity, preclinical toxicity, clinical efficacy, clinical toxicity, immunogenicity, potency, and clinical safety properties.

[0094] This document provides nucleic acid libraries that can be expressed in vectors. Expression vectors used for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors include, but are not limited to, mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 vector, pEF1a-tdTomato vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; yeast expression vectors: pTYB21 and pKLAC2; and insect vectors: pAc5.1 / V5-His A and pDEST8. In some instances, the vector is pcDNA3 or pcDNA3.1.

[0095] This article describes the expression in vectors to generate nucleic acid libraries containing antibody constructs. In some instances, the constructs vary in size. In some instances, the constructs contain at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases. In some instances, the builder contains approximately 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,000 to 5,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4 ... 0 to 6,000, 1,000 to 7,000, 1,000 to 8,000, 1,000 to 9,000, 1,000 to 10,000, 2,000 to 3,000, 2,000 to 4,000, 2,000 to 5,000, 2,000 to 6,000, 2,000 to 7,000, 2,000 to 8,000, 2,000 to 9,000, 2,000 to 10,000, 3,000 to 4,000, 3 ,000 to 5,000, 3,000 to 6,000, 3,000 to 7,000, 3,000 to 8,000, 3,000 to 9,000, 3,000 to 10,000, 4,000 to 5,000, 4,000 to 6,000, 4,000 to 7,000, 4,000 to 8,000, 4,000 to 9,000, 4,000 to 10,000, 5,000 to 6,000, 5,000 to 7,000 00, 5,000 to 8,000, 5,000 to 9,000, 5,000 to 10,000, 6,000 to 7,000, 6,000 to 8,000, 6,000 to 9,000, 6,000 to 10,000, 7,000 to 8,000, 7,000 to 9,000, 7,000 to 10,000, 8,000 to 9,000, 8,000 to 10,000 or 9,000 to 10,000 bases.

[0096] This document provides libraries containing nucleic acids encoding antibodies, wherein these nucleic acid libraries are expressed in cells. In some instances, libraries are synthesized to express reporter genes. Exemplary reporter genes include, but are not limited to, acetylhydroxy acid synthase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue-green fluorescent protein, lemon yellow fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), carmine synthase (NOS), octopus alkaloid synthase (OCS), luciferase, and derivatives thereof. Methods for determining the regulation of reporter genes are well known in the art and include, but are not limited to, fluorescence assays (e.g., fluorescence spectroscopy, fluorescence-activated cell sorting (FACS), fluorescence microscopy) and antibiotic resistance determination.

[0097] Diseases and symptoms This document provides libraries containing nucleic acids encoding antibodies or immunoglobulins that may have therapeutic effects. In some instances, the antibodies or immunoglobulins, upon translation, produce proteins for treating a disease or condition in a subject. Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or conditions, metabolic diseases or conditions, cardiovascular diseases or conditions, immunodeficiency diseases or conditions, respiratory diseases or conditions, pain, digestive diseases or conditions, reproductive diseases or conditions, endocrine diseases or conditions, immune diseases or conditions, autoimmune diseases or conditions, or nervous system diseases or conditions. In some instances, the cancer is a solid tumor or a blood cancer. In some instances, the disease or condition is an immunodeficiency disease. In some instances, the disease or condition is an inflammatory disease. In some instances, the disease or condition is an immune condition (e.g., allergy or asthma). In some instances, the disease or condition is a mast cell disease (e.g., generalized mastocytosis, mast cell activation syndrome, or hereditary alpha-trypsinemia). In some instances, the subject is a mammal. In some instances, the subject is a mouse, rabbit, dog, or human. Subjects treated by the methods described herein may be infants, adults, or children. Pharmaceutical compositions containing antibodies or antibody fragments as described herein may be administered intravenously or subcutaneously.

[0098] In some instances, the disease or condition is associated with SIGLEC-8 dysfunction. In some instances, the disease or condition is associated with abnormal signaling via SIGLEC-8. In some instances, the disease or condition is a mast cell disorder (e.g., generalized mastocytosis, mast cell activation syndrome, or hereditary alpha-trypsinemia). In some instances, the disease or condition is eosinophilic reflux disease (e.g., eosinophilic esophagitis or gastroenteritis). In some instances, the disease or condition is duodenitis. In some instances, the disease or condition is cancer. In some instances, the disease or condition is an immune disorder. In some instances, the disease or condition is an allergy (e.g., nut allergy or allergic conjunctivitis), chronic urticaria (e.g., urticaria), atopic dermatitis, or asthma (e.g., allergic asthma).

[0099] For example, SIGLEC-8 is part of the sialic acid-binding IG-like lectins (siglec) family, which are transmembrane proteins of the CD33-associated receptor group. SIGLEC-8 has two splice variants and can function as an inhibitory immunomodulatory receptor. SIGLEC-8 exhibits fine-tuned specificity for different sialylated and sulfated carbohydrate ligands. SIGLEC-8 is expressed late in development and by immune effector cells such as eosinophils, mast cells, and basophils. SIGLEC-8 may be involved in asthma and allergies. SIGLEC-8 can be expressed by eosinophils and / or basophils from subjects with certain cancers (e.g., chronic eosinophilic leukemia, eosinophilic syndrome, or chronic myeloid leukemia). SIGLEC-8 can also be expressed by bone marrow mast cells from subjects with mastocytosis and / or aplastic anemia.

[0100] For example, CD117 is a transmembrane tyrosine kinase growth factor receptor, a product of c-kit gene expression. CD117 is a receptor for stem cell factor (SCF) and plays a role in early hematopoiesis. CD117 is expressed by mammary epithelial cells, germ cells, melanocytes, myeloid cells, and mast cells. CD117 can be expressed by certain types of cancer, such as, but not limited to, ovarian cancer, seminoma, glioma, glioblastoma, mast cell tumor, melanoma, and gastrointestinal tumors. CD117 may also be associated with chronic urticaria (urticaria), nodular prurigo, severe combined immunodeficiency, or retinopathy (e.g., diabetic retinopathy, retinopathy of prematurity, or wet macular degeneration).

[0101] protein targets This article provides a library containing nucleic acids encoding antibodies or antigen-binding fragments targeting SIGLEC-8. SIGLEC-8 is a transmembrane protein that functions as an inhibitory immunomodulatory receptor.

[0102] This document provides SIGLEC-8 antibodies or immunoglobulins, wherein the SIGLEC-8 antibody or its antigen-binding fragment comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 1-450. In some instances, the antibody or its antigen-binding fragment comprises at least or about 95% sequence identity with any one of SEQ ID NO: 1-450. In some instances, the antibody or its antigen-binding fragment comprises at least or about 97% sequence identity with any one of SEQ ID NO: 1-450. In some instances, the antibody or its antigen-binding fragment comprises at least or about 99% sequence identity with any one of SEQ ID NO: 1-450. In some instances, the antibody or its antigen-binding fragment comprises at least or about 100% sequence identity with any one of SEQ ID NO: 1-450.

[0103] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs: 1-150 and 201-350. In some instances, the antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 95% homology with any one of SEQ ID NOs: 1-150 and 201-350. In some instances, the antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 97% homology with any one of SEQ ID NOs: 1-150 and 201-350. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least or about 99% homology with any one of SEQ ID NO: 1-150 and 201-350. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least or about 100% homology with any one of SEQ ID NO: 1-150 and 201-350. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, 21, 22, or more than 22 amino acids having any one of SEQ ID NO: 1-150 and 201-350.

[0104] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) comprising an amino acid sequence of any one of SEQ ID NO: 1-150 or 201-350, or a functional variant thereof having one or two amino acid substitutions relative to an amino acid sequence of any one of SEQ ID NO: 1-150 or 201-350. As described herein, a “functional variant” of a complementarity-determining region (CDR) refers to a variant of a CDR having one or more amino acid modifications (e.g., amino acid insertions, substitutions, or deletions) relative to the CDR sequence of a variable domain binding to a specific antigen, wherein one or more amino acid modifications to the CDR do not result in ablation of the variable domain’s antigen binding to the specific antigen.

[0105] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises heavy chain CDR1 (HCDR1), which contains at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 1-50. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least or about 95% homology with any one of SEQ ID NO: 1-50. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least or about 97% homology with any one of SEQ ID NO: 1-50. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least or about 99% homology with any one of SEQ ID NO: 1-50. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least or about 100% homology to any one of SEQ ID NO: 1-50. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, or more than 8 amino acids having any one of SEQ ID NO: 1-50.

[0106] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises heavy chain CDR2 (HCDR2) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 51-100. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 95% homology with any one of SEQ ID NO: 51-100. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 97% homology with any one of SEQ ID NO: 51-100. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 99% homology with any one of SEQ ID NO: 51-100. In some instances, the antibody or its antigen-binding fragment comprises HCDR2, which contains at least or about 100% homology to any one of SEQ ID NO: 51-100. In some instances, the antibody or its antigen-binding fragment comprises HCDR2, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more amino acids having any one of SEQ ID NO: 51-100.

[0107] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises a heavy chain CDR3 (HCDR3) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 101-150. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 95% homology with any one of SEQ ID NO: 101-150. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 97% homology with any one of SEQ ID NO: 101-150. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 99% homology with any one of SEQ ID NO: 101-150. In some instances, the antibody or its antigen-binding fragment comprises HCDR3, which contains at least or about 100% homology with any one of SEQ ID NO: 101-150. In some instances, the antibody or its antigen-binding fragment comprises HCDR3, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22 or more amino acids having any one of SEQ ID NO: 101-150.

[0108] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain CDR1 (LCDR1) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 201-250. In some instances, the antibody or its antigen-binding fragment comprises LCDR1 containing at least or about 95% homology with any one of SEQ ID NO: 201-250. In some instances, the antibody or its antigen-binding fragment comprises LCDR1 containing at least or about 97% homology with any one of SEQ ID NO: 201-250. In some instances, the antibody or its antigen-binding fragment comprises HCDR1 containing at least or about 99% homology with any one of SEQ ID NO: 201-250. In some instances, the antibody or its antigen-binding fragment comprises LCDR1, which contains at least or about 100% homology to any one of SEQ ID NO: 201-250. In some instances, the antibody or its antigen-binding fragment comprises LCDR1, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, or more than 8 amino acids having any one of SEQ ID NO: 201-250.

[0109] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain CDR2 (LCDR2) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 251-300. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 95% homology with any one of SEQ ID NO: 251-300. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 97% homology with any one of SEQ ID NO: 251-300. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 99% homology with any one of SEQ ID NO: 251-300. In some instances, the antibody or its antigen-binding fragment comprises LCDR2, which contains at least or about 100% homology to any one of SEQ ID NO: 251-300. In some instances, the antibody or its antigen-binding fragment comprises LCDR2, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more amino acids having any one of SEQ ID NO: 251-300.

[0110] In some embodiments, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain CDR3 (LCDR3) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 301-350. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 95% homology with any one of SEQ ID NO: 301-350. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 97% homology with any one of SEQ ID NO: 301-350. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 99% homology with any one of SEQ ID NO: 301-350. In some instances, the antibody or its antigen-binding fragment comprises LCDR3, which contains at least or about 100% homology to any one of SEQ ID NO: 301-350. In some instances, the antibody or its antigen-binding fragment comprises LCDR3, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22 or more amino acids having any one of SEQ ID NO: 301-350.

[0111] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 1, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 1; HCDR2 comprising the amino acid sequence of SEQ ID NO: 51, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 51; HCDR3 comprising the amino acid sequence of SEQ ID NO: 101, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 101; LCDR1 comprising the amino acid sequence of SEQ ID NO: 201, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 201; LCDR2 comprising the amino acid sequence of SEQ ID NO: 251, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 251; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 301, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 301.

[0112] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO:2, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:2; HCDR2 comprising the amino acid sequence of SEQ ID NO:52, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:52; HCDR3 comprising the amino acid sequence of SEQ ID NO:102, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:102; LCDR1 comprising the amino acid sequence of SEQ ID NO:202, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:202; LCDR2 comprising the amino acid sequence of SEQ ID NO:252, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:252; and LCDR3 comprising the amino acid sequence of SEQ ID NO:302, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:302.

[0113] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO:3, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:3; HCDR2 comprising the amino acid sequence of SEQ ID NO:53, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:53; HCDR3 comprising the amino acid sequence of SEQ ID NO:103, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:103; LCDR1 comprising the amino acid sequence of SEQ ID NO:203, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:203; LCDR2 comprising the amino acid sequence of SEQ ID NO:253, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:253; and LCDR3 comprising the amino acid sequence of SEQ ID NO:303, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:303.

[0114] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO:4, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:4; HCDR2 comprising the amino acid sequence of SEQ ID NO:54, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:54; HCDR3 comprising the amino acid sequence of SEQ ID NO:104, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:104; LCDR1 comprising the amino acid sequence of SEQ ID NO:204, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:204; LCDR2 comprising the amino acid sequence of SEQ ID NO:254, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:254; and LCDR3 comprising the amino acid sequence of SEQ ID NO:304, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:304.

[0115] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 5, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 5; HCDR2 comprising the amino acid sequence of SEQ ID NO: 55, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 55; HCDR3 comprising the amino acid sequence of SEQ ID NO: 105, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 105; LCDR1 comprising the amino acid sequence of SEQ ID NO: 205, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 205; LCDR2 comprising the amino acid sequence of SEQ ID NO: 255, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 255; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 305, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 305.

[0116] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 6, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 6; HCDR2 comprising the amino acid sequence of SEQ ID NO: 56, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 56; HCDR3 comprising the amino acid sequence of SEQ ID NO: 106, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 106; LCDR1 comprising the amino acid sequence of SEQ ID NO: 206, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 206; LCDR2 comprising the amino acid sequence of SEQ ID NO: 256, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 256; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 306, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 306.

[0117] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 7, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 7; HCDR2 comprising the amino acid sequence of SEQ ID NO: 57, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 57; HCDR3 comprising the amino acid sequence of SEQ ID NO: 107, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 107; LCDR1 comprising the amino acid sequence of SEQ ID NO: 207, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 207; LCDR2 comprising the amino acid sequence of SEQ ID NO: 257, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 257; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 307, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 307.

[0118] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 8; HCDR2 comprising the amino acid sequence of SEQ ID NO: 58, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 58; HCDR3 comprising the amino acid sequence of SEQ ID NO: 108, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 108; LCDR1 comprising the amino acid sequence of SEQ ID NO: 208, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 208; LCDR2 comprising the amino acid sequence of SEQ ID NO: 258, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 258; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 308, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 308.

[0119] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 9, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 9; HCDR2 comprising the amino acid sequence of SEQ ID NO: 59, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 59; HCDR3 comprising the amino acid sequence of SEQ ID NO: 109, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 109; LCDR1 comprising the amino acid sequence of SEQ ID NO: 209, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 209; LCDR2 comprising the amino acid sequence of SEQ ID NO: 259, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 259; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 309, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 309.

[0120] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 10, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 10; HCDR2 comprising the amino acid sequence of SEQ ID NO: 60, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 60; HCDR3 comprising the amino acid sequence of SEQ ID NO: 110, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 110; LCDR1 comprising the amino acid sequence of SEQ ID NO: 210, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 210; LCDR2 comprising the amino acid sequence of SEQ ID NO: 260, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 260; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 310, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 310. The amino acid sequence of 310 has functional variants with one or two amino acid substitutions.

[0121] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 11, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 11; HCDR2 comprising the amino acid sequence of SEQ ID NO: 61, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 61; HCDR3 comprising the amino acid sequence of SEQ ID NO: 111, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 111; LCDR1 comprising the amino acid sequence of SEQ ID NO: 211, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 211; LCDR2 comprising the amino acid sequence of SEQ ID NO: 261, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 261; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 311, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 311. The amino acid sequence of 311 has functional variants with one or two amino acid substitutions.

[0122] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 12, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 12; HCDR2 comprising the amino acid sequence of SEQ ID NO: 62, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 62; HCDR3 comprising the amino acid sequence of SEQ ID NO: 112, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 112; LCDR1 comprising the amino acid sequence of SEQ ID NO: 212, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 212; LCDR2 comprising the amino acid sequence of SEQ ID NO: 262, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 262; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 312, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 312. The amino acid sequence of 312 has functional variants with one or two amino acid substitutions.

[0123] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 13, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 13; HCDR2 comprising the amino acid sequence of SEQ ID NO: 63, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 63; HCDR3 comprising the amino acid sequence of SEQ ID NO: 113, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 113; LCDR1 comprising the amino acid sequence of SEQ ID NO: 213, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 213; LCDR2 comprising the amino acid sequence of SEQ ID NO: 263, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 263; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 313, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 313. The amino acid sequence of 313 has functional variants with one or two amino acid substitutions.

[0124] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 14, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 14; HCDR2 comprising the amino acid sequence of SEQ ID NO: 64, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 64; HCDR3 comprising the amino acid sequence of SEQ ID NO: 114, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 114; LCDR1 comprising the amino acid sequence of SEQ ID NO: 214, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 214; LCDR2 comprising the amino acid sequence of SEQ ID NO: 264, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 264; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 314, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 314. The amino acid sequence of 314 has functional variants with one or two amino acid substitutions.

[0125] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 15, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 15; HCDR2 comprising the amino acid sequence of SEQ ID NO: 65, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 65; HCDR3 comprising the amino acid sequence of SEQ ID NO: 115, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 115; LCDR1 comprising the amino acid sequence of SEQ ID NO: 215, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 215; LCDR2 comprising the amino acid sequence of SEQ ID NO: 265, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 265; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 315, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 315. The amino acid sequence of 315 has functional variants with one or two amino acid substitutions.

[0126] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 16, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 16; HCDR2 comprising the amino acid sequence of SEQ ID NO: 66, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 66; HCDR3 comprising the amino acid sequence of SEQ ID NO: 116, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 116; LCDR1 comprising the amino acid sequence of SEQ ID NO: 216, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 216; LCDR2 comprising the amino acid sequence of SEQ ID NO: 266, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 266; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 316, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 316. The amino acid sequence of 316 has functional variants with one or two amino acid substitutions.

[0127] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 17, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 17; HCDR2 comprising the amino acid sequence of SEQ ID NO: 67, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 67; HCDR3 comprising the amino acid sequence of SEQ ID NO: 117, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 117; LCDR1 comprising the amino acid sequence of SEQ ID NO: 217, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 217; LCDR2 comprising the amino acid sequence of SEQ ID NO: 267, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 267; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 317, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 317. The amino acid sequence of 317 has functional variants with one or two amino acid substitutions.

[0128] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 18, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 18; HCDR2 comprising the amino acid sequence of SEQ ID NO: 68, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 68; HCDR3 comprising the amino acid sequence of SEQ ID NO: 118, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 118; LCDR1 comprising the amino acid sequence of SEQ ID NO: 218, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 218; LCDR2 comprising the amino acid sequence of SEQ ID NO: 268, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 268; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 318, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 318. The amino acid sequence of 318 has functional variants with one or two amino acid substitutions.

[0129] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 19, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 19; HCDR2 comprising the amino acid sequence of SEQ ID NO: 69, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 69; HCDR3 comprising the amino acid sequence of SEQ ID NO: 119, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 119; LCDR1 comprising the amino acid sequence of SEQ ID NO: 219, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 219; LCDR2 comprising the amino acid sequence of SEQ ID NO: 269, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 269; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 319, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 319. The amino acid sequence of 319 has functional variants with one or two amino acid substitutions.

[0130] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 20; HCDR2 comprising the amino acid sequence of SEQ ID NO: 70, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 70; HCDR3 comprising the amino acid sequence of SEQ ID NO: 120, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 120; LCDR1 comprising the amino acid sequence of SEQ ID NO: 220, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 220; LCDR2 comprising the amino acid sequence of SEQ ID NO: 270, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 270; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 320, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 270; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 320, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 320. The amino acid sequence of 320 has functional variants with one or two amino acid substitutions.

[0131] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 21, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 21; HCDR2 comprising the amino acid sequence of SEQ ID NO: 71, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 71; HCDR3 comprising the amino acid sequence of SEQ ID NO: 121, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 121; LCDR1 comprising the amino acid sequence of SEQ ID NO: 221, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 221; LCDR2 comprising the amino acid sequence of SEQ ID NO: 271, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 271; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 321, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 271; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 321, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 271. The amino acid sequence of 321 has functional variants with one or two amino acid substitutions.

[0132] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 22, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 22; HCDR2 comprising the amino acid sequence of SEQ ID NO: 72, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 72; HCDR3 comprising the amino acid sequence of SEQ ID NO: 122, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 122; LCDR1 comprising the amino acid sequence of SEQ ID NO: 222, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 222; LCDR2 comprising the amino acid sequence of SEQ ID NO: 272, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 272; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 322, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 272; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 322, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 322. The amino acid sequence of 322 has functional variants with one or two amino acid substitutions.

[0133] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 23, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 23; HCDR2 comprising the amino acid sequence of SEQ ID NO: 73, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 73; HCDR3 comprising the amino acid sequence of SEQ ID NO: 123, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 123; LCDR1 comprising the amino acid sequence of SEQ ID NO: 223, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 223; LCDR2 comprising the amino acid sequence of SEQ ID NO: 273, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 273; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 32 ...323; and LCDR2 comprising the amino acid sequence of SEQ ID NO: 323, or an functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 323; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 323, or an functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: The amino acid sequence of 323 has functional variants with one or two amino acid substitutions.

[0134] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 24, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 24; HCDR2 comprising the amino acid sequence of SEQ ID NO: 74, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 74; HCDR3 comprising the amino acid sequence of SEQ ID NO: 124, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 124; LCDR1 comprising the amino acid sequence of SEQ ID NO: 224, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 224; LCDR2 comprising the amino acid sequence of SEQ ID NO: 274, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 274; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 324, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 274; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 324, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 324. The amino acid sequence of 324 has functional variants with one or two amino acid substitutions.

[0135] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 25, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 25; HCDR2 comprising the amino acid sequence of SEQ ID NO: 75, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 75; HCDR3 comprising the amino acid sequence of SEQ ID NO: 125, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 125; LCDR1 comprising the amino acid sequence of SEQ ID NO: 225, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 225; LCDR2 comprising the amino acid sequence of SEQ ID NO: 275, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 275; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 325, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 325. The amino acid sequence of 325 has functional variants with one or two amino acid substitutions.

[0136] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 26, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 26; HCDR2 comprising the amino acid sequence of SEQ ID NO: 76, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 76; HCDR3 comprising the amino acid sequence of SEQ ID NO: 126, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 126; LCDR1 comprising the amino acid sequence of SEQ ID NO: 226, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 226; LCDR2 comprising the amino acid sequence of SEQ ID NO: 276, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 276; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 326, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 276; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 326, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 326. The amino acid sequence of 326 has functional variants with one or two amino acid substitutions.

[0137] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 27, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 27; HCDR2 comprising the amino acid sequence of SEQ ID NO: 77, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 77; HCDR3 comprising the amino acid sequence of SEQ ID NO: 127, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 127; LCDR1 comprising the amino acid sequence of SEQ ID NO: 227, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 227; LCDR2 comprising the amino acid sequence of SEQ ID NO: 277, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 277; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 327, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 327. The amino acid sequence of 327 has functional variants with one or two amino acid substitutions.

[0138] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 28, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 28; HCDR2 comprising the amino acid sequence of SEQ ID NO: 78, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 78; HCDR3 comprising the amino acid sequence of SEQ ID NO: 128, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 128; LCDR1 comprising the amino acid sequence of SEQ ID NO: 228, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 228; LCDR2 comprising the amino acid sequence of SEQ ID NO: 278, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 278; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 328, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 328. The amino acid sequence of 328 has functional variants with one or two amino acid substitutions.

[0139] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 29, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 29; HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 79; HCDR3 comprising the amino acid sequence of SEQ ID NO: 129, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 129; LCDR1 comprising the amino acid sequence of SEQ ID NO: 229, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 229; LCDR2 comprising the amino acid sequence of SEQ ID NO: 279, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 279; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 329, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 329. The amino acid sequence of 329 has a functional variant with one or two amino acid substitutions.

[0140] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 30, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 30; HCDR2 comprising the amino acid sequence of SEQ ID NO: 80, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 80; HCDR3 comprising the amino acid sequence of SEQ ID NO: 130, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 130; LCDR1 comprising the amino acid sequence of SEQ ID NO: 230, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 230; LCDR2 comprising the amino acid sequence of SEQ ID NO: 280, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 280; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 330, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 330. The amino acid sequence of 330 has functional variants with one or two amino acid substitutions.

[0141] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 31, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 31; HCDR2 comprising the amino acid sequence of SEQ ID NO: 81, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 81; HCDR3 comprising the amino acid sequence of SEQ ID NO: 131, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 131; LCDR1 comprising the amino acid sequence of SEQ ID NO: 231, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 231; LCDR2 comprising the amino acid sequence of SEQ ID NO: 281, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 281; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 331, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 331. The amino acid sequence of 331 has functional variants with one or two amino acid substitutions.

[0142] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 32; HCDR2 comprising the amino acid sequence of SEQ ID NO: 82, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 82; HCDR3 comprising the amino acid sequence of SEQ ID NO: 132, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 132; LCDR1 comprising the amino acid sequence of SEQ ID NO: 232, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 232; LCDR2 comprising the amino acid sequence of SEQ ID NO: 282, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 282; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 332, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 332. The amino acid sequence of 332 has functional variants with one or two amino acid substitutions.

[0143] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 33, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 33; HCDR2 comprising the amino acid sequence of SEQ ID NO: 83, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 83; HCDR3 comprising the amino acid sequence of SEQ ID NO: 133, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 133; LCDR1 comprising the amino acid sequence of SEQ ID NO: 233, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 233; LCDR2 comprising the amino acid sequence of SEQ ID NO: 283, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 283; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 333, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 333. The amino acid sequence of 333 has functional variants with one or two amino acid substitutions.

[0144] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 34, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 34; HCDR2 comprising the amino acid sequence of SEQ ID NO: 84, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 84; HCDR3 comprising the amino acid sequence of SEQ ID NO: 134, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 134; LCDR1 comprising the amino acid sequence of SEQ ID NO: 234, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 234; LCDR2 comprising the amino acid sequence of SEQ ID NO: 284, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 284; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 334, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 334. The amino acid sequence of 334 has functional variants with one or two amino acid substitutions.

[0145] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 35, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 35; HCDR2 comprising the amino acid sequence of SEQ ID NO: 85, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 85; HCDR3 comprising the amino acid sequence of SEQ ID NO: 135, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 135; LCDR1 comprising the amino acid sequence of SEQ ID NO: 235, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 235; LCDR2 comprising the amino acid sequence of SEQ ID NO: 285, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 285; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 335, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 335. The amino acid sequence of 335 has functional variants with one or two amino acid substitutions.

[0146] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 36, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 36; HCDR2 comprising the amino acid sequence of SEQ ID NO: 86, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 86; HCDR3 comprising the amino acid sequence of SEQ ID NO: 136, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 136; LCDR1 comprising the amino acid sequence of SEQ ID NO: 236, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 236; LCDR2 comprising the amino acid sequence of SEQ ID NO: 286, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 286; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 336, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 336. The amino acid sequence of 336 has functional variants with one or two amino acid substitutions.

[0147] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 37; HCDR2 comprising the amino acid sequence of SEQ ID NO: 87, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 87; HCDR3 comprising the amino acid sequence of SEQ ID NO: 137, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 137; LCDR1 comprising the amino acid sequence of SEQ ID NO: 237, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 237; LCDR2 comprising the amino acid sequence of SEQ ID NO: 287, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 287; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 337, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 337. The amino acid sequence of 337 has functional variants with one or two amino acid substitutions.

[0148] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 38, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 38; HCDR2 comprising the amino acid sequence of SEQ ID NO: 88, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 88; HCDR3 comprising the amino acid sequence of SEQ ID NO: 138, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 138; LCDR1 comprising the amino acid sequence of SEQ ID NO: 238, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 238; LCDR2 comprising the amino acid sequence of SEQ ID NO: 288, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 288; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 338, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 338. The amino acid sequence of 338 has functional variants with one or two amino acid substitutions.

[0149] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 39, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 39; HCDR2 comprising the amino acid sequence of SEQ ID NO: 89, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 89; HCDR3 comprising the amino acid sequence of SEQ ID NO: 139, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 139; LCDR1 comprising the amino acid sequence of SEQ ID NO: 239, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 239; LCDR2 comprising the amino acid sequence of SEQ ID NO: 289, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 289; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 339, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 339. The amino acid sequence of 339 has functional variants with one or two amino acid substitutions.

[0150] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 40, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 40; HCDR2 comprising the amino acid sequence of SEQ ID NO: 90, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 90; HCDR3 comprising the amino acid sequence of SEQ ID NO: 140, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 140; LCDR1 comprising the amino acid sequence of SEQ ID NO: 240, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 240; LCDR2 comprising the amino acid sequence of SEQ ID NO: 290, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 290; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 340, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 340. The amino acid sequence of 340 has functional variants with one or two amino acid substitutions.

[0151] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 41, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 41; HCDR2 comprising the amino acid sequence of SEQ ID NO: 91, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 91; HCDR3 comprising the amino acid sequence of SEQ ID NO: 141, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 141; LCDR1 comprising the amino acid sequence of SEQ ID NO: 241; LCDR2 comprising the amino acid sequence of SEQ ID NO: 291, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 291; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 341, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 341.

[0152] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 42; HCDR2 comprising the amino acid sequence of SEQ ID NO: 92, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 92; HCDR3 comprising the amino acid sequence of SEQ ID NO: 142, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 142; LCDR1 comprising the amino acid sequence of SEQ ID NO: 242, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 242; LCDR2 comprising the amino acid sequence of SEQ ID NO: 292, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 292; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 342, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 342. The amino acid sequence of 342 has functional variants with one or two amino acid substitutions.

[0153] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 43, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 43; HCDR2 comprising the amino acid sequence of SEQ ID NO: 93, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 93; HCDR3 comprising the amino acid sequence of SEQ ID NO: 143, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 143; LCDR1 comprising the amino acid sequence of SEQ ID NO: 243, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 243; LCDR2 comprising the amino acid sequence of SEQ ID NO: 293, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 293; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 343, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 343. The amino acid sequence of 343 has functional variants with one or two amino acid substitutions.

[0154] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 44, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 44; HCDR2 comprising the amino acid sequence of SEQ ID NO: 94, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 94; HCDR3 comprising the amino acid sequence of SEQ ID NO: 144, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 144; LCDR1 comprising the amino acid sequence of SEQ ID NO: 244, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 244; LCDR2 comprising the amino acid sequence of SEQ ID NO: 294, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 294; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 344, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 344. The amino acid sequence of 344 has functional variants with one or two amino acid substitutions.

[0155] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 45, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 45; HCDR2 comprising the amino acid sequence of SEQ ID NO: 95, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 95; HCDR3 comprising the amino acid sequence of SEQ ID NO: 145, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 145; LCDR1 comprising the amino acid sequence of SEQ ID NO: 245, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 245; LCDR2 comprising the amino acid sequence of SEQ ID NO: 295, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 295; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 345, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 345. The amino acid sequence of 345 has functional variants with one or two amino acid substitutions.

[0156] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 46, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 46; HCDR2 comprising the amino acid sequence of SEQ ID NO: 96, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 96; HCDR3 comprising the amino acid sequence of SEQ ID NO: 146, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 146; LCDR1 comprising the amino acid sequence of SEQ ID NO: 246, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 246; LCDR2 comprising the amino acid sequence of SEQ ID NO: 296, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 296; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 346, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 346. The amino acid sequence of 346 has functional variants with one or two amino acid substitutions.

[0157] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 47; HCDR2 comprising the amino acid sequence of SEQ ID NO: 97, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 97; HCDR3 comprising the amino acid sequence of SEQ ID NO: 147, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 147; LCDR1 comprising the amino acid sequence of SEQ ID NO: 247, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 247; LCDR2 comprising the amino acid sequence of SEQ ID NO: 297, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 297; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 347, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 347. The amino acid sequence of 347 has functional variants with one or two amino acid substitutions.

[0158] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 48, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 48; HCDR2 comprising the amino acid sequence of SEQ ID NO: 98, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 98; HCDR3 comprising the amino acid sequence of SEQ ID NO: 148, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 148; LCDR1 comprising the amino acid sequence of SEQ ID NO: 248, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 248; LCDR2 comprising the amino acid sequence of SEQ ID NO: 298, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 298; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 348, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 348. The amino acid sequence of 348 has functional variants with one or two amino acid substitutions.

[0159] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 49, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 49; HCDR2 comprising the amino acid sequence of SEQ ID NO: 99, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 99; HCDR3 comprising the amino acid sequence of SEQ ID NO: 149, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 149; LCDR1 comprising the amino acid sequence of SEQ ID NO: 249, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 249; LCDR2 comprising the amino acid sequence of SEQ ID NO: 299, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 299; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 349, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 349. The amino acid sequence of 349 has functional variants with one or two amino acid substitutions.

[0160] In some embodiments, the SIGLEC-8 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 50, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 50; HCDR2 comprising the amino acid sequence of SEQ ID NO: 100, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 100; HCDR3 comprising the amino acid sequence of SEQ ID NO: 150, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 150; LCDR1 comprising the amino acid sequence of SEQ ID NO: 250, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 250; LCDR2 comprising the amino acid sequence of SEQ ID NO: 300, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 300; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 350, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 350. The amino acid sequence of 350 has functional variants with one or two amino acid substitutions.

[0161] In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a heavy chain variable domain containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 151-200. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a heavy chain variable domain containing at least or about 95% sequence identity with any one of SEQ ID NO: 151-200. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a heavy chain variable domain containing at least or about 97% sequence identity with any one of SEQ ID NO: 151-200. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 99% sequence identity with any one of SEQ ID NO: 151-200. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 100% sequence identity with any one of SEQ ID NO: 151-200. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a heavy chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more of 150 amino acids having any one of SEQ ID NO: 151-200.

[0162] In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 351-400. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 95% sequence identity with any one of SEQ ID NO: 351-400. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 97% sequence identity with any one of SEQ ID NO: 351-400. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain that has at least or about 99% sequence identity with any one of SEQ ID NO: 351-400. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain that has at least or about 100% sequence identity with any one of SEQ ID NO: 351-400. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a light chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more of 150 amino acids having any one of SEQ ID NO: 351-400.

[0163] In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 401-450. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 95% sequence identity with any one of SEQ ID NO: 401-450. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 97% sequence identity with any one of SEQ ID NO: 401-450. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence that contains at least or about 99% sequence identity with any one of SEQ ID NO: 401-450. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence that contains at least or about 100% sequence identity with any one of SEQ ID NO: 401-450. In some instances, the SIGLEC-8 antibody or its antigen-binding fragment comprises a VH-VL sequence having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250 or more of the amino acids listed in SEQ ID NO: 401-450.

[0164] This article provides a library of nucleic acids encoding antibodies or immunoglobulins targeting CD117 (also known as KIT proto-oncogene receptor tyrosine kinase or mast cell / stem cell growth factor receptor (SCFR)). CD117 is a cytokine receptor protein that binds to stem cell factors to form a dimer to activate signal transduction molecules that propagate SCF signals into the cell. Signal transduction via CD117 plays a role in cell survival, proliferation, and differentiation.

[0165] This document provides CD117 antibodies or immunoglobulins, wherein the CD117 antibody or immunoglobulin comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 451-639. In some instances, the antibody or antigen-binding fragment thereof comprises at least or about 95% sequence identity with any of SEQ ID NO: 451-639. In some instances, the antibody or antigen-binding fragment thereof comprises at least or about 97% sequence identity with any of SEQ ID NO: 451-639. In some instances, the antibody or antigen-binding fragment thereof comprises at least or about 99% sequence identity with any of SEQ ID NO: 451-639. In some instances, the antibody or its antigen-binding fragment contains at least or about 100% sequence identity with any of SEQ ID NO: 451-639.

[0166] In some embodiments, the CD117 antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs: 451-513 and 535-597. In some instances, the antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 95% homology with any one of SEQ ID NOs: 451-513 and 535-597. In some instances, the antibody or its antigen-binding fragment includes complementarity-determining regions (CDRs) containing at least or about 97% homology with any one of SEQ ID NOs: 451-513 and 535-597. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least or about 99% homology with any one of SEQ ID NO: 451-513 and 535-597. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least or about 100% homology with any one of SEQ ID NO: 451-513 and 535-597. In some instances, the antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) having at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, 21, 22, or more than 22 amino acids having any one of SEQ ID NO: 451-513 and 535-597.

[0167] In some embodiments, the CD117-binding antibody or its antigen-binding fragment includes a complementarity-determining region (CDR) comprising an amino acid sequence of any one of SEQ ID NO: 1-150 or 201-350, or a functional variant thereof having one or two amino acid substitutions relative to an amino acid sequence of any one of SEQ ID NO: 1-150 or 201-350. As described herein, a “functional variant” of a complementarity-determining region (CDR) refers to a variant of a CDR having one or more amino acid modifications (e.g., amino acid insertions, substitutions, or deletions) relative to the CDR sequence of a variable domain binding to a specific antigen, wherein one or more amino acid modifications to the CDR do not result in ablation of the variable domain’s antigen binding to the specific antigen.

[0168] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises heavy chain CDR1 (HCDR1) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 451-471. In some instances, the antibody or its antigen-binding fragment comprises HCDR1 containing at least or about 95% homology with any one of SEQ ID NO: 451-471. In some instances, the antibody or its antigen-binding fragment comprises HCDR1 containing at least or about 97% homology with any one of SEQ ID NO: 451-471. In some instances, the antibody or its antigen-binding fragment comprises HCDR1 containing at least or about 99% homology with any one of SEQ ID NO: 451-471. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least or about 100% homology to any one of SEQ ID NO: 451-471. In some instances, the antibody or its antigen-binding fragment comprises HCDR1, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, or more than 8 amino acids having any one of SEQ ID NO: 451-471.

[0169] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises heavy chain CDR2 (HCDR2) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 472-492. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 95% homology with any one of SEQ ID NO: 472-492. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 97% homology with any one of SEQ ID NO: 472-492. In some instances, the antibody or its antigen-binding fragment comprises HCDR2 containing at least or about 99% homology with any one of SEQ ID NO: 472-492. In some instances, the antibody or its antigen-binding fragment comprises HCDR2, which contains at least or about 100% homology to any one of SEQ ID NO: 472-492. In some instances, the antibody or its antigen-binding fragment comprises HCDR2, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more amino acids having any one of SEQ ID NO: 472-492.

[0170] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises heavy chain CDR3 (HCDR3) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 493-513. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 95% homology with any one of SEQ ID NO: 493-513. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 97% homology with any one of SEQ ID NO: 493-513. In some instances, the antibody or its antigen-binding fragment comprises HCDR3 containing at least or about 99% homology with any one of SEQ ID NO: 493-513. In some instances, the antibody or its antigen-binding fragment comprises HCDR3, which contains at least or about 100% homology with any one of SEQ ID NO: 493-513. In some instances, the antibody or its antigen-binding fragment comprises HCDR3, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22 or more amino acids having any one of SEQ ID NO: 493-513.

[0171] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises a light chain CDR1 (LCDR1) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 535-555. In some instances, the antibody or its antigen-binding fragment comprises LCDR1 containing at least or about 95% homology with any one of SEQ ID NO: 535-555. In some instances, the antibody or its antigen-binding fragment comprises LCDR1 containing at least or about 97% homology with any one of SEQ ID NO: 535-555. In some instances, the antibody or its antigen-binding fragment comprises HCDR1 containing at least or about 99% homology with any one of SEQ ID NO: 535-555. In some instances, the antibody or its antigen-binding fragment comprises LCDR1, which contains at least or about 100% homology to any one of SEQ ID NO: 535-555. In some instances, the antibody or its antigen-binding fragment comprises LCDR1, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, or more than 8 amino acids having any one of SEQ ID NO: 535-555.

[0172] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises a light chain CDR2 (LCDR2) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 556-576. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 95% homology with any one of SEQ ID NO: 556-576. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 97% homology with any one of SEQ ID NO: 556-576. In some instances, the antibody or its antigen-binding fragment comprises LCDR2 containing at least or about 99% homology with any one of SEQ ID NO: 556-576. In some instances, the antibody or its antigen-binding fragment comprises LCDR2, which contains at least or about 100% homology to any one of SEQ ID NO: 556-576. In some instances, the antibody or its antigen-binding fragment comprises LCDR2, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more amino acids having any one of SEQ ID NO: 556-576.

[0173] In some embodiments, the CD117 antibody or its antigen-binding fragment comprises a light chain CDR3 (LCDR3) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 577-597. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 95% homology with any one of SEQ ID NO: 577-597. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 97% homology with any one of SEQ ID NO: 577-597. In some instances, the antibody or its antigen-binding fragment comprises LCDR3 containing at least or about 99% homology with any one of SEQ ID NO: 577-597. In some instances, the antibody or its antigen-binding fragment comprises LCDR3, which contains at least or about 100% homology to any one of SEQ ID NO: 577-597. In some instances, the antibody or its antigen-binding fragment comprises LCDR3, which contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22 or more amino acids having any one of SEQ ID NO: 577-597.

[0174] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 451, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 451; HCDR2 comprising the amino acid sequence of SEQ ID NO: 472, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 472; HCDR3 comprising the amino acid sequence of SEQ ID NO: 493, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 493; LCDR1 comprising the amino acid sequence of SEQ ID NO: 535, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 535; LCDR2 comprising the amino acid sequence of SEQ ID NO: 556, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 556; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 577, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 577. The amino acid sequence of 577 has functional variants with one or two amino acid substitutions.

[0175] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 452, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 452; HCDR2 comprising the amino acid sequence of SEQ ID NO: 473, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 473; HCDR3 comprising the amino acid sequence of SEQ ID NO: 494, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 494; LCDR1 comprising the amino acid sequence of SEQ ID NO: 536, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 536; LCDR2 comprising the amino acid sequence of SEQ ID NO: 557, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 557; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 578, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 557. The amino acid sequence of 578 has functional variants with one or two amino acid substitutions.

[0176] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 453, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 453; HCDR2 comprising the amino acid sequence of SEQ ID NO: 474, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 474; HCDR3 comprising the amino acid sequence of SEQ ID NO: 495, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 495; LCDR1 comprising the amino acid sequence of SEQ ID NO: 537, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 537; LCDR2 comprising the amino acid sequence of SEQ ID NO: 558, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 558; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 579, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 579. The amino acid sequence of 579 has functional variants with one or two amino acid substitutions.

[0177] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 454, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 454; HCDR2 comprising the amino acid sequence of SEQ ID NO: 475, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 475; HCDR3 comprising the amino acid sequence of SEQ ID NO: 496, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 496; LCDR1 comprising the amino acid sequence of SEQ ID NO: 538, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 538; LCDR2 comprising the amino acid sequence of SEQ ID NO: 559, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 559; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 580, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 580. The amino acid sequence of 580 has functional variants with one or two amino acid substitutions.

[0178] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 455, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 455; HCDR2 comprising the amino acid sequence of SEQ ID NO: 476, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 476; HCDR3 comprising the amino acid sequence of SEQ ID NO: 497, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 497; LCDR1 comprising the amino acid sequence of SEQ ID NO: 539, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 539; LCDR2 comprising the amino acid sequence of SEQ ID NO: 560, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 560; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 581, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 581. The amino acid sequence of 581 has functional variants with one or two amino acid substitutions.

[0179] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 456, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 456; HCDR2 comprising the amino acid sequence of SEQ ID NO: 477, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 477; HCDR3 comprising the amino acid sequence of SEQ ID NO: 498, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 498; LCDR1 comprising the amino acid sequence of SEQ ID NO: 540, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 540; LCDR2 comprising the amino acid sequence of SEQ ID NO: 561, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 561; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 582, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 582. The amino acid sequence of 582 has functional variants with one or two amino acid substitutions.

[0180] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 457, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 457; HCDR2 comprising the amino acid sequence of SEQ ID NO: 478, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 478; HCDR3 comprising the amino acid sequence of SEQ ID NO: 499, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 499; LCDR1 comprising the amino acid sequence of SEQ ID NO: 541, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 541; LCDR2 comprising the amino acid sequence of SEQ ID NO: 562, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 562; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 583, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 583. The amino acid sequence of 583 has functional variants with one or two amino acid substitutions.

[0181] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 458, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 458; HCDR2 comprising the amino acid sequence of SEQ ID NO: 479, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 479; HCDR3 comprising the amino acid sequence of SEQ ID NO: 500, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 500; LCDR1 comprising the amino acid sequence of SEQ ID NO: 542, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 542; LCDR2 comprising the amino acid sequence of SEQ ID NO: 563, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 563; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 584, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 584. The amino acid sequence of 584 has functional variants with one or two amino acid substitutions.

[0182] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 459, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 459; HCDR2 comprising the amino acid sequence of SEQ ID NO: 480, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 480; HCDR3 comprising the amino acid sequence of SEQ ID NO: 501, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 501; LCDR1 comprising the amino acid sequence of SEQ ID NO: 543, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 543; LCDR2 comprising the amino acid sequence of SEQ ID NO: 564, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 564; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 585, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 585. The amino acid sequence of 585 has functional variants with one or two amino acid substitutions.

[0183] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 460, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 460; HCDR2 comprising the amino acid sequence of SEQ ID NO: 481, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 481; HCDR3 comprising the amino acid sequence of SEQ ID NO: 502, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 502; LCDR1 comprising the amino acid sequence of SEQ ID NO: 544, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 544; LCDR2 comprising the amino acid sequence of SEQ ID NO: 565, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 565; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 586, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 566. The amino acid sequence of 586 has functional variants with one or two amino acid substitutions.

[0184] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 461, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 461; HCDR2 comprising the amino acid sequence of SEQ ID NO: 482, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 482; HCDR3 comprising the amino acid sequence of SEQ ID NO: 503, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 503; LCDR1 comprising the amino acid sequence of SEQ ID NO: 545, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 545; LCDR2 comprising the amino acid sequence of SEQ ID NO: 566, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 566; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 587, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 587. The amino acid sequence of 587 has functional variants with one or two amino acid substitutions.

[0185] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 462, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 462; HCDR2 comprising the amino acid sequence of SEQ ID NO: 483, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 483; HCDR3 comprising the amino acid sequence of SEQ ID NO: 504, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 504; LCDR1 comprising the amino acid sequence of SEQ ID NO: 546, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 546; LCDR2 comprising the amino acid sequence of SEQ ID NO: 567, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 567; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 588, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 588. The amino acid sequence of 588 has functional variants with one or two amino acid substitutions.

[0186] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 463, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 463; HCDR2 comprising the amino acid sequence of SEQ ID NO: 484, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 484; HCDR3 comprising the amino acid sequence of SEQ ID NO: 505, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 505; LCDR1 comprising the amino acid sequence of SEQ ID NO: 547, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 547; LCDR2 comprising the amino acid sequence of SEQ ID NO: 568, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 568; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 589, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 569. The amino acid sequence of 589 has functional variants with one or two amino acid substitutions.

[0187] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 464, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 464; HCDR2 comprising the amino acid sequence of SEQ ID NO: 485, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 485; HCDR3 comprising the amino acid sequence of SEQ ID NO: 506, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 506; LCDR1 comprising the amino acid sequence of SEQ ID NO: 548, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 548; LCDR2 comprising the amino acid sequence of SEQ ID NO: 569, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 569; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 590, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 590. The amino acid sequence of 590 has functional variants with one or two amino acid substitutions.

[0188] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 465, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 465; HCDR2 comprising the amino acid sequence of SEQ ID NO: 486, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 486; HCDR3 comprising the amino acid sequence of SEQ ID NO: 507, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 507; LCDR1 comprising the amino acid sequence of SEQ ID NO: 549, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 549; LCDR2 comprising the amino acid sequence of SEQ ID NO: 570, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 570; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 591, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 591. The amino acid sequence of 591 has functional variants with one or two amino acid substitutions.

[0189] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 466, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 466; HCDR2 comprising the amino acid sequence of SEQ ID NO: 487, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 487; HCDR3 comprising the amino acid sequence of SEQ ID NO: 508, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 508; LCDR1 comprising the amino acid sequence of SEQ ID NO: 550, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 550; LCDR2 comprising the amino acid sequence of SEQ ID NO: 571, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 571; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 592, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 592. The amino acid sequence of 592 has functional variants with one or two amino acid substitutions.

[0190] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 467, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 467; HCDR2 comprising the amino acid sequence of SEQ ID NO: 488, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 488; HCDR3 comprising the amino acid sequence of SEQ ID NO: 509, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 509; LCDR1 comprising the amino acid sequence of SEQ ID NO: 551, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 551; LCDR2 comprising the amino acid sequence of SEQ ID NO: 572, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 572; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 593, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 593. The amino acid sequence of 593 has functional variants with one or two amino acid substitutions.

[0191] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 468, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 468; HCDR2 comprising the amino acid sequence of SEQ ID NO: 489, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 489; HCDR3 comprising the amino acid sequence of SEQ ID NO: 510, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 510; LCDR1 comprising the amino acid sequence of SEQ ID NO: 552, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 552; LCDR2 comprising the amino acid sequence of SEQ ID NO: 573, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 573; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 594, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 594. The amino acid sequence of 594 has functional variants with one or two amino acid substitutions.

[0192] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 469, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 469; HCDR2 comprising the amino acid sequence of SEQ ID NO: 490, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 490; HCDR3 comprising the amino acid sequence of SEQ ID NO: 511, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 511; LCDR1 comprising the amino acid sequence of SEQ ID NO: 553, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 553; LCDR2 comprising the amino acid sequence of SEQ ID NO: 574, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 574; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 595, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 595. The amino acid sequence of 595 has functional variants with one or two amino acid substitutions.

[0193] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 470, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 470; HCDR2 comprising the amino acid sequence of SEQ ID NO: 491, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 491; HCDR3 comprising the amino acid sequence of SEQ ID NO: 512, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 512; LCDR1 comprising the amino acid sequence of SEQ ID NO: 554, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 554; LCDR2 comprising the amino acid sequence of SEQ ID NO: 575, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 575; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 596, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 596. The amino acid sequence of 596 has functional variants with one or two amino acid substitutions.

[0194] In some embodiments, the CD117 binding antibody or its antigen-binding fragment comprises: HCDR1 comprising the amino acid sequence of SEQ ID NO: 471, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 471; HCDR2 comprising the amino acid sequence of SEQ ID NO: 492, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 492; HCDR3 comprising the amino acid sequence of SEQ ID NO: 513, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 513; LCDR1 comprising the amino acid sequence of SEQ ID NO: 555, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 555; LCDR2 comprising the amino acid sequence of SEQ ID NO: 576, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 576; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 597, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 597. The amino acid sequence of 597 has functional variants with one or two amino acid substitutions.

[0195] In some instances, the CD117 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 514-534. In some instances, the CD117 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 95% sequence identity with any one of SEQ ID NO: 514-534. In some instances, the CD117 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 97% sequence identity with any one of SEQ ID NO: 514-534. In some instances, the CD117 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 99% sequence identity with any one of SEQ ID NO: 514-534. In some instances, the CD117 antibody or its antigen-binding fragment includes a heavy chain variable domain that contains at least or about 100% sequence identity with any one of SEQ ID NO: 514-534. In some instances, the CD117 antibody or its antigen-binding fragment comprises a heavy chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more of 150 amino acids having any one of SEQ ID NO: 514-534.

[0196] In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 598-618. In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 95% sequence identity with any one of SEQ ID NO: 598-618. In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain containing at least or about 97% sequence identity with any one of SEQ ID NO: 598-618. In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain that has at least or about 99% sequence identity with any one of SEQ ID NO: 598-618. In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain that has at least or about 100% sequence identity with any one of SEQ ID NO: 598-618. In some instances, the CD117 antibody or its antigen-binding fragment comprises a light chain variable domain comprising at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 or more of 150 amino acids having any one of SEQ ID NO: 598-618.

[0197] In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO: 619-639. In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 95% sequence identity with any one of SEQ ID NO: 619-639. In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence containing at least or about 97% sequence identity with any one of SEQ ID NO: 619-639. In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence that contains at least or about 99% sequence identity with any one of SEQ ID NO: 619-639. In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence that contains at least or about 100% sequence identity with any one of SEQ ID NO: 619-639. In some instances, the CD117 antibody or its antigen-binding fragment comprises a VH-VL sequence having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250 or more of 250 amino acids having any one of SEQ ID NO: 619-639.

[0198] Variant Library Codon mutation The variant nucleic acid library described herein may contain multiple nucleic acids, each encoding a variant codon sequence compared to a reference nucleic acid sequence. In some instances, each nucleic acid in the first nucleic acid group contains a variant at a single variant site. In some instances, the first nucleic acid group contains multiple variants at a single variant site, such that the first nucleic acid group contains more than one variant at the same variant site. The first nucleic acid group may contain nucleic acids that co-encode multiple codon variants at the same variant site. The first nucleic acid group may contain nucleic acids that co-encode up to 19 or more codons at the same position. The first nucleic acid group may contain nucleic acids that co-encode up to 60 variant triplets at the same position, or the first nucleic acid group may contain nucleic acids that co-encode up to 61 different codon triplets at the same position. Each variant may encode a codon that produces a different amino acid during translation. Table 1 provides a list of each possible codon (and representative amino acid) for each variant site.

[0199] Table 1. List of codons and amino acids

[0200] A nucleic acid population can contain different nucleic acids that co-encode up to 20 codon variations at multiple positions. In such instances, each nucleic acid in the population contains codon variations at more than one position within the same nucleic acid. In some instances, each nucleic acid in the population contains codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more codons within a single nucleic acid. In some instances, each variant long nucleic acid contains codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more codons within a single long nucleic acid. In some instances, the variant nucleic acid population contains codon variations at codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more in a single nucleic acid. In some instances, the variant nucleic acid population contains codon variations at at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more in a single long nucleic acid.

[0201] Highly parallel nucleic acid synthesis This paper presents a platform approach that leverages the miniaturization, parallelization, and vertical integration of end-to-end processes from polynucleotide synthesis to genome assembly within nanopores on silicon to create a revolutionary synthetic platform. The device described herein provides a silicon synthetic platform with the same footprint as a 96-well plate, capable of increasing throughput by up to 1,000 times or more compared to conventional synthetic methods, producing up to approximately 1,000,000 or more polynucleotides, or 10,000 or more genes, in a single highly parallelized run.

[0202] With the advent of next-generation sequencing, high-resolution genomic data has become a crucial factor in in-depth research into the biological roles of various genes in both normal biology and disease pathogenesis. At the heart of this research lies the central dogma of molecular biology and the concept of "residue-by-residue transfer of sequence information." Genomic information encoded in DNA is transcribed into proteins, which are then translated into active products within a given biological pathway.

[0203] Another exciting area of ​​research is the discovery, development, and fabrication of therapeutic molecules targeting highly specific cellular targets. Highly diverse DNA sequence libraries are central to the pipeline for developing targeted therapeutics. Gene mutants are used to express proteins in a cycle of designing, constructing, and testing protein engineering, which, in ideal instances, ultimately results in optimized genes for high expression of proteins with high affinity for their therapeutic targets. Consider, for example, the binding pocket of a receptor. The ability to simultaneously test all sequence arrangements of all residues within the binding pocket would allow for thorough exploration, increasing the chances of success. Saturation mutagenesis, where researchers attempt to generate all possible mutations at specific sites within the receptor, represents one approach to addressing this development challenge. While costly and time-consuming, it allows for the introduction of every variant at every location. Conversely, combinatorial mutagenesis, where extensive modifications can be made to a few selected sites or short DNA fragments, generates an incomplete library of variants with offset representations.

[0204] To accelerate drug development pipelines, libraries that provide desired variants at the correct locations and frequencies for testing—in other words, precise libraries—can reduce screening costs and turnaround times. This article presents methods for synthesizing nucleic acid synthetic variant libraries that provide the precise introduction of each desired variant at the desired frequency. For end users, this means not only the ability to thoroughly sample the sequence space but also the ability to query these hypotheses in an efficient manner, thereby reducing costs and screening time. Whole-genome editing can elucidate important pathways, libraries where optimal functionality of each variant and sequence arrangement can be tested, and entire pathways and genomes can be reconstructed using thousands of genes to reconfigure biological systems for drug discovery.

[0205] In the first example, the methods described herein can be used to optimize the drug itself. For example, to improve a specific function of an antibody, a variant polynucleotide library encoding a portion of the antibody is designed and synthesized. The variant nucleic acid library of the antibody can then be generated using the processes described herein (e.g., PCR mutagenesis followed by insertion into a vector). The antibody is then expressed in a production cell line and screened for enhanced activity. Exemplary screening includes examining the regulation of binding affinity to the antigen, stability, or effector function (e.g., ADCC, complement, or apoptosis). Exemplary regions for optimizing the antibody include, but are not limited to, Fc regions, Fab regions, variable regions of Fab regions, constant regions of Fab regions, and variable domains (V) of the heavy or light chains. H or V L ) and V H or V L Specific complementarity determination regions (CDRs).

[0206] In some embodiments, the antibody or its antigen-binding fragment comprises an Fc region modified with one or more amino acids to improve the serum half-life of the antibody or its antigen-binding fragment relative to a wild-type Fc region. For example, the antibody or its antigen-binding fragment may comprise a modified IgG Fc region for improving serum half-life, having one or more of the following modifications relative to a wild-type IgG Fc region: M252Y, S254T, T256E, M428L, N434S, T256D, T307R, Q311V, N315D, N286D, T307R, H285N, or T307Q. In some embodiments, the antibody or its antigen-binding fragment may comprise modified IgG for improving serum half-life. The Fc region has one of the following modification sets: M252Y / S254T / T256E, M428L / N434S, T256D / T307R / Q311V, T256D / N315D / A378V, T256D / N286D / T307R / Q311V, H285N / T307Q / N315D, T256D / T307R / Q311V / A378V, H285D / Q311V / A37 8V, T256D / H285D / A378V, T256D / Q311V / A378V, T256D / H285D / N286D / T307R / A378V, T256D / H286D / T307R / Q311V / A378V, T307Q / Q311V / A378V, H285D / T307Q / A378V, or T256D / H285D / T307R / Q311V / A378V. In some embodiments, the antibody or its antigen-binding fragment may include an Fc region with one or more deletions relative to the wild-type Fc region to improve serum half-life. For example, the Fc region may include the deletion of a CH2 domain, a CH3 domain, or a portion thereof to improve serum half-life. In some implementations, the Fc region may include the deletion of a C-terminal amino acid (such as a C-terminal lysine) in the CH3 domain to improve serum half-life.

[0207] The nucleic acid libraries synthesized using the methods described herein can be expressed in a variety of cells associated with disease states. Cells associated with disease states include cell lines, tissue samples, primary cells from subjects, cultured cells expanded from subjects, or cells in model systems. Exemplary model systems include, but are not limited to, plant and animal models of disease states.

[0208] To identify variant molecules associated with the prevention, mitigation, or treatment of a disease state, the variant nucleic acid library described herein is expressed in cells associated with the disease state or in cells where the disease state can be induced. In some instances, agents are used to induce the disease state in cells. Exemplary tools for inducing disease states include, but are not limited to, the Cre / Lox recombination system, LPS inflammation induction, and streptozotocin for inducing hypoglycemia. Cells associated with the disease state can be cells from a model system or cultured cells, as well as cells from a subject with a specific disease state. Exemplary disease states include bacterial, fungal, viral, autoimmune, or proliferative conditions (e.g., cancer). In some instances, the variant nucleic acid library is expressed in model systems, cell lines, or primary cells derived from the subject, and changes in at least one cellular activity are screened. Exemplary cellular activities include, but are not limited to, proliferation, cell cycle progression, cell death, adhesion, migration, multiplication, cell signaling, energy production, oxygen utilization, metabolic activity and senescence, response to free radical damage, or any combination thereof.

[0209] base Devices used as surfaces for polynucleotide synthesis can be in the form of substrates, including but not limited to homogeneous array surfaces, patterned array surfaces, channels, beads, gels, etc. This document provides substrates comprising multiple clusters, each cluster containing multiple loci supporting the attachment and synthesis of polynucleotides. In some instances, the substrate comprises a homogeneous array surface. For example, a homogeneous array surface is a homogeneous plate. As used herein, the term "locus" refers to a structurally discrete region that supports the extension of a polynucleotide encoding a single predetermined sequence from a surface. In some instances, the locus is on a two-dimensional surface (e.g., a substantially flat surface). In some instances, the locus is on a three-dimensional surface (e.g., a pore, micropore, channel, or pillar). In some instances, the surface of the locus comprises a material actively functionalized to attach to at least one nucleotide for polynucleotide synthesis, or preferably, to a group of the same nucleotides for the synthesis of a group of polynucleotides. In some instances, a polynucleotide refers to a group of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate comprises one or more surfaces of the substrate. The average error rate of polynucleotides synthesized in the libraries described herein using the provided systems and methods is typically less than 1 / 1000, less than about 1 / 2000, less than about 1 / 3000, or even less without error correction.

[0210] This paper provides a surface that supports the parallel synthesis of multiple polynucleotides with different predetermined sequences at addressable sites on a common support. In some instances, the substrates are greater than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; It supports the synthesis of 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more different polynucleotides. In some cases, the surface values ​​exceed 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 90 The synthesis of 0,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more polynucleotides encoding different sequences is supported. In some instances, at least a portion of the polynucleotides has the same sequence or is configured to be synthesized with the same sequence. In some instances, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more bases.

[0211] This article provides methods for synthesizing polynucleotides at different loci on a substrate, wherein each locus supports the synthesis of a polynucleotide population. In some cases, each locus supports the synthesis of a polynucleotide population having a sequence different from that of a polynucleotide population grown at another locus. In some instances, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundant sequences at different loci within the same locus cluster on the surface used for polynucleotide synthesis. In some instances, the loci of the substrate are located within multiple clusters. In some instances, the substrate contains at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, the substrate contains more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2, 000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more different loci. In some instances, the base contains approximately 10,000 different loci. The number of loci within a single cluster varies from instance to instance. In some cases, each cluster contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, or more loci. In some instances, each cluster contains approximately 50-500 loci. In some instances, each cluster contains approximately 100-200 loci. In some instances, each cluster contains approximately 100-150 loci. In some instances, each cluster contains approximately 109, 121, 130, or 137 loci.In some instances, each cluster contains approximately 19, 20, 61, 64, or more loci. Alternatively or in combination, polynucleotide synthesis occurs on the homogeneous array surface.

[0212] In some instances, the number of different polynucleotides synthesized on the substrate depends on the number of different loci available in the substrate. In some instances, the density of loci within clusters or on the surface of the substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more loci / mm². 2 In some cases, the substrate includes 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm. 2 In some instances, the distance between the centers of two adjacent loci within a cluster or surface is approximately 10-500, 10-200, or 10-100 μm. In some instances, the distance between the centers of two adjacent loci is greater than approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some instances, the distance between the centers of two adjacent loci is less than approximately 200, 150, 100, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some instances, each locus has a width of approximately 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, each locus has a width of approximately 0.5-100, 0.5-50, 10-75, or 0.5-50 μm.

[0213] In some instances, the cluster density within the substrate is at least or about 1 cluster / 100 mm. 2 1 cluster / 10 mm 2 1 cluster / 5 mm 2 1 cluster / 4 mm 2 1 cluster / 3 mm 2 1 cluster / 2 mm 2 1 cluster / 1 mm 2 2 clusters / 1 mm 2 3 clusters / 1mm 2 4 clusters / 1 mm 2 5 clusters / 1 mm 2 10 clusters / 1 mm 2 50 clusters / 1 mm 2 Or more. In some instances, the substrate contains approximately 1 cluster / 10 mm. 2Approximately 10 clusters / 1 mm 2 In some instances, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is between about 50-100, 50-200, 50-300, 50-500, and 100-2000 μm. In some cases, the distance between the centers of two adjacent clusters is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross-section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm. In some cases, each cluster has a cross-sectional area of ​​approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In other cases, each cluster has an internal cross-sectional area of ​​approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0214] In some instances, the substrate is approximately the size of a standard 96-well plate, for example, between about 100 and about 200 mm × between about 50 and about 150 mm. In some instances, the substrate has a diameter less than or equal to about 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm. In some instances, the substrate has a diameter between about 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some instances, the substrate has a diameter of at least about 100; 200; 500; 1,000; 2,000; 5,000; 10,000; 12,000; 15,000; 20,000; 30,000; 40,000; or 50,000 mm. 2 Or a larger planar surface area. In some instances, the substrate has a thickness between approximately 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

[0215] Surface materials The substrates, devices, and reactors provided herein are made of any of a variety of materials suitable for the methods, compositions, and systems described herein. In some instances, the substrate material is manufactured to exhibit low levels of nucleotide binding. In some instances, the substrate material is modified to create different surfaces exhibiting high levels of nucleotide binding. In some instances, the substrate material is transparent to visible and / or UV light. In some instances, the substrate material is sufficiently conductive, for example, capable of forming a uniform electric field over all or part of the substrate. In some instances, the conductive material is connected to an electrical ground. In some instances, the substrate is thermally conductive or thermally insulating. In some instances, the material is chemically and thermally resistant to support chemical or biochemical reactions, such as polynucleotide synthesis processes. In some instances, the substrate comprises a flexible material. For flexible materials, the material may include, but is not limited to, modified and unmodified nylon, nitrocellulose, polypropylene, etc. In some instances, the substrate comprises a rigid material. For rigid materials, the materials may include, but are not limited to: glass; fused silica; silicon; plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof); and metals (e.g., gold, platinum, etc.). The substrate, solid support, or reactor may be made of materials selected from the group consisting of: silicon, polystyrene, agarose, dextran, cellulose polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. The substrate / solid support, or the microstructures therein, and the reactor may be manufactured using combinations of the materials listed herein or any other suitable materials known in the art.

[0216] Surface architecture This document provides substrates for use in the methods, compositions, and systems described herein, wherein these substrates have a surface architecture suitable for the methods, compositions, and systems described herein. In some instances, the substrate includes raised and / or recessed features. One benefit of having such features is increased surface area to support polynucleotide synthesis. In some instances, substrates with raised and / or recessed features are referred to as three-dimensional substrates. In some cases, three-dimensional substrates contain one or more channels. In some cases, one or more loci contain channels. In some cases, channels may be deposited with reagents via a deposition apparatus such as a material deposition apparatus. In some cases, reagents and / or fluids are collected in large pores in fluid communication with one or more channels. For example, the substrate contains multiple channels corresponding to multiple loci having clusters, and the multiple channels are in fluid communication with a pore of the cluster. In some methods, libraries of polynucleotides are synthesized in multiple loci of a cluster.

[0217] This document provides substrates for use in the methods, compositions, and systems described herein, wherein these substrates are configured for polynucleotide synthesis. In some instances, the structure is configured to allow controlled flow and mass transfer pathways for polynucleotide synthesis on a surface. In some instances, the substrate configuration allows for controlled and uniform distribution of mass transfer pathways, chemical exposure times, and / or washing efficiencies during polynucleotide synthesis. In some instances, the substrate configuration allows for increased sweep efficiency, for example, by providing sufficient volume for the growing polynucleotide such that the volume excluded by the growing polynucleotide does not exceed 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the initial available volume that can be used or is suitable for growing the polynucleotide. In some instances, the three-dimensional structure allows for managed fluid flow to enable rapid exchange of chemical exposures.

[0218] This document provides substrates for use in the methods, compositions, and systems described herein, wherein these substrates contain structures suitable for the methods, compositions, and systems described herein. In some instances, separation is achieved through physical structure. In some instances, separation is achieved through differential functionalization of the surface, which generates active and passive regions for polynucleotide synthesis. In some instances, differential functionalization is achieved by altering the hydrophobicity of the entire substrate surface, thereby creating a water contact angle effect that leads to beading or wetting of the deposited reagent. Employing larger structures reduces splashing and cross-contamination of reagents from adjacent spots to different polynucleotide synthesis sites. In some cases, apparatus such as material deposition devices are used to deposit reagents to different polynucleotide synthesis sites. Substrates with three-dimensional features are configured in a manner that allows for the synthesis of large quantities of polynucleotides (e.g., more than about 10,000) with low error rates (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some cases, the substrate contains a density of approximately 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 features / mm. 2 Its characteristics.

[0219] The apertures in the substrate may have the same or different width, height, and / or volume as another aperture in the substrate. The channels in the substrate may have the same or different width, height, and / or volume as another channel in the substrate. In some instances, the diameter of the cluster or the diameter of the aperture containing the cluster, or both, is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some instances, the diameter of the cluster or aperture, or both, is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some instances, the diameter of the cluster or aperture, or both, is between approximately 1.0 and 1.3 mm. In some instances, the diameter of the cluster or aperture, or both, is approximately 1.150 mm. In some instances, the diameter of the cluster or aperture, or both, is approximately 0.08 mm. The diameter of the cluster refers to the cluster within a two-dimensional or three-dimensional substrate.

[0220] In some instances, the hole height is approximately 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 μm. In other cases, the hole height is less than approximately 1000, 900, 800, 700, or 600 μm.

[0221] In some instances, the substrate contains multiple channels corresponding to multiple loci within a cluster, wherein the height or depth of the channels is 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 μm. In some cases, the height of the channels is less than 100, 80, 60, 40, or 20 μm.

[0222] In some instances, the diameter of both the channel, locus (e.g., in a substantially planar substrate) or the channel and locus (e.g., in a three-dimensional substrate in which the locus corresponds to the channel) is about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 μm, for example, about 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some instances, the diameter of both the channel, locus, or the channel and locus is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some instances, the distance between the centers of two adjacent channels, loci, or channels and loci is about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, for example, about 20 μm.

[0223] Surface finishing This document provides methods for synthesizing polynucleotides on surfaces containing various surface modifications. In some instances, surface modifications are used to chemically and / or physically alter a surface by additive or subtractive processes to change one or more chemical and / or physical properties of a substrate surface or selected sites or regions of a substrate surface. For example, surface modifications include, but are not limited to, (1) altering the wetting properties of a surface; (2) functionalizing a surface, i.e., providing, modifying, or substituting surface functional groups; (3) defunctionalizing a surface, i.e., removing surface functional groups; (4) otherwise altering the chemical composition of a surface, e.g., by etching; (5) increasing or decreasing surface roughness; (6) providing a coating on a surface, e.g., a coating exhibiting wetting properties different from those of the surface; and / or (7) depositing particles on a surface.

[0224] In some cases, adding a chemical layer (called an adhesion promoter) on top of a surface facilitates the structured patterning of loci on the substrate surface. Exemplary surfaces used to apply adhesion promotion include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some instances, a second chemical layer is deposited on the substrate surface. In some cases, the second chemical layer has low surface energy. In some cases, the surface energy of the chemical layer coated on the surface supports the positioning of droplets on the surface. Depending on the chosen patterning arrangement, the proximity of the loci and / or the fluid contact area at the loci is variable.

[0225] In some instances, the substrate surface on which nucleic acids or other components are deposited, or the resolving locus (e.g., for polynucleotide synthesis), is smooth or substantially planar (e.g., two-dimensional) or has irregularities, such as raised or recessed features (e.g., three-dimensional features). In some instances, the substrate surface is modified with one or more different layers of compounds. Such modifying layers of interest include, but are not limited to, inorganic and organic layers, such as metals, metal oxides, polymers, small organic molecules, etc.

[0226] In some instances, the resolving loci of the substrate are functionalized with one or more portions that increase and / or decrease surface energy. In some cases, the portions are chemically inert. In some cases, the portions are configured to support a desired chemical reaction, such as one or more processes in a polynucleotide synthesis reaction. The surface energy or hydrophobicity of the surface is a factor used to determine the affinity of nucleotides for attachment to the surface. In some instances, methods for substrate functionalization include: (a) providing a substrate having a surface comprising silica; and (b) silanizing the surface using a suitable silanizing agent described herein or known in the art, such as an organofunctional alkoxysilane molecule. The methods and functionalizing agents are described in U.S. Patent No. 5,474,796, which is incorporated herein by reference in its entirety.

[0227] In some instances, substrate surfaces are functionalized by contacting a derivatized composition containing a mixture of silanes under reaction conditions that effectively couple silanes to the substrate surface, typically via reactive hydrophilic portions present on the substrate surface. Silanization typically involves coating the surface through self-assembly with organofunctional alkoxysilane molecules. A variety of siloxane functionalizing agents known in the art can be further used, for example, to decrease or increase surface energy. Organofunctional alkoxysilanes are classified according to their organic functionality.

[0228] Polynucleotide synthesis The methods for polynucleotide synthesis disclosed herein may include processes involving phosphorus amide chemistry. In some instances, polynucleotide synthesis includes coupling a base to phosphorus amide. Polynucleotide synthesis may include coupling the base by depositing phosphorus amide under coupling conditions, wherein the same base is optionally deposited with phosphorus amide more than once, i.e., double coupling. Polynucleotide synthesis may include capping of unreacted sites. In some instances, capping is optional. Polynucleotide synthesis may also include oxidation or one or more oxidation steps. Polynucleotide synthesis may include deblocking, detriphenylmethylation, and sulfidation. In some instances, polynucleotide synthesis includes oxidation or sulfidation. In some instances, a washing apparatus, for example, is used between one or each step during the polynucleotide synthesis reaction. The time range of any step in the phosphorus amide synthesis method may be less than about 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec, and 10 sec.

[0229] Polynucleotide synthesis using the phosphoramidite method may include the subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain to form a phosphotriester bond. Phosphoside polynucleotide synthesis proceeds along the 3' to 5' direction. Phosphoside polynucleotide synthesis allows for the controlled addition of one nucleotide to the growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle includes a coupling step. Phosphoside coupling involves the formation of a phosphotriester bond between an activated nucleoside phosphoramidite and a nucleoside, for example, bound to a substrate via a linker. In some instances, the nucleoside phosphoramidite is provided to the apparatus in an activated state. In some instances, the nucleoside phosphoramidite is provided to the apparatus along with an activator. In some instances, nucleoside phosphoramide is provided to the apparatus in an excess of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 times, or more, of the nucleoside bound to the substrate. In some instances, the addition of nucleoside phosphoramide is carried out in an anhydrous environment, such as in anhydrous acetonitrile. The apparatus is optionally washed after the addition of nucleoside phosphoramide. In some instances, the coupling step is repeated once or several times, optionally with washing steps between additions of nucleoside phosphoramide to the substrate. In some instances, the polynucleotide synthesis method used herein includes 1, 2, 3, or more sequential coupling steps. Prior to coupling, in many instances, the nucleoside bound to the apparatus is deprotected by removing a protecting group, which serves to prevent polymerization. The most common protecting group is 4,4'-dimethoxytriphenylmethyl (DMT).

[0230] Following coupling, the phosphoramidite polynucleotide synthesis method optionally includes a capping step. In the capping step, the growing polynucleotide is treated with a capping agent. The capping step can be used to block further chain extension of the unreacted 5'-OH group bound to the substrate after coupling, thereby preventing the formation of polynucleotides with internal base deletions. Further, phosphoramidite activated with 1H-tetrazole can react to a small extent with the O6 position of guanosine. Unbound from theory, this byproduct (possibly migrating via O6-N7) can undergo depurination during oxidation with I2 / water. During the final deprotection of the polynucleotide, the depurination site may eventually be cleaved, thus reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping reagent before oxidation with I2 / water. In some instances, including a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. As an example, the capping step includes treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. After the sealing step, an optional washing device is used.

[0231] In some instances, the growing nucleic acid bound to the device is oxidized after the addition of nucleoside phosphoramide, and optionally after capping and one or more washing steps. The oxidation step involves oxidizing the phosphite triester to a tetracoordinate phosphotriester, which is a protected precursor of a naturally occurring phosphodiester nucleoside internucleotide bond. In some instances, the oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, dimethylpyridine, trimethylpyridine). Oxidation can be carried out under anhydrous conditions using, for example, tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxazolidinium (CSO). In some methods, a capping step is performed after oxidation. This second capping step allows the device to dry, as residual water from the oxidation that may persist could inhibit subsequent coupling. After oxidation, the device and the growing polynucleotide are optionally washed. In some instances, the oxidation step is replaced by a sulfidation step to obtain polynucleotide thiophosphates, where any end-capping step can be performed after sulfidation. Many reagents are capable of achieving efficient sulfur transfer, including but not limited to 3-(dimethylaminomethylene)amino)-3H-1,2,4-dithiazolyl-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide (also known as Beaucage reagent), and N,N,N'N'-tetraethylthiourea disulfide (TETD).

[0232] To facilitate subsequent cycles of nucleoside incorporation via coupling, the protected 5' end of the growing polynucleotide bound to the device is removed, allowing the primary hydroxyl group to react with the next nucleoside phosphoramidite. In some instances, the protecting group is DMT, and deblocking is performed with trichloroacetic acid in dichloromethane. Prolonged detriphenylmethylation or deblocking with a stronger acid solution than recommended can lead to increased depurination of the polynucleotide bound to the solid support, thus reducing the yield of the desired full-length product. The methods and compositions of this disclosure provide controlled deblocking conditions that limit undesirable depurination reactions. In some instances, the polynucleotide bound to the device is washed after deblocking. In some instances, efficient washing after deblocking contributes to a low error rate in the synthesized polynucleotide.

[0233] Methods for synthesizing polynucleotides typically involve an iterative sequence of the following steps: applying a protected monomer to an actively functionalized surface (e.g., a locus) to link with an activated surface, a linker, or a previously deprotected monomer; deprotecting the applied monomer to allow it to react with a subsequently applied protected monomer; and applying another protected monomer for linking. One or more intermediate steps include oxidation or sulfidation. In some instances, one or more washing steps occur before or after one or all of the steps.

[0234] Methods for the synthesis of phosphoramide-based polynucleotides include a series of chemical steps. In some instances, one or more steps of the synthetic method involve reagent cycling, wherein one or more steps of the method include applying a reagent that can be used in that step to the apparatus. For example, the reagent is cycled through a series of liquid deposition and vacuum drying steps. For substrates containing three-dimensional features such as pores, micropores, channels, etc., the reagent is optionally passed through one or more regions of the apparatus via pores and / or channels.

[0235] The methods and systems described herein relate to a polynucleotide synthesis apparatus for synthesizing polynucleotides. Synthesis can be parallel. For example, at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel can be 2-100,000, 3-50,000, 4-10,000, 5-1,000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, or 30-35. Those skilled in the art will understand that the total number of polynucleotides synthesized in parallel can fall within any range defined by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel can fall within any range defined by any of the values ​​that serve as the endpoints of this range. The total molar mass of the polynucleotides synthesized in the device, or the molar mass of each of these polynucleotides, may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles or greater. The length of each of these polynucleotides, or the average length of the polynucleotides in the device, may be at least or at least at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides or more. The length of each of these polynucleotides, or the average length of the polynucleotides within the device, can be up to or about 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides or less. The length of each of these polynucleotides, or the average length of the polynucleotides within the device, can fall within the range of 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25.Those skilled in the art will understand that the length of each of these polynucleotides, or the average length of the polynucleotides within the device, can fall within any range defined by any of these values, for example, 100-300. The length of each of these polynucleotides, or the average length of the polynucleotides within the device, can fall within any range defined by any of the values ​​that serve as the endpoints of that range.

[0236] The method for synthesizing polynucleotides on a surface provided herein allows for synthesis at rapid rates. For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 or more nucleotides per hour can be synthesized. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks or their analogues / modified versions. In some instances, libraries of polynucleotides are synthesized in parallel on the substrate. For example, a device containing about or at least about 100; 1,000; 10,000; 30,000; 75,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 parsing loci can support the synthesis of at least the same number of different polynucleotides, wherein polynucleotides encoding different sequences are synthesized at the parsing loci. In some instances, libraries of polynucleotides are synthesized on the device described herein with a low error rate in less than about three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less. In some instances, large nucleic acids assembled from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein are prepared in less than approximately three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less.

[0237] In some instances, the methods described herein provide for the generation of nucleic acid libraries containing variant nucleic acids at multiple codon sites. In some instances, the nucleic acids may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or more variant codon sites.

[0238] In some instances, one or more sites of the variant codon may be adjacent. In some instances, one or more sites of the variant codon may not be adjacent and may be separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more codons.

[0239] In some instances, a nucleic acid may contain multiple sites of variant codon sites, where all variant codon sites are adjacent to each other, thus forming a segment of variant codon sites. In some instances, a nucleic acid may contain multiple sites of variant codon sites, where all variant codon sites are not adjacent to each other. In some instances, a nucleic acid may contain multiple sites of variant codon sites, where some variant codon sites are adjacent to each other, thus forming a segment of variant codon sites, and some variant codon sites are not adjacent to each other.

[0240] Refer to the attached diagram. Figure 1 An exemplary process workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids is shown. The workflow is typically divided into the following stages: (1) de novo synthesis of a single-stranded nucleic acid library; (2) ligation of nucleic acids to form a larger fragment; (3) error correction; (4) quality control; and (5) transport. Prior to de novo synthesis, the intended nucleic acid sequence or set of nucleic acid sequences is pre-selected. For example, a set of genes is pre-selected for generation.

[0241] Once a large nucleic acid for generation is selected, a predetermined nucleic acid library is designed for de novo synthesis. Various suitable methods are known for generating high-density polynucleotide arrays. In the workflow example, a device surface layer is provided. In the example, the chemical properties of the surface are modified to improve the polynucleotide synthesis process. Low surface energy regions are generated to repel liquids, while high surface energy regions are generated to attract liquids. The surface itself can be in the form of a flat surface or contain shape variations, such as protrusions or micropores that increase surface area. In the workflow example, the selected high surface energy molecules have a dual function of supporting DNA chemistry, as disclosed in International Patent Application Publication WO / 2015 / 021080, which is incorporated herein by reference in its entirety.

[0242] In-situ preparation of polynucleotide arrays is performed on a solid support, utilizing a single nucleotide extension process to extend multiple oligomers in parallel. Deposition apparatus, such as a material deposition apparatus, is designed to release reagents in a stepwise manner, allowing multiple polynucleotides to extend one residue at a time in parallel to generate oligomers 102 with a predetermined nucleic acid sequence. In some instances, the polynucleotides are cleaved from the surface at this stage. Cleavage includes gaseous cleavage, for example, with ammonia or methylamine.

[0243] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also referred to as a “nanoreactor”) is a silicon-coated pore containing PCR reagents and lowered onto the polynucleotide library 103. Reagents are added before or after sealing the polynucleotides 104 to release the polynucleotides from the substrate. In this exemplary workflow, the polynucleotides are released after sealing the nanoreactor 105. Once released, fragments of the single-stranded polynucleotides hybridize to span the entire long-programmed sequence of DNA. Partial hybridization 105 is possible because each synthesized polynucleotide is designed to have a small portion overlapping with at least one other polynucleotide in the pool.

[0244] After hybridization, the PCA reaction begins. During polymerase cycling, polynucleotides anneal with complementary fragments, and gaps are filled by polymerase. Each cycle randomly increases the length of different fragments, depending on which polynucleotides find each other. The complementarity between fragments allows for the formation of a complete, large-span double-stranded DNA 10⁶.

[0245] After PCA, the nanoreactor is separated from the device 107 and positioned to interact with the device containing primers for PCR 108. After sealing, PCR is performed on the nanoreactor 109, amplifying larger nucleic acids. After PCR 110, the nanochamber 111 is opened, error correction reagent is added 112, the chamber is sealed 113, and an error correction reaction occurs to remove mismatched base pairs and / or poorly complementary strands from the double-stranded PCR amplification product 114. The nanoreactor is then opened and separated 115. The error-corrected product undergoes further processing steps, such as PCR and molecular barcoding, and is then packaged 122 for transport 123.

[0246] In some instances, quality control measures are implemented. Following error correction, the quality control steps include, for example, interacting 116 with a wafer containing sequencing primers for amplifying the error-corrected product, sealing the wafer into a chamber containing the amplified product, and performing another round of amplification. The nanoreactor is then opened 119, the product is combined 120, and sequencing is performed 121. After an acceptable quality control determination is made, the packaged product 122 is approved for shipment 123.

[0247] In some instances, the overlapping primer pairs disclosed herein are used via workflows (such as...) Figure 1 The nucleic acids generated in the process (in the workflow) are mutagenized. In some instances, primer libraries are generated in situ on a solid support, and multiple oligomers are extended in parallel using a single nucleotide extension process. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner, allowing multiple polynucleotides to extend one residue at a time in parallel to generate oligomers 102 with a predetermined nucleic acid sequence.

[0248] Computer System Any system described herein can be operatively linked to a computer and can be automated locally or remotely via the computer. In various instances, the methods and systems of this disclosure may also include software programs on a computer system and their uses. Therefore, computerized control of the synchronization of dispensing / vacuum / refilling functions (such as coordinating and synchronizing material deposition apparatus movement, dispensing actions, and vacuum actuation) is within the scope of this disclosure. The computer system can be programmed to engage between a user-specified base sequence and the location of the material deposition apparatus to deliver the correct reagent to a designated area of ​​the substrate.

[0249] Figure 2 The computer system 200 shown can be understood as a logical device that can read instructions from medium 211 and / or network port 205, which can optionally be connected to server 209 having fixed medium 212. Such as Figure 2 The system shown may include a CPU 201, a disk drive 203, optional input devices such as a keyboard 215 and / or a mouse 216, and an optional monitor 207. Data communication to a server at a local or remote location can be achieved via the indicated communication medium. The communication medium may include any means of sending and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection can provide communication via the World Wide Web. It is contemplated that data relating to this disclosure may be sent via such a network or connection for receipt and / or viewing by a party 222, such as... Figure 2 As shown.

[0250] like Figure 3As shown, cache 304 can be connected to or incorporated into processor 302 to provide high-speed memory for instructions or data recently or frequently used by processor 302. Processor 302 is connected to northbridge 306 via processor bus 308. Northbridge 306 is connected to random access memory (RAM) 310 via memory bus 312 and manages processor 302's access to RAM 310. Northbridge 306 is also connected to southbridge 314 via chipset bus 316. Southbridge 314 is in turn connected to peripheral bus 318. Peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral buses. Northbridge and southbridge are commonly referred to as processor chipsets and manage data transfer between the processor, RAM, and peripheral components on peripheral bus 318. In some alternative architectures, the functionality of northbridge can be incorporated into the processor instead of using a separate northbridge chip. In some instances, system 300 may include accelerator card 322 attached to peripheral bus 318. Accelerators can include field-programmable gate arrays (FPGAs) or other hardware used to accelerate certain processes. For example, accelerators can be used for adaptive data reconstruction or for evaluating algebraic expressions used in extended set processing.

[0251] Software and data are stored in external memory 324 and can be loaded into RAM 310 and / or cache 304 for processor use. System 300 includes an operating system for managing system resources; non-limiting examples of the operating system include Linux, Windows™, MACOSTM, BlackBerry OS™, iOS™, and other functionally equivalent operating systems, as well as application software running on top of the operating system for managing and optimizing data storage according to example instances of this disclosure. In this example, system 300 also includes network interface cards (NICs) 320 and 321 connected to a peripheral bus for providing a network interface to external memory, such as network attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0252] Figure 4This is a diagram illustrating network 400, which includes multiple computer systems 402a and 402b, multiple cellular phones and personal data assistants 402c, and network-attached storage (NAS) 404a and 404b. In an example instance, systems 402a, 402b, and 402c can manage data storage and optimize data access for data stored in NAS 404a and 404b. Mathematical models can be applied to the data and evaluated using distributed parallel processing across computer systems 402a and 402b and cellular phone and personal data assistant systems 402c. Computer systems 402a and 402b and cellular phone and personal data assistant systems 402c can also provide parallel processing for adaptive data reconstruction of data stored in NAS 404a and 404b. Figure 4 This is just one example, and various other computer architectures and systems can be used in conjunction with various instances of this disclosure. For example, blade servers can be used to provide parallel processing. Processor blades can be connected via a backplane to provide parallel processing. Memory can also be connected to the backplane via a separate network interface or as network-attached storage (NAS). In some example instances, processors can maintain separate storage spaces and send data via network interfaces, backplanes, or other connectors for parallel processing by other processors. In other instances, some or all of the processors can use shared virtual address storage space.

[0253] Figure 5 This is a block diagram of a multiprocessor computer system 500 using a shared virtual address memory space, based on an example instance. The system includes multiple processors 502a-f that can access a shared memory subsystem 504. The system incorporates multiple programmable hardware memory algorithm processors (MAPs) 506a-f, which reside within the memory subsystem 504. Each MAP 506a-f may include memory 508a-f and one or more field-programmable gate arrays (FPGAs) 510a-f. MAPs provide configurable functional units and can provide specific algorithms or portions of algorithms to FPGAs 510a-f for processing in close coordination with the corresponding processors. For example, a MAP can be used to evaluate algebraic expressions about a data model and, in the example instance, to perform adaptive data reconstruction. In this example, for these purposes, each MAP is globally accessible by all processors. In one configuration, each MAP can use direct memory access (DMA) to access its associated memory 508a-f, allowing it to perform tasks independently of and asynchronously with the corresponding microprocessor 502a-f. In this configuration, a MAP can feed the results directly to another MAP for pipelined and parallel execution of the algorithm.

[0254] The computer architectures and systems described above are merely examples, and a wide variety of other computer, cellular phone, and personal data assistant architectures and systems can be used in conjunction with these examples. These include systems using any combination of general-purpose processors, coprocessors, FPGAs and other programmable logic devices, system-on-a-chip (SoC), application-specific integrated circuits (ASIC), and other processing and logic elements. In some instances, all or part of the computer system may be implemented in software or hardware. Any type of data storage medium can be used in conjunction with these examples, including random access memory, hard disk drives, flash memory, tape drives, disk arrays, network-attached storage (NAS), and other local or distributed data storage devices and systems.

[0255] In the example instance, the computer system can be implemented using software modules that execute on any of the above or other computer architectures and systems. In other instances, the system's functionality can be partially or completely implemented in firmware, programmable logic devices (such as... Figure 3 This can be implemented using Field Programmable Gate Arrays (FPGAs), Systems-on-Chip (SoCs), Application-Specific Integrated Circuits (ASICs), or other processing and logic elements. For example, it can be implemented using hardware acceleration cards (such as...). Figure 3 The accelerator card 322 shown in the image utilizes hardware acceleration to configure the processor and optimizer.

[0256] The following examples are provided to illustrate the principles and practice of the embodiments disclosed herein more clearly to those skilled in the art, and these examples should not be construed as limiting the scope of any claimed embodiments. Unless otherwise stated, all parts and percentages are by weight.

[0257] Example The following examples are given for the purpose of illustrating various embodiments of this disclosure and are not intended to limit this disclosure in any way. These examples, together with the methods described herein, represent preferred embodiments, are exemplary, and are not intended to limit the scope of this disclosure. Variations and other uses covered within the spirit of this disclosure as defined by the claims will be apparent to those skilled in the art.

[0258] Example 1: Functionalization of the device surface The device was functionalized to support the attachment and synthesis of polynucleotide libraries. First, the device surface was wet-cleaned for 20 minutes using a piranha solution containing 90% H₂SO₄ and 10% H₂O₂. The device was then rinsed with DI water in several beakers, kept under a DI water gooseneck tap for 5 minutes, and dried with N₂. Subsequently, the device was immersed in NH₄OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a spray gun, and immersed for 1 minute in each of three consecutive beakers containing DI water, followed by a second rinse with DI water using a spray gun. The device was then plasma-cleaned by exposing its surface to O₂. Plasma etching with O₂ was performed using a SAMCO PC-300 instrument in downstream mode at 250 watts for 1 minute.

[0259] Active functionalization of the cleaned device surface was performed using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 Torr, 60 min, 70 °C, 135 °C evaporator. Resist was applied to the device surface using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin-coated onto the device at 2500 rpm for 40 sec. The device was pre-baked on a Brewer hot plate at 90 °C for 30 min. Photolithography was performed using a Karl Suss MA6 mask aligner. The device was exposed for 2.2 sec and developed in MSF 26A for 1 min. Residual developer was rinsed off with a spray gun, and the device was immersed in water for 5 min. The device was baked in an oven at 100 °C for 30 min, and then visually inspected for lithographic defects using a Nikon L200. Residual resist was removed using a descum process, and O2 plasma etching was performed at 250 watts for 1 min using a SAMCO PC-300 instrument.

[0260] The device surface was passively functionalized using a 100 µL perfluorooctyltrichlorosilane solution mixed with 10 µL of light mineral oil. The device was placed in a chamber, pumped for 10 min, then the pump valve was closed and the device was allowed to stand for 10 min. The chamber was then ventilated. The device was then subjected to resist stripping by sonication at maximum power (9 on the Crest system) followed by two immersions (5 min each) in 500 mL of NMP at 70 °C. The device was then sonicated at maximum power after immersion in 500 mL of isopropanol at room temperature for 5 min. The device was then immersed in 300 mL of 200 °C ethanol and dried with N2. The functionalized surface was activated to serve as a support for polynucleotide synthesis.

[0261] Example 2: Synthesis of 50-mer sequences on an oligonucleotide synthesis apparatus The two-dimensional oligonucleotide synthesis apparatus was assembled into a flow cell connected to an AppliedBiosystems (ABI 394 DNA Synthesizer). The apparatus was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest) for the synthesis of an exemplary 50 bp polynucleotide (“50-mer polynucleotide”) using the polynucleotide synthesis method described herein.

[0262] The sequence of the 50-mer is as follows: 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO: 640), where # represents thymidine-succinyl hexaamide CED phosphoramide (CLP-2244 from ChemGenes), which is a cleavable linker capable of releasing oligonucleotides from the surface during deprotection.

[0263] Synthesized using standard DNA synthesis chemistry (coupling, capping, oxidation, and decapping) and an ABI synthesizer according to the protocols in Table 2.

[0264] Table 2: Synthesis Scheme

[0265]

[0266] The delivery of the phosphorus amide / activator combination is similar to that of batch reagent delivery via a flow cell. Since the environment is kept "humid" with the reagent throughout the process, no drying step is performed.

[0267] The flow restrictor was removed from the ABI 394 synthesizer to achieve faster flow rates. Without the flow restrictor, the flow rates of amide (0.1 M, in ACN), activator (0.25 M benzoylthiotetrazole (“BTT”; 30-3070-xx, from Glen Research), in ACN) and Ox (0.02 M I2, in 20% pyridine, 10% water, and 70% THF) were approximately ~100 μL / sec, the flow rates of acetonitrile (“ACN”) and capping reagent (a 1:1 mixture of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% 1-methylimidazole in THF) were approximately ~200 μL / sec, and the flow rate of decapping agent (3% dichloroacetic acid, in toluene) was approximately ~300 μL / sec (compared to approximately ~50 μL / sec for all reagents with the flow restrictor). The time required for complete removal of the oxidant was observed, and the timing of the chemical flow time was adjusted accordingly. Additional ACN washes were introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected overnight in gaseous ammonia at 75 psi. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed on a small RNA chip in a bioanalyzer.

[0268] Example 3: Synthesis of 100-mer sequences on an oligonucleotide synthesis apparatus 100-polymer polynucleotides ("100-polymer polynucleotide"; SEQ ID NO: 641) were synthesized on two different silicon chips (the first chip was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, and the second chip was functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane) using the same process as described in Example 2 for synthesizing the 50-polymer sequence. The # represents thymidine-succinyl hexaamide CED phosphoramide (CLP-2244 from ChemGenes). The polynucleotides extracted from the surface were analyzed on a bioanalytical instrument.

[0269] Further PCR amplification of all ten samples from two chips was performed using the following thermal cycling procedure with forward primer (5'ATGCGGGGTTCTCATCATC3') (SEQ ID NO:642) and reverse primer (5'CGGGATCCTTATCGTCATCG3') (SEQ ID NO:643) in 50 μL PCR mixture (25 μL NEB Q5 premix, 2.5 μL 10 μM forward primer, 2.5 μL 10 μM reverse primer, 1 μL surface-extracted polynucleotides, and up to 50 μL water): 98℃, 30 sec 98℃, 10 sec; 63℃, 10 sec; 72℃, 10 sec; repeat 12 cycles. 72℃, 2min The PCR products were also run on a bioanalyzer, exhibiting a sharp peak at the 100-mer position. Next, the PCR-amplified samples were cloned and subjected to Sanger sequencing. Table 3 summarizes the Sanger sequencing results of samples taken from spots 1-5 of chip 1 and samples taken from spots 6-10 of chip 2.

[0270] Table 3: Sequencing Results

[0271] Therefore, the high quality and uniformity of polynucleotides synthesized repeatedly on two chips with different surface chemistry properties were achieved. Overall, 89% of the sequenced 100-mers were error-free perfect sequences, corresponding to 233 out of 262.

[0272] Table 4 summarizes the error characteristics of sequences obtained from polynucleotide samples from spots 1-10.

[0273] Table 4: Error Characteristics

[0274] Example 4: Antibody library of SIGLEC-8 Two expression boxes designed for SIGLEC-8, pTT5-SIGLEC-8 P2A mVenus ( Figure 6A ) and pTT5-SIGLEC-8 mVenus ( Figure 6B This was done to determine the transient expression profile and localization of SIGLEC-8. SIGLEC-8 was shown to be localized to the membrane ( Figure 6C-6E Transient expression of SIGLEC-8 was verified using a control antibody. Figure 6F-6G ).

[0275] A synthetic antibody library was developed, and SIGLEC-8 candidates were screened in four rounds using a bead-based panning strategy. Figures 7A-7B The clone ELISA screening identified a total of 52 unique clones in the third and fourth rounds of selection. Figures 8A-8C SIGLEC-8 antibody was expressed and purified for further assays. Figures 9A-9C ).

[0276] Dynamics studies using Carterra SPR ( Figures 10A-10B Titration assays showed specific binding to the transient system and demonstrated affinity for K. D correlation ( Figure 11A-11O Cross-reactivity profiles with relevant SIGLEC proteins were evaluated using SPR. Figure 12A-12B Identification of sub-nanomolar clones of SIGLEC-8 ( Figures 13A-13B The cross-reactivity of SIGLEC-8 mAb with other SIGLEC proteins was tested. Figure 13C The SIGLEC-8 lead was divided into boxes. Figure 14A ), and compare the correlation of SIGLEC-8 lead compounds ( Figure 14B When compared to lezarelimab (a known monoclonal antibody targeting SIGLEC-8), the antibodies disclosed in this paper (such as antibody SIGLEC-8-40) have been shown to target the same SIGLEC-8 epitope as lezarelimab. Figures 15A-15B ).

[0277] The binding affinity and cell-binding EC50 of the SIGLEC-8 antibody are summarized in Table 5.

[0278] Table 5: SIGLEC-8 antibody binding affinity and cell binding

[0279]

[0280] Example 5: Antibody library of CD117 Two expression boxes designed for CD117, pTT5-CD117 P2A mVenus ( Figure 16A ) and pTT5-CD117mVenus ( Figure 16B This was done to determine the transient expression profile and localization of CD117. CD117 was shown to be localized to the membrane ( Figure 6C and Figure 16C-16D ).

[0281] A synthetic antibody library was developed, and CD117 candidates were screened in five rounds using a bead-based panning strategy. Figures 18A-18BNGS analysis of CD117 panning phage output showed an increase in cluster enrichment from round 4 to round 5. Figures 19A-19B CDR3 enrichment was also observed throughout the entire selection round. Figure 19C-19E ).

[0282] Transient expression of CD117 was verified using the control antibody Expi293. Figures 17A-17B 48 hours post-transfection, the primary antibody Expi293 was transiently transfected with CD117. The secondary antibody used was APC goat anti-human IgG (1:400 dilution). 100,000 cells per well were blocked with 1x PBS + 0.5% BSA for 1 hour, stained with 100 μL of primary antibody for 1 hour, and stained with secondary antibody for 1 hour, with three washes between each staining. Several candidates were shown to bind to the transient cell line by FACS. Figures 20A-20C ). Specific binding to FACS revealed functional screening leads for antibodies CD117-7, CD117-10, CD117-17, CD117-11, CD117-18, CD117-14, and CD117-6. Figure 21A-21X Cell-bound EC50 values ​​are summarized in Table 6.

[0283] Table 6. CD117 antibody cell binding

[0284] When measured using the half-maximal effective concentration (EC50), the top hits for clonal ELISA screening were identified as CD117-2, CD117-14, CD117-6, and CD117-9. Figures 22A-22E ).

[0285] Reporter gene assays using CD117 (c-kit) were performed using stem cell factor (SCF or c-kit ligand). SCF binding to CD117 induces dimerization and subsequent activation of the ERK pathway. ERK phosphorylation leads to binding of the transcription factor serum response factor (SRF), which targets the promoter of a target gene containing a serum response element (SRE). Binding of the SRF transcription factor to the SRE results in increased cell proliferation. The functional reporter gene assays used in this study involved transient overexpression of CD117-GFP and the SRF reporter gene in HEK293T cells to screen for CD117 antibodies. SCF was titrated on cells overexpressing CD117. SCF induced an increase in SRF activation—a more than two-fold increase in signal was observed. The EC50 for SCF activation of CD117 was observed to be approximately 585 pM. Figure 23 This concentration was used to test the activity of the CD117 antibody.

[0286] Titration of four CD117 control antibodies against a standard 585 pM SCF concentration ( Figure 24A All four controls showed strong inhibition of SRF reporter gene activity. The SIGLEC-8 antibody, used as a control, showed no effect on SRF signaling. In another control experiment, neither the CD117 antibody nor the SIGLEC-8 antibody showed any effect on EGF signaling. Figure 24B ).

[0287] Preliminary screening of apex agonists was performed using cells stimulated with 10 nM SCF. The identified apex blockers included CD117-6, CD117-7, CD117-10, CD117-11, CD117-14, CD117-17, CD117-18, CD117-79, CD117-125, CD117-131, and CD117-150. Figures 25A-25B However, MFI binding analysis showed that the top binder was not the top antagonist. Figure 25C Transcriptional reporter gene assays demonstrated the ability to readily measure the functional activity of additional CD117 antibodies, as SRF reporter gene expression showed a robust increase upon stimulation of HEK cells overexpressing CD117 with SCF. This response was suppressed in control assays. Figures 26A-26B Additionally, the EC50 for CD117 activation was found to be approximately 10 nM, and this concentration was used to test the activity of the top lead compounds (CD117-6, CD117-7, CD117-10, CD117-11, CD117-14, CD117-17, CD117-18, CD117-79, CD117-125, CD117-131, and CD117-150).

[0288] Potential antagonists were subjected to secondary screening titration. Binding was tested on top candidates CD117-1, CD117-2, CD117-6, CD117-7, and CD117-14 to determine the concentration (IC50) of the antigen blocking antibody-phage binding to the immobilized antigen. Figures 27A-27D and Figures 28A-28H The first three antagonists identified were CD117-6, CD117-7, and CD117-14.

[0289] To further evaluate the antibodies identified during screening, 21 clones were selected for detailed characterization, and their target binding kinetics were analyzed using a Carterra SPR instrument. The binding kinetics of the anti-CD117 antibody to human CD117, cynomolgus monkey CD117, and mouse CD117 are shown below. Figures 29A-29B middle.

[0290] The classic epitope binning of CD117 was also used to evaluate the CD117 epitope binning. Table 7 shows the epitope binning of the anti-CD117 antibody. For comparison, epitope binning was also performed on four prior art antibodies, and it was found that they bind to different epitopes with the anti-CD117 antibody presented herein.

[0291] Table 7. CD117 Tabletop Box

[0292] Example 6. Efficacy of SIGLEC-8 antibody in a mouse asthma model Ovalbumin (OVA) + Al(OH)3-induced asthma mouse model: During the asthma-inducing sensitization phase, OVA + Al(OH)3 was administered intraperitoneally on days 0, 7, and 14, followed by intranasal administration of 2% OVA for 30 min daily on days 22–25 during the challenge phase. Six different test groups, each consisting of 8 animals, were evaluated, as summarized in Table 8.

[0293] Table 8. Experimental Design

[0294] BIW = twice a week; IP = intraperitoneal injection Mice (n=8 / group) were injected with SIGLEC-8 antibody or control on days 21 and 24 according to the dosing regimen in Table 6. The number of leukocytes and eosinophils, and the ratio of eosinophils to CD45+ cells from bronchoalveolar lavage fluid (BALF) were assessed. Serum OVA / HDM-specific IgE / total IgE was also measured. Results are shown in... Figures 30-40 middle.

[0295] The frequency of mCD45+ cells in living cells is shown in Figure 30 In A, the number of mCD45+ cells per milliliter of BALF is shown in Figure 30 In B, SIGLEC-8-55 administration resulted in a significantly higher percentage of mCD45+ cells in viable cells compared to the isotype control group. Each SIGLEC-8 antibody group (and positive control) resulted in significantly lower mCD45+ cells / mL BALF compared to the isotype control group.

[0296] The frequency of mCD3+ cells in mCD45+ is shown in Figure 31 In A, the number of mCD3+ cells per milliliter of BALF is shown in Figure 31In B, compared with the isotype control group, SIGLEC-8-33 administration resulted in a significantly higher percentage of mCD3+ cells in mCD45+ cells. SIGLEC-55 or SIGLEC-61 administration resulted in significantly lower mCD3+ cells / mL BALF compared to the isotype control group.

[0297] The frequency of mCD3- cells in mCD45+ is shown in Figure 32 In A, the number of mCD3- cells per milliliter of BALF is shown in Figure 32 In B, compared with the isotype control, SIGLEC-8-33 administration resulted in a significantly lower percentage of mCD3- cells in CD45+ cells, and all SIGLEC-8 antibody groups except SIGLEC-8-55 resulted in significantly lower mCD3- cells / mL compared with the isotype control.

[0298] The frequency of NK cells in mCD3- is shown in Figure 33 In A, the number of NK cells per milliliter of BALF is shown in Figure 33 In B, all SIGLEC-8 antibodies resulted in significantly lower NK cells / mL BALF compared to the isotype control.

[0299] The frequency of Siglec-F+ cells in mCD3- is shown to be Figure 34 In A, the number of Siglec-F+ cells per ml of BALF is shown in Figure 34 In B, compared with the isotype control, administration of SIGLEC-8-33 resulted in a significantly lower percentage of Siglec-F+ cells in CD3- cells, while compared with the isotype control, all SIGLEC 8 antibodies except SIGLEC-8-55 resulted in a significantly lower Siglec-F+ cell / mL BALF.

[0300] Serum IgE levels were evaluated by ELISA and shown on [the following diagram / image]. Figure 35 In mice, administration of SIGLEC-8 antibody did not significantly reduce anti-OVA IgE levels.

[0301] The frequency of mCD19+ cells in mCD3- is shown in Figure 36 In A, the number of mCD19+ cells per milliliter of BALF is shown in Figure 36 In group B, no significant differences were observed between the SIGLEC-8 antibody group and the isotype control.

[0302] The frequency of mCD11b+ cells in CD3- cells is shown in Figure 37 In A, the number of mCD11b+ cells is shown in Figure 37In B, compared with the isotype control, administration of SIGLEC-8-33 resulted in a significantly higher percentage of mCD11b+ cells. Administration of SIGLEC-8-55 and SIGLEC-8-61 resulted in significantly lower mCD11b+ cells / mL BALF compared to the isotype control.

[0303] The frequency of macrophages (F4 / 80+) in mCD11b+ cells is shown in Figure 38 In A, the number of macrophages (F4 / 80+) is shown in Figure 38 In B, compared with the isotype control, administration of SIGLEC-8-55 or SIGLEC-8-61 resulted in a significantly higher percentage of macrophages in mCD11b+ cells.

[0304] The frequency of mCD11c+ cells in mCD45+ cells is shown in Figure 39 In A, the number of mCD11c+ cells is shown in Figure 39 In group B, no significant differences were observed between the SIGLEC-8 antibody group and the isotype control.

[0305] The frequency of macrophages (F4 / 80+) in mCD11c+ cells is shown in Figure 40 In A, the number of macrophages (F4 / 80+) in mCD11c+ cells is shown in Figure 40 In B, administration of SIGLEC-8-40, SIGLEC-8-55, or SIGLEC-8-61 resulted in a significantly higher percentage of macrophages in mCD11c+ cells compared to the isotype control.

[0306] Example 7. Exemplary Sequence The sequence of SIGLEC-8 immunoglobulin is shown in Table 9. The sequence of CD117 immunoglobulin is shown in Table 10.

[0307] Table 9. SIGLEC-8 sequences

[0308]

[0309]

[0310]

[0311]

[0312]

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341] Table 10. CD117 sequence

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360] While preferred embodiments of this disclosure have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Many variations, modifications, and substitutions will now occur to those skilled in the art without departing from this disclosure. It should be understood that various alternatives to the embodiments of this disclosure described herein can be used to implement this disclosure. This means that the following claims define the scope of this disclosure and therefore cover the methods and structures within the scope of these claims and their equivalents.

Claims

1. An antibody or antigen-binding fragment thereof that binds to sialic acid-binding immunoglobulin-like lectin 8 (SIGLEC-8), wherein the antibody or antigen-binding fragment thereof comprises: a) Heavy chain complementarity-determining region 1 (HCDR1) comprising the amino acid sequence of SEQ ID NO: 1, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 1; Heavy chain complementarity-determining region 2 (HCDR2) comprising the amino acid sequence of SEQ ID NO: 51, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 51; Heavy chain complementarity-determining region 3 (HCDR3) comprising the amino acid sequence of SEQ ID NO: 101, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 101; Light chain complementarity-determining region 1 (LCDR1) comprising the amino acid sequence of SEQ ID NO: 201, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 201; Light chain complementarity-determining region 2 (LCDR2) comprising the amino acid sequence of SEQ ID NO: 251, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 251; and comprising SEQ ID NO: The light chain complementarity-determining region 3 (LCDR3) of the amino acid sequence of SEQ ID NO: 301, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 301; b) HCDR1 containing the amino acid sequence of SEQ ID NO: 2, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2; HCDR2 containing the amino acid sequence of SEQ ID NO: 52, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 52; HCDR3 containing the amino acid sequence of SEQ ID NO: 102, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 102; LCDR1 containing the amino acid sequence of SEQ ID NO: 202, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 202; LCDR2 containing the amino acid sequence of SEQ ID NO: 252, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 252; and LCDR3 containing the amino acid sequence of SEQ ID NO: 302, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

302. c) HCDR1 containing the amino acid sequence of SEQ ID NO: 3, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 3; HCDR2 containing the amino acid sequence of SEQ ID NO: 53, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 53; HCDR3 containing the amino acid sequence of SEQ ID NO: 103, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 103; LCDR1 containing the amino acid sequence of SEQ ID NO: 203, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 203; LCDR2 containing the amino acid sequence of SEQ ID NO: 253, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 253; and LCDR3 containing the amino acid sequence of SEQ ID NO: 303, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

303. d) HCDR1 containing the amino acid sequence of SEQ ID NO: 4, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 4; HCDR2 containing the amino acid sequence of SEQ ID NO: 54, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 54; HCDR3 containing the amino acid sequence of SEQ ID NO: 104, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 104; LCDR1 containing the amino acid sequence of SEQ ID NO: 204, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 204; LCDR2 containing the amino acid sequence of SEQ ID NO: 254, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 254; and LCDR3 containing the amino acid sequence of SEQ ID NO: 304, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

304. e) HCDR1 containing the amino acid sequence of SEQ ID NO: 5, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 5; HCDR2 containing the amino acid sequence of SEQ ID NO: 55, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 55; HCDR3 containing the amino acid sequence of SEQ ID NO: 105, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 105; LCDR1 containing the amino acid sequence of SEQ ID NO: 205, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 205; LCDR2 containing the amino acid sequence of SEQ ID NO: 255, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 255; and LCDR3 containing the amino acid sequence of SEQ ID NO: 305, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

305. f) HCDR1 containing the amino acid sequence of SEQ ID NO: 6, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 6; HCDR2 containing the amino acid sequence of SEQ ID NO: 56, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 56; HCDR3 containing the amino acid sequence of SEQ ID NO: 106, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 106; LCDR1 containing the amino acid sequence of SEQ ID NO: 206, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 206; LCDR2 containing the amino acid sequence of SEQ ID NO: 256, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 256; and LCDR3 containing the amino acid sequence of SEQ ID NO: 306, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

306. g) HCDR1 containing the amino acid sequence of SEQ ID NO: 7, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 7; HCDR2 containing the amino acid sequence of SEQ ID NO: 57, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 57; HCDR3 containing the amino acid sequence of SEQ ID NO: 107, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 107; LCDR1 containing the amino acid sequence of SEQ ID NO: 207, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 207; LCDR2 containing the amino acid sequence of SEQ ID NO: 257, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 257; and LCDR3 containing the amino acid sequence of SEQ ID NO: 307, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

307. h) HCDR1 containing the amino acid sequence of SEQ ID NO: 8, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 8; HCDR2 containing the amino acid sequence of SEQ ID NO: 58, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 58; HCDR3 containing the amino acid sequence of SEQ ID NO: 108, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 108; LCDR1 containing the amino acid sequence of SEQ ID NO: 208, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 208; LCDR2 containing the amino acid sequence of SEQ ID NO: 258, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 258; and LCDR3 containing the amino acid sequence of SEQ ID NO: 308, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

308. i) HCDR1 containing the amino acid sequence of SEQ ID NO: 9, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 9; HCDR2 containing the amino acid sequence of SEQ ID NO: 59, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 59; HCDR3 containing the amino acid sequence of SEQ ID NO: 109, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 109; LCDR1 containing the amino acid sequence of SEQ ID NO: 209, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 209; LCDR2 containing the amino acid sequence of SEQ ID NO: 259, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 259; and LCDR3 containing the amino acid sequence of SEQ ID NO: 309, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

309. j) HCDR1 containing the amino acid sequence of SEQ ID NO: 10, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 10; HCDR2 containing the amino acid sequence of SEQ ID NO: 60, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 60; HCDR3 containing the amino acid sequence of SEQ ID NO: 110, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 110; LCDR1 containing the amino acid sequence of SEQ ID NO: 210, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 210; LCDR2 containing the amino acid sequence of SEQ ID NO: 260, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 260; and LCDR3 containing the amino acid sequence of SEQ ID NO: 310, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

310. k) HCDR1 containing the amino acid sequence of SEQ ID NO: 11, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 11; HCDR2 containing the amino acid sequence of SEQ ID NO: 61, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 61; HCDR3 containing the amino acid sequence of SEQ ID NO: 111, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 111; LCDR1 containing the amino acid sequence of SEQ ID NO: 211, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 211; LCDR2 containing the amino acid sequence of SEQ ID NO: 261, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 261; and LCDR3 containing the amino acid sequence of SEQ ID NO: 311, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

311. l) HCDR1 containing the amino acid sequence of SEQ ID NO: 12, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 12; HCDR2 containing the amino acid sequence of SEQ ID NO: 62, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 62; HCDR3 containing the amino acid sequence of SEQ ID NO: 112, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 112; LCDR1 containing the amino acid sequence of SEQ ID NO: 212, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 212; LCDR2 containing the amino acid sequence of SEQ ID NO: 262, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 262; and LCDR3 containing the amino acid sequence of SEQ ID NO: 312, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

312. m) HCDR1 containing the amino acid sequence of SEQ ID NO: 13, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 13; HCDR2 containing the amino acid sequence of SEQ ID NO: 63, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 63; HCDR3 containing the amino acid sequence of SEQ ID NO: 113, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 113; LCDR1 containing the amino acid sequence of SEQ ID NO: 213, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 213; LCDR2 containing the amino acid sequence of SEQ ID NO: 263, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 263; and LCDR3 containing the amino acid sequence of SEQ ID NO: 313, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

313. n) HCDR1 containing the amino acid sequence of SEQ ID NO: 14, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 14; HCDR2 containing the amino acid sequence of SEQ ID NO: 64, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 64; HCDR3 containing the amino acid sequence of SEQ ID NO: 114, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 114; LCDR1 containing the amino acid sequence of SEQ ID NO: 214, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 214; LCDR2 containing the amino acid sequence of SEQ ID NO: 264, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 264; and LCDR3 containing the amino acid sequence of SEQ ID NO: 314, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

314. o) HCDR1 containing the amino acid sequence of SEQ ID NO: 15, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 15; HCDR2 containing the amino acid sequence of SEQ ID NO: 65, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 65; HCDR3 containing the amino acid sequence of SEQ ID NO: 115, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 115; LCDR1 containing the amino acid sequence of SEQ ID NO: 215, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 215; LCDR2 containing the amino acid sequence of SEQ ID NO: 265, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 265; and LCDR3 containing the amino acid sequence of SEQ ID NO: 315, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

315. p) HCDR1 containing the amino acid sequence of SEQ ID NO: 16, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 16; HCDR2 containing the amino acid sequence of SEQ ID NO: 66, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 66; HCDR3 containing the amino acid sequence of SEQ ID NO: 116, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 116; LCDR1 containing the amino acid sequence of SEQ ID NO: 216, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 216; LCDR2 containing the amino acid sequence of SEQ ID NO: 266, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 266; and LCDR3 containing the amino acid sequence of SEQ ID NO: 316, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

316. q) HCDR1 containing the amino acid sequence of SEQ ID NO: 17, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 17; HCDR2 containing the amino acid sequence of SEQ ID NO: 67, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 67; HCDR3 containing the amino acid sequence of SEQ ID NO: 117, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 117; LCDR1 containing the amino acid sequence of SEQ ID NO: 217, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 217; LCDR2 containing the amino acid sequence of SEQ ID NO: 267, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 267; and LCDR3 containing the amino acid sequence of SEQ ID NO: 317, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

317. r) HCDR1 containing the amino acid sequence of SEQ ID NO: 18, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 18; HCDR2 containing the amino acid sequence of SEQ ID NO: 68, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 68; HCDR3 containing the amino acid sequence of SEQ ID NO: 118, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 118; LCDR1 containing the amino acid sequence of SEQ ID NO: 218, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 218; LCDR2 containing the amino acid sequence of SEQ ID NO: 268, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 268; and LCDR3 containing the amino acid sequence of SEQ ID NO: 318, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

318. s) HCDR1 containing the amino acid sequence of SEQ ID NO: 19, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 19; HCDR2 containing the amino acid sequence of SEQ ID NO: 69, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 69; HCDR3 containing the amino acid sequence of SEQ ID NO: 119, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 119; LCDR1 containing the amino acid sequence of SEQ ID NO: 219, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 219; LCDR2 containing the amino acid sequence of SEQ ID NO: 269, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 269; and LCDR3 containing the amino acid sequence of SEQ ID NO: 319, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

319. t) HCDR1 containing the amino acid sequence of SEQ ID NO: 20, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 20; HCDR2 containing the amino acid sequence of SEQ ID NO: 70, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 70; HCDR3 containing the amino acid sequence of SEQ ID NO: 120, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 120; LCDR1 containing the amino acid sequence of SEQ ID NO: 220, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 220; LCDR2 containing the amino acid sequence of SEQ ID NO: 270, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 270; and LCDR3 containing the amino acid sequence of SEQ ID NO: 320, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

320. u) HCDR1 containing the amino acid sequence of SEQ ID NO: 21, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 21; HCDR2 containing the amino acid sequence of SEQ ID NO: 71, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 71; HCDR3 containing the amino acid sequence of SEQ ID NO: 121, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 121; LCDR1 containing the amino acid sequence of SEQ ID NO: 221, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 221; LCDR2 containing the amino acid sequence of SEQ ID NO: 271, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 271; and LCDR3 containing the amino acid sequence of SEQ ID NO: 321, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

321. v) HCDR1 containing the amino acid sequence of SEQ ID NO: 22, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 22; HCDR2 containing the amino acid sequence of SEQ ID NO: 72, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 72; HCDR3 containing the amino acid sequence of SEQ ID NO: 122, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 122; LCDR1 containing the amino acid sequence of SEQ ID NO: 222, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 222; LCDR2 containing the amino acid sequence of SEQ ID NO: 272, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 272; and LCDR3 containing the amino acid sequence of SEQ ID NO: 322, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

322. w) HCDR1 containing the amino acid sequence of SEQ ID NO: 23, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 23; HCDR2 containing the amino acid sequence of SEQ ID NO: 73, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 73; HCDR3 containing the amino acid sequence of SEQ ID NO: 123, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 123; LCDR1 containing the amino acid sequence of SEQ ID NO: 223, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 223; LCDR2 containing the amino acid sequence of SEQ ID NO: 273, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 273; and LCDR3 containing the amino acid sequence of SEQ ID NO: 323, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

323. x) HCDR1 containing the amino acid sequence of SEQ ID NO: 24, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 24; HCDR2 containing the amino acid sequence of SEQ ID NO: 74, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 74; HCDR3 containing the amino acid sequence of SEQ ID NO: 124, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 124; LCDR1 containing the amino acid sequence of SEQ ID NO: 224, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 224; LCDR2 containing the amino acid sequence of SEQ ID NO: 274, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 274; and LCDR3 containing the amino acid sequence of SEQ ID NO: 324, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

324. y) HCDR1 containing the amino acid sequence of SEQ ID NO: 25, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 25; HCDR2 containing the amino acid sequence of SEQ ID NO: 75, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 75; HCDR3 containing the amino acid sequence of SEQ ID NO: 125, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 125; LCDR1 containing the amino acid sequence of SEQ ID NO: 225, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 225; LCDR2 containing the amino acid sequence of SEQ ID NO: 275, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 275; and LCDR3 containing the amino acid sequence of SEQ ID NO: 325, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

325. z) HCDR1 containing the amino acid sequence of SEQ ID NO: 26, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 26; HCDR2 containing the amino acid sequence of SEQ ID NO: 76, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 76; HCDR3 containing the amino acid sequence of SEQ ID NO: 126, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 126; LCDR1 containing the amino acid sequence of SEQ ID NO: 226, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 226; LCDR2 containing the amino acid sequence of SEQ ID NO: 276, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 276; and LCDR3 containing the amino acid sequence of SEQ ID NO: 326, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

326. aa) HCDR1 containing the amino acid sequence of SEQ ID NO: 27, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 27; HCDR2 containing the amino acid sequence of SEQ ID NO: 77, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 77; HCDR3 containing the amino acid sequence of SEQ ID NO: 127, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 127; LCDR1 containing the amino acid sequence of SEQ ID NO: 227, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 227; LCDR2 containing the amino acid sequence of SEQ ID NO: 277, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 277; and LCDR3 containing the amino acid sequence of SEQ ID NO: 327, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

327. bb) HCDR1 containing the amino acid sequence of SEQ ID NO: 28, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 28; HCDR2 containing the amino acid sequence of SEQ ID NO: 78, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 78; HCDR3 containing the amino acid sequence of SEQ ID NO: 128, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 128; LCDR1 containing the amino acid sequence of SEQ ID NO: 228, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 228; LCDR2 containing the amino acid sequence of SEQ ID NO: 278, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 278; and LCDR3 containing the amino acid sequence of SEQ ID NO: 328, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

328. cc) HCDR1 containing the amino acid sequence of SEQ ID NO: 29, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 29; HCDR2 containing the amino acid sequence of SEQ ID NO: 79, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 79; HCDR3 containing the amino acid sequence of SEQ ID NO: 129, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 129; LCDR1 containing the amino acid sequence of SEQ ID NO: 229, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 229; LCDR2 containing the amino acid sequence of SEQ ID NO: 279, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 279; and LCDR3 containing the amino acid sequence of SEQ ID NO: 329, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

329. dd) HCDR1 containing the amino acid sequence of SEQ ID NO: 30, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 30; HCDR2 containing the amino acid sequence of SEQ ID NO: 80, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 80; HCDR3 containing the amino acid sequence of SEQ ID NO: 130, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 130; LCDR1 containing the amino acid sequence of SEQ ID NO: 230, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 230; LCDR2 containing the amino acid sequence of SEQ ID NO: 280, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 280; and LCDR3 containing the amino acid sequence of SEQ ID NO: 330, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

330. (ee) HCDR1 containing the amino acid sequence of SEQ ID NO: 31, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 31; HCDR2 containing the amino acid sequence of SEQ ID NO: 81, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 81; HCDR3 containing the amino acid sequence of SEQ ID NO: 131, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 131; LCDR1 containing the amino acid sequence of SEQ ID NO: 231, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 231; LCDR2 containing the amino acid sequence of SEQ ID NO: 281, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 281; and LCDR3 containing the amino acid sequence of SEQ ID NO: 331, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

331. ff) HCDR1 containing the amino acid sequence of SEQ ID NO: 32, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 32; HCDR2 containing the amino acid sequence of SEQ ID NO: 82, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 82; HCDR3 containing the amino acid sequence of SEQ ID NO: 132, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 132; LCDR1 containing the amino acid sequence of SEQ ID NO: 232, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 232; LCDR2 containing the amino acid sequence of SEQ ID NO: 282, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 282; and LCDR3 containing the amino acid sequence of SEQ ID NO: 332, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

332. gg) HCDR1 containing the amino acid sequence of SEQ ID NO: 33, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 33; HCDR2 containing the amino acid sequence of SEQ ID NO: 83, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 83; HCDR3 containing the amino acid sequence of SEQ ID NO: 133, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 133; LCDR1 containing the amino acid sequence of SEQ ID NO: 233, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 233; LCDR2 containing the amino acid sequence of SEQ ID NO: 283, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 283; and LCDR3 containing the amino acid sequence of SEQ ID NO: 333, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

333. hh) HCDR1 containing the amino acid sequence of SEQ ID NO: 34, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 34; HCDR2 containing the amino acid sequence of SEQ ID NO: 84, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 84; HCDR3 containing the amino acid sequence of SEQ ID NO: 134, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 134; LCDR1 containing the amino acid sequence of SEQ ID NO: 234, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 234; LCDR2 containing the amino acid sequence of SEQ ID NO: 284, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 284; and LCDR3 containing the amino acid sequence of SEQ ID NO: 334, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

334. ii) HCDR1 containing the amino acid sequence of SEQ ID NO: 35, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 35; HCDR2 containing the amino acid sequence of SEQ ID NO: 85, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 85; HCDR3 containing the amino acid sequence of SEQ ID NO: 135, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 135; LCDR1 containing the amino acid sequence of SEQ ID NO: 235, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 235; LCDR2 containing the amino acid sequence of SEQ ID NO: 285, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 285; and LCDR3 containing the amino acid sequence of SEQ ID NO: 335, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

335. The following amino acids are included: HCDR1 containing the amino acid sequence of SEQ ID NO: 36, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 36; HCDR2 containing the amino acid sequence of SEQ ID NO: 86, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 86; HCDR3 containing the amino acid sequence of SEQ ID NO: 136, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 136; LCDR1 containing the amino acid sequence of SEQ ID NO: 236, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 236; LCDR2 containing the amino acid sequence of SEQ ID NO: 286, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 286; and LCDR3 containing the amino acid sequence of SEQ ID NO: 336, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

336. The following amino acids are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 37, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 37; HCDR2 containing the amino acid sequence of SEQ ID NO: 87, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 87; HCDR3 containing the amino acid sequence of SEQ ID NO: 137, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 137; LCDR1 containing the amino acid sequence of SEQ ID NO: 237, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 237; LCDR2 containing the amino acid sequence of SEQ ID NO: 287, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 287; and LCDR3 containing the amino acid sequence of SEQ ID NO: 337, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

337. ll) HCDR1 containing the amino acid sequence of SEQ ID NO: 38, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 38; HCDR2 containing the amino acid sequence of SEQ ID NO: 88, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 88; HCDR3 containing the amino acid sequence of SEQ ID NO: 138, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 138; LCDR1 containing the amino acid sequence of SEQ ID NO: 238, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 238; LCDR2 containing the amino acid sequence of SEQ ID NO: 288, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 288; and LCDR3 containing the amino acid sequence of SEQ ID NO: 338, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

338. The following amino acids are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 39, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 39; HCDR2 containing the amino acid sequence of SEQ ID NO: 89, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 89; HCDR3 containing the amino acid sequence of SEQ ID NO: 139, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 139; LCDR1 containing the amino acid sequence of SEQ ID NO: 239, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 239; LCDR2 containing the amino acid sequence of SEQ ID NO: 289, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 289; and LCDR3 containing the amino acid sequence of SEQ ID NO: 339, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

339. nn) HCDR1 containing the amino acid sequence of SEQ ID NO: 40, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 40; HCDR2 containing the amino acid sequence of SEQ ID NO: 90, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 90; HCDR3 containing the amino acid sequence of SEQ ID NO: 140, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 140; LCDR1 containing the amino acid sequence of SEQ ID NO: 240, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 240; LCDR2 containing the amino acid sequence of SEQ ID NO: 290, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 290; and LCDR3 containing the amino acid sequence of SEQ ID NO: 340, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

340. oo) HCDR1 containing the amino acid sequence of SEQ ID NO: 41, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 41; HCDR2 containing the amino acid sequence of SEQ ID NO: 91, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 91; HCDR3 containing the amino acid sequence of SEQ ID NO: 141, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 141; LCDR1 containing the amino acid sequence of SEQ ID NO: 241; LCDR2 containing the amino acid sequence of SEQ ID NO: 291, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 291; and LCDR3 containing the amino acid sequence of SEQ ID NO: 341, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 341; pp) HCDR1 containing the amino acid sequence of SEQ ID NO: 42, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 42; HCDR2 containing the amino acid sequence of SEQ ID NO: 92, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 92; HCDR3 containing the amino acid sequence of SEQ ID NO: 142, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 142; LCDR1 containing the amino acid sequence of SEQ ID NO: 242, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 242; LCDR2 containing the amino acid sequence of SEQ ID NO: 292, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 292; and LCDR3 containing the amino acid sequence of SEQ ID NO: 342, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

342. The following amino acids are included: HCDR1 containing the amino acid sequence of SEQ ID NO: 43, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 43; HCDR2 containing the amino acid sequence of SEQ ID NO: 93, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 93; HCDR3 containing the amino acid sequence of SEQ ID NO: 143, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 143; LCDR1 containing the amino acid sequence of SEQ ID NO: 243, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 243; LCDR2 containing the amino acid sequence of SEQ ID NO: 293, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 293; and LCDR3 containing the amino acid sequence of SEQ ID NO: 343, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

343. The following are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 44, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 44; HCDR2 containing the amino acid sequence of SEQ ID NO: 94, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 94; HCDR3 containing the amino acid sequence of SEQ ID NO: 144, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 144; LCDR1 containing the amino acid sequence of SEQ ID NO: 244, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 244; LCDR2 containing the amino acid sequence of SEQ ID NO: 294, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 294; and LCDR3 containing the amino acid sequence of SEQ ID NO: 344, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

344. ss) HCDR1 containing the amino acid sequence of SEQ ID NO: 45, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 45; HCDR2 containing the amino acid sequence of SEQ ID NO: 95, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 95; HCDR3 containing the amino acid sequence of SEQ ID NO: 145, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 145; LCDR1 containing the amino acid sequence of SEQ ID NO: 245, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 245; LCDR2 containing the amino acid sequence of SEQ ID NO: 295, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 295; and LCDR3 containing the amino acid sequence of SEQ ID NO: 345, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

345. The following are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 46, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 46; HCDR2 containing the amino acid sequence of SEQ ID NO: 96, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 96; HCDR3 containing the amino acid sequence of SEQ ID NO: 146, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 146; LCDR1 containing the amino acid sequence of SEQ ID NO: 246, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 246; LCDR2 containing the amino acid sequence of SEQ ID NO: 296, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 296; and LCDR3 containing the amino acid sequence of SEQ ID NO: 346, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

346. The following amino acids are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 47, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 47; HCDR2 containing the amino acid sequence of SEQ ID NO: 97, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 97; HCDR3 containing the amino acid sequence of SEQ ID NO: 147, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 147; LCDR1 containing the amino acid sequence of SEQ ID NO: 247, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 247; LCDR2 containing the amino acid sequence of SEQ ID NO: 297, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 297; and LCDR3 containing the amino acid sequence of SEQ ID NO: 347, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

347. vv) HCDR1 containing the amino acid sequence of SEQ ID NO: 48, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 48; HCDR2 containing the amino acid sequence of SEQ ID NO: 98, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 98; HCDR3 containing the amino acid sequence of SEQ ID NO: 148, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 148; LCDR1 containing the amino acid sequence of SEQ ID NO: 248, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 248; LCDR2 containing the amino acid sequence of SEQ ID NO: 298, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 298; and LCDR3 containing the amino acid sequence of SEQ ID NO: 348, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

348. The following amino acids are included in the following categories: HCDR1 containing the amino acid sequence of SEQ ID NO: 49, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 49; HCDR2 containing the amino acid sequence of SEQ ID NO: 99, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 99; HCDR3 containing the amino acid sequence of SEQ ID NO: 149, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 149; LCDR1 containing the amino acid sequence of SEQ ID NO: 249, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 249; LCDR2 containing the amino acid sequence of SEQ ID NO: 299, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 299; and LCDR3 containing the amino acid sequence of SEQ ID NO: 349, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 349; or xx) HCDR1 containing the amino acid sequence of SEQ ID NO: 50, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 50; HCDR2 containing the amino acid sequence of SEQ ID NO: 100, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 100; HCDR3 containing the amino acid sequence of SEQ ID NO: 150, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 150; LCDR1 containing the amino acid sequence of SEQ ID NO: 250, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 250; LCDR2 containing the amino acid sequence of SEQ ID NO: 300, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 300; and LCDR3 containing the amino acid sequence of SEQ ID NO: 350, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

350.

2. An antibody or antigen-binding fragment thereof that binds to sialic acid-binding immunoglobulin-like lectin 8 (SIGLEC-8), wherein the antibody or antigen-binding fragment thereof comprises: a) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 151 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 351; b) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 152 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 352; c) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 153 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 353; d) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 154 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 354; e) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 155 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 355; f) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 156 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 356; g) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 157 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 357; h) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 158 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 358; i) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 159 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 359; j) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 160 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 360; k) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 161 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 361; l) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 162 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 362; m) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 163 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 363; n) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 164 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 364; o) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 165 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 365; p) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 166 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 366; q) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 167 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 367; r) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 168 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 368; s) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 169 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 369; t) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 170 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 370; u) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 171 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 371; v) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 172 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 372; w) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 173 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 373; x) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 174 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 374; y) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 175 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 375; z) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 176 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 376; aa) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 177 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 377; bb) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 178 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 378; cc) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 179 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 379; (dd) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 180 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 380; (ee) VH containing at least 90% or at least 95% of the amino acid sequence identical to the amino acid sequence of SEQ ID NO: 181 and VL containing at least 90% or at least 95% of the amino acid sequence identical to the amino acid sequence of SEQ ID NO: 381; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 182, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 382; VH, which contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 183, and VL, which contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 383; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 184, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

384. ii) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 185 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 385; (jj) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 186 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 386; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 187, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

387. ll) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 188 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 388; VH (mm) contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 189, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 389; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 190, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 390; oo) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 191 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 391; pp) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 192 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 392; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 193, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 393; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 194, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 394; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 195, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 395; VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 196, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 396; The VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 197, and the VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

397. VH contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 198, and VL contains an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

398. VH, which contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 199, and VL, which contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 399; or xx) VH containing at least 90% or at least 95% of the amino acid sequence identical to the amino acid sequence of SEQ ID NO: 200 and VL containing at least 90% or at least 95% of the amino acid sequence identical to the amino acid sequence of SEQ ID NO:

400.

3. The antibody or antigen-binding fragment thereof as claimed in claim 1 or claim 2, wherein the antibody or antigen-binding fragment thereof is a humanized or chimeric antibody or antigen-binding fragment thereof.

4. The antibody or antigen-binding fragment thereof as claimed in claim 2, wherein the antigen or antigen-binding fragment thereof comprises: a) VH containing the amino acid sequence of SEQ ID NO: 151 and VL containing the amino acid sequence of SEQ ID NO: 351; b) VH containing the amino acid sequence of SEQ ID NO: 152 and VL containing the amino acid sequence of SEQ ID NO: 352; c) VH containing the amino acid sequence of SEQ ID NO: 153 and VL containing the amino acid sequence of SEQ ID NO: 353; d) VH containing the amino acid sequence of SEQ ID NO: 154 and VL containing the amino acid sequence of SEQ ID NO: 354; e) VH containing the amino acid sequence of SEQ ID NO: 155 and VL containing the amino acid sequence of SEQ ID NO: 355; f) VH containing the amino acid sequence of SEQ ID NO: 156 and VL containing the amino acid sequence of SEQ ID NO: 356; g) VH containing the amino acid sequence of SEQ ID NO: 157 and VL containing the amino acid sequence of SEQ ID NO: 357; h) VH containing the amino acid sequence of SEQ ID NO: 158 and VL containing the amino acid sequence of SEQ ID NO: 358; i) VH containing the amino acid sequence of SEQ ID NO: 159 and VL containing the amino acid sequence of SEQ ID NO: 359; j) VH containing the amino acid sequence of SEQ ID NO: 160 and VL containing the amino acid sequence of SEQ ID NO: 360; k) VH containing the amino acid sequence of SEQ ID NO: 161 and VL containing the amino acid sequence of SEQ ID NO: 361; l) VH containing the amino acid sequence of SEQ ID NO: 162 and VL containing the amino acid sequence of SEQ ID NO: 362; m) VH containing the amino acid sequence of SEQ ID NO: 163 and VL containing the amino acid sequence of SEQ ID NO: 363; n) VH containing the amino acid sequence of SEQ ID NO: 164 and VL containing the amino acid sequence of SEQ ID NO: 364; o) VH containing the amino acid sequence of SEQ ID NO: 165 and VL containing the amino acid sequence of SEQ ID NO: 365; p) VH containing the amino acid sequence of SEQ ID NO: 166 and VL containing the amino acid sequence of SEQ ID NO: 366; q) VH containing the amino acid sequence of SEQ ID NO: 167 and VL containing the amino acid sequence of SEQ ID NO: 367; r) VH containing the amino acid sequence of SEQ ID NO: 168 and VL containing the amino acid sequence of SEQ ID NO: 368; s) VH containing the amino acid sequence of SEQ ID NO: 169 and VL containing the amino acid sequence of SEQ ID NO: 369; t) VH containing the amino acid sequence of SEQ ID NO: 170 and VL containing the amino acid sequence of SEQ ID NO: 370; u) VH containing the amino acid sequence of SEQ ID NO: 171 and VL containing the amino acid sequence of SEQ ID NO: 371; v) VH containing the amino acid sequence of SEQ ID NO: 172 and VL containing the amino acid sequence of SEQ ID NO: 372; w) VH containing the amino acid sequence of SEQ ID NO: 173 and VL containing the amino acid sequence of SEQ ID NO: 373; x) VH containing the amino acid sequence of SEQ ID NO: 174 and VL containing the amino acid sequence of SEQ ID NO: 374; y) VH containing the amino acid sequence of SEQ ID NO: 175 and VL containing the amino acid sequence of SEQ ID NO: 375; z) VH containing the amino acid sequence of SEQ ID NO: 176 and VL containing the amino acid sequence of SEQ ID NO: 376; aa) VH containing the amino acid sequence of SEQ ID NO: 177 and VL containing the amino acid sequence of SEQ ID NO: 377; bb) VH containing the amino acid sequence of SEQ ID NO: 178 and VL containing the amino acid sequence of SEQ ID NO: 378; cc) VH containing the amino acid sequence of SEQ ID NO: 179 and VL containing the amino acid sequence of SEQ ID NO: 379; (dd) VH containing the amino acid sequence of SEQ ID NO: 180 and VL containing the amino acid sequence of SEQ ID NO: 380; (ee) VH containing the amino acid sequence of SEQ ID NO: 181 and VL containing the amino acid sequence of SEQ ID NO: 381; VH containing the amino acid sequence of SEQ ID NO: 182 and VL containing the amino acid sequence of SEQ ID NO: 382; gg) VH containing the amino acid sequence of SEQ ID NO: 183 and VL containing the amino acid sequence of SEQ ID NO: 383; VH, containing the amino acid sequence of SEQ ID NO: 184, and VL, containing the amino acid sequence of SEQ ID NO: 384; ii) VH containing the amino acid sequence of SEQ ID NO: 185 and VL containing the amino acid sequence of SEQ ID NO: 385; (jj) VH containing the amino acid sequence of SEQ ID NO: 186 and VL containing the amino acid sequence of SEQ ID NO: 386; VH containing the amino acid sequence of SEQ ID NO: 187 and VL containing the amino acid sequence of SEQ ID NO: 387; ll) VH containing the amino acid sequence of SEQ ID NO: 188 and VL containing the amino acid sequence of SEQ ID NO: 388; VH containing the amino acid sequence of SEQ ID NO: 189 and VL containing the amino acid sequence of SEQ ID NO: 389; VH, containing the amino acid sequence of SEQ ID NO: 190, and VL, containing the amino acid sequence of SEQ ID NO: 390; oo) VH containing the amino acid sequence of SEQ ID NO: 191 and VL containing the amino acid sequence of SEQ ID NO: 391; pp) VH containing the amino acid sequence of SEQ ID NO: 192 and VL containing the amino acid sequence of SEQ ID NO: 392; VH, containing the amino acid sequence of SEQ ID NO: 193, and VL, containing the amino acid sequence of SEQ ID NO: 393; rr) VH containing the amino acid sequence of SEQ ID NO: 194 and VL containing the amino acid sequence of SEQ ID NO: 394; VH, which contains the amino acid sequence of SEQ ID NO: 195, and VL, which contains the amino acid sequence of SEQ ID NO: 395; VH, containing the amino acid sequence of SEQ ID NO: 196, and VL, containing the amino acid sequence of SEQ ID NO: 396; uu) VH containing the amino acid sequence of SEQ ID NO: 197 and VL containing the amino acid sequence of SEQ ID NO: 397; VH, which contains the amino acid sequence of SEQ ID NO: 198, and VL, which contains the amino acid sequence of SEQ ID NO: 398; ww) VH containing the amino acid sequence of SEQ ID NO: 199 and VL containing the amino acid sequence of SEQ ID NO: 399; or xx) VH containing the amino acid sequence of SEQ ID NO: 200 and VL containing the amino acid sequence of SEQ ID NO:

400.

5. An antibody or antigen-binding fragment thereof that binds to sialic acid-binding immunoglobulin-like lectin 8 (SIGLEC-8), wherein the antibody or antigen-binding fragment thereof comprises: a) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 650 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

700. b) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 651 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

701. c) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 652 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 702; d) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 653 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 703; e) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 654 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

704. f) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 655 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

705. g) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 656 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

706. h) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 657 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

707. i) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 658 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

708. j) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 659 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

709. k) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 660 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

710. l) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 661 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

711. m) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 662 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

712. n) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 663 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

713. o) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 664 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

714. p) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 665 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

715. q) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 666 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 716; r) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 667 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

717. s) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 668 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 718; t) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 669 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 719; u) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 670 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

720. v) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 671 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

721. w) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 672 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 722; x) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 673 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 723; y) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 674 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 724; z) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 675 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

725. aa) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 676 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

726. bb) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 677 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 727; cc) a heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 678 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 728; (dd) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 679 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 729; (ee) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 680 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 730; ff) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 681 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 731; gg) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 682 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 732; (hh) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 683 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

733. ii) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 684 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 734; jj) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 685 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

735. kk) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 686 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

736. ll) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 687 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 737; The heavy chain (mm) contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 688, and the light chain contains at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

738. nn) a heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 689 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 739; oo) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 690 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 740; pp) a heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 691 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 741; (qq) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 692 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 742; rr) a heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 693 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 743; ss) a heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 694 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 744; (tt) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 695 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 745; uu) a heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 696 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

746. vv) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 697 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 747; ww) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 698, and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 748; or xx) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 699 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

749.

6. The antibody or antigen-binding fragment thereof as claimed in claim 5, wherein the antibody or antigen-binding fragment thereof comprises: a) The heavy chain containing the amino acid sequence of SEQ ID NO: 650 and the light chain containing the amino acid sequence of SEQ ID NO: 700; b) The heavy chain containing the amino acid sequence of SEQ ID NO: 651 and the light chain containing the amino acid sequence of SEQ ID NO: 701; c) The heavy chain containing the amino acid sequence of SEQ ID NO: 652 and the light chain containing the amino acid sequence of SEQ ID NO: 702; d) The heavy chain containing the amino acid sequence of SEQ ID NO: 653 and the light chain containing the amino acid sequence of SEQ ID NO: 703; e) The heavy chain containing the amino acid sequence of SEQ ID NO: 654 and the light chain containing the amino acid sequence of SEQ ID NO: 704; f) The heavy chain containing the amino acid sequence of SEQ ID NO: 655 and the light chain containing the amino acid sequence of SEQ ID NO: 705; g) A heavy chain containing the amino acid sequence of SEQ ID NO: 656 and a light chain containing the amino acid sequence of SEQ ID NO: 706; h) The heavy chain containing the amino acid sequence of SEQ ID NO: 657 and the light chain containing the amino acid sequence of SEQ ID NO: 707; i) The heavy chain containing the amino acid sequence of SEQ ID NO: 658 and the light chain containing the amino acid sequence of SEQ ID NO: 708; j) The heavy chain containing the amino acid sequence of SEQ ID NO: 659 and the light chain containing the amino acid sequence of SEQ ID NO: 709; k) The heavy chain containing the amino acid sequence of SEQ ID NO: 660 and the light chain containing the amino acid sequence of SEQ ID NO: 710; l) The heavy chain containing the amino acid sequence of SEQ ID NO: 661 and the light chain containing the amino acid sequence of SEQ ID NO: 711; m) The heavy chain containing the amino acid sequence of SEQ ID NO: 662 and the light chain containing the amino acid sequence of SEQ ID NO: 712; n) The heavy chain containing the amino acid sequence of SEQ ID NO: 663 and the light chain containing the amino acid sequence of SEQ ID NO: 713; o) The heavy chain containing the amino acid sequence of SEQ ID NO: 664 and the light chain containing the amino acid sequence of SEQ ID NO: 714; p) The heavy chain containing the amino acid sequence of SEQ ID NO: 665 and the light chain containing the amino acid sequence of SEQ ID NO: 715; q) The heavy chain containing the amino acid sequence of SEQ ID NO: 666 and the light chain containing the amino acid sequence of SEQ ID NO: 716; r) The heavy chain containing the amino acid sequence of SEQ ID NO: 667 and the light chain containing the amino acid sequence of SEQ ID NO: 717; s) The heavy chain containing the amino acid sequence of SEQ ID NO: 668 and the light chain containing the amino acid sequence of SEQ ID NO: 718; t) The heavy chain containing the amino acid sequence of SEQ ID NO: 669 and the light chain containing the amino acid sequence of SEQ ID NO: 719; u) The heavy chain containing the amino acid sequence of SEQ ID NO: 670 and the light chain containing the amino acid sequence of SEQ ID NO: 720; v) The heavy chain containing the amino acid sequence of SEQ ID NO: 671 and the light chain containing the amino acid sequence of SEQ ID NO: 721; w) The heavy chain containing the amino acid sequence of SEQ ID NO: 672 and the light chain containing the amino acid sequence of SEQ ID NO: 722; x) The heavy chain containing the amino acid sequence of SEQ ID NO: 673 and the light chain containing the amino acid sequence of SEQ ID NO: 723; y) The heavy chain containing the amino acid sequence of SEQ ID NO: 674 and the light chain containing the amino acid sequence of SEQ ID NO: 724; z) The heavy chain containing the amino acid sequence of SEQ ID NO: 675 and the light chain containing the amino acid sequence of SEQ ID NO: 725; aa) The heavy chain containing the amino acid sequence of SEQ ID NO: 676 and the light chain containing the amino acid sequence of SEQ ID NO: 726; bb) The heavy chain containing the amino acid sequence of SEQ ID NO: 677 and the light chain containing the amino acid sequence of SEQ ID NO: 727; cc) The heavy chain containing the amino acid sequence of SEQ ID NO: 678 and the light chain containing the amino acid sequence of SEQ ID NO: 728; (dd) The heavy chain containing the amino acid sequence of SEQ ID NO: 679 and the light chain containing the amino acid sequence of SEQ ID NO: 729; (ee) The heavy chain containing the amino acid sequence of SEQ ID NO: 680 and the light chain containing the amino acid sequence of SEQ ID NO: 730; ff) The heavy chain containing the amino acid sequence of SEQ ID NO: 681 and the light chain containing the amino acid sequence of SEQ ID NO: 731; gg) The heavy chain containing the amino acid sequence of SEQ ID NO: 682 and the light chain containing the amino acid sequence of SEQ ID NO: 732; (hh) The heavy chain containing the amino acid sequence of SEQ ID NO: 683 and the light chain containing the amino acid sequence of SEQ ID NO: 733; ii) The heavy chain containing the amino acid sequence of SEQ ID NO: 684 and the light chain containing the amino acid sequence of SEQ ID NO: 734; jj) The heavy chain containing the amino acid sequence of SEQ ID NO: 685 and the light chain containing the amino acid sequence of SEQ ID NO: 735; kk) The heavy chain containing the amino acid sequence of SEQ ID NO: 686 and the light chain containing the amino acid sequence of SEQ ID NO: 736; ll) The heavy chain containing the amino acid sequence of SEQ ID NO: 687 and the light chain containing the amino acid sequence of SEQ ID NO: 737; (mm) The heavy chain containing the amino acid sequence of SEQ ID NO: 688 and the light chain containing the amino acid sequence of SEQ ID NO: 738; nn) The heavy chain containing the amino acid sequence of SEQ ID NO: 689 and the light chain containing the amino acid sequence of SEQ ID NO: 739; (oo) The heavy chain containing the amino acid sequence of SEQ ID NO: 690 and the light chain containing the amino acid sequence of SEQ ID NO: 740; pp) a heavy chain containing the amino acid sequence of SEQ ID NO: 691 and a light chain containing the amino acid sequence of SEQ ID NO: 741; (qq) The heavy chain containing the amino acid sequence of SEQ ID NO: 692 and the light chain containing the amino acid sequence of SEQ ID NO: 742; rr) The heavy chain containing the amino acid sequence of SEQ ID NO: 693 and the light chain containing the amino acid sequence of SEQ ID NO: 743; ss) The heavy chain containing the amino acid sequence of SEQ ID NO: 694 and the light chain containing the amino acid sequence of SEQ ID NO: 744; (tt) The heavy chain containing the amino acid sequence of SEQ ID NO: 695 and the light chain containing the amino acid sequence of SEQ ID NO: 745; uu) The heavy chain containing the amino acid sequence of SEQ ID NO: 696 and the light chain containing the amino acid sequence of SEQ ID NO: 746; vv) The heavy chain containing the amino acid sequence of SEQ ID NO: 697 and the light chain containing the amino acid sequence of SEQ ID NO: 747; ww) The heavy chain containing the amino acid sequence of SEQ ID NO: 698 and the light chain containing the amino acid sequence of SEQ ID NO: 748; or xx) The heavy chain containing the amino acid sequence of SEQ ID NO: 699 and the light chain containing the amino acid sequence of SEQ ID NO:

749.

7. The antibody or antigen-binding fragment thereof as described in any one of claims 1-6, wherein it is a monoclonal antibody or antigen-binding fragment thereof.

8. The antibody or antigen-binding fragment thereof as claimed in any one of claims 1-7, wherein the antibody is a monospecific antibody, a bispecific antibody or a multispecific antibody; or wherein the antigen-binding fragment is a single-chain Fv (scFv), a disulfide-linked Fv (sdFv), a Fab fragment or an F(ab')2 fragment.

9. The antibody or antigen-binding fragment thereof as claimed in any one of claims 1-8, wherein the SIGLEC-8 is human SIGLEC-8.

10. The antibody or antigen-binding fragment thereof as claimed in any one of claims 1-9, wherein the antibody or antigen-binding fragment thereof is in a Kc of less than 75 nM, less than 50 nM, less than 25 nM or less than 10 nM. D Combined with SIGLEC-8.

11. An isolated nucleic acid encoding an antibody or an antigen-binding fragment thereof as described in any one of claims 1-10.

12. An expression vector comprising the nucleic acid as described in claim 11.

13. An isolated host cell comprising the nucleic acid as described in claim 11 or the expression vector as described in claim 12.

14. An isolated host cell expressing an antibody or an antigen-binding fragment thereof as described in any one of claims 1-10.

15. A method for generating an antibody or antigen-binding fragment thereof that binds to SIGLEC-8, the method comprising incubating a host cell as described in claim 13 or claim 14 under conditions suitable for generating the antibody or antigen-binding fragment thereof.

16. The method of claim 15, further comprising separating the antibody or its antigen-binding fragment.

17. An antibody or antigen-binding fragment thereof that binds to differentiation cluster 117 (CD117), wherein the antibody or antigen-binding fragment thereof comprises: a) Heavy chain complementarity-determining region 1 (HCDR1) comprising the amino acid sequence of SEQ ID NO: 451, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 451; Heavy chain complementarity-determining region 2 (HCDR2) comprising the amino acid sequence of SEQ ID NO: 472, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 472; Heavy chain complementarity-determining region 3 (HCDR3) comprising the amino acid sequence of SEQ ID NO: 493, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 493; Light chain complementarity-determining region 1 (LCDR1) comprising the amino acid sequence of SEQ ID NO: 535, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 535; Light chain complementarity-determining region 2 (LCDR2) comprising the amino acid sequence of SEQ ID NO: 556, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 556; and comprising SEQ ID NO: The light chain complementarity-determining region 3 (LCDR3) of the amino acid sequence of SEQ ID NO: 577, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 577; b) HCDR1 containing the amino acid sequence of SEQ ID NO: 452, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 452; HCDR2 containing the amino acid sequence of SEQ ID NO: 473, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 473; HCDR3 containing the amino acid sequence of SEQ ID NO: 494, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 494; LCDR1 containing the amino acid sequence of SEQ ID NO: 536, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 536; LCDR2 containing the amino acid sequence of SEQ ID NO: 557, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 557; and LCDR3 containing the amino acid sequence of SEQ ID NO: 578, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

578. c) HCDR1 containing the amino acid sequence of SEQ ID NO: 453, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 453; HCDR2 containing the amino acid sequence of SEQ ID NO: 474, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 474; HCDR3 containing the amino acid sequence of SEQ ID NO: 495, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 495; LCDR1 containing the amino acid sequence of SEQ ID NO: 537, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 537; LCDR2 containing the amino acid sequence of SEQ ID NO: 558, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 558; and LCDR3 containing the amino acid sequence of SEQ ID NO: 579, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

579. d) HCDR1 containing the amino acid sequence of SEQ ID NO: 454, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 454; HCDR2 containing the amino acid sequence of SEQ ID NO: 475, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 475; HCDR3 containing the amino acid sequence of SEQ ID NO: 496, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 496; LCDR1 containing the amino acid sequence of SEQ ID NO: 538, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 538; LCDR2 containing the amino acid sequence of SEQ ID NO: 559, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 559; and LCDR3 containing the amino acid sequence of SEQ ID NO: 580, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

580. e) HCDR1 containing the amino acid sequence of SEQ ID NO: 455, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 455; HCDR2 containing the amino acid sequence of SEQ ID NO: 476, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 476; HCDR3 containing the amino acid sequence of SEQ ID NO: 497, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 497; LCDR1 containing the amino acid sequence of SEQ ID NO: 539, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 539; LCDR2 containing the amino acid sequence of SEQ ID NO: 560, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 560; and LCDR3 containing the amino acid sequence of SEQ ID NO: 581, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

581. f) HCDR1 containing the amino acid sequence of SEQ ID NO: 456, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 456; HCDR2 containing the amino acid sequence of SEQ ID NO: 477, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 477; HCDR3 containing the amino acid sequence of SEQ ID NO: 498, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 498; LCDR1 containing the amino acid sequence of SEQ ID NO: 540, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 540; LCDR2 containing the amino acid sequence of SEQ ID NO: 561, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 561; and LCDR3 containing the amino acid sequence of SEQ ID NO: 582, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

582. g) HCDR1 containing the amino acid sequence of SEQ ID NO: 457, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 457; HCDR2 containing the amino acid sequence of SEQ ID NO: 478, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 478; HCDR3 containing the amino acid sequence of SEQ ID NO: 499, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 499; LCDR1 containing the amino acid sequence of SEQ ID NO: 541, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 541; LCDR2 containing the amino acid sequence of SEQ ID NO: 562, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 562; and LCDR3 containing the amino acid sequence of SEQ ID NO: 583, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

583. h) HCDR1 containing the amino acid sequence of SEQ ID NO: 458, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 458; HCDR2 containing the amino acid sequence of SEQ ID NO: 479, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 479; HCDR3 containing the amino acid sequence of SEQ ID NO: 500, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 500; LCDR1 containing the amino acid sequence of SEQ ID NO: 542, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 542; LCDR2 containing the amino acid sequence of SEQ ID NO: 563, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 563; and LCDR3 containing the amino acid sequence of SEQ ID NO: 584, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

584. i) HCDR1 containing the amino acid sequence of SEQ ID NO: 459, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 459; HCDR2 containing the amino acid sequence of SEQ ID NO: 480, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 480; HCDR3 containing the amino acid sequence of SEQ ID NO: 501, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 501; LCDR1 containing the amino acid sequence of SEQ ID NO: 543, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 543; LCDR2 containing the amino acid sequence of SEQ ID NO: 564, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 564; and LCDR3 containing the amino acid sequence of SEQ ID NO: 585, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

585. j) HCDR1 containing the amino acid sequence of SEQ ID NO: 460, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 460; HCDR2 containing the amino acid sequence of SEQ ID NO: 481, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 481; HCDR3 containing the amino acid sequence of SEQ ID NO: 502, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 502; LCDR1 containing the amino acid sequence of SEQ ID NO: 544, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 544; LCDR2 containing the amino acid sequence of SEQ ID NO: 565, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 565; and LCDR3 containing the amino acid sequence of SEQ ID NO: 586, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

586. k) HCDR1 containing the amino acid sequence of SEQ ID NO: 461, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 461; HCDR2 containing the amino acid sequence of SEQ ID NO: 482, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 482; HCDR3 containing the amino acid sequence of SEQ ID NO: 503, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 503; LCDR1 containing the amino acid sequence of SEQ ID NO: 545, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 545; LCDR2 containing the amino acid sequence of SEQ ID NO: 566, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 566; and LCDR3 containing the amino acid sequence of SEQ ID NO: 587, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

587. l) HCDR1 containing the amino acid sequence of SEQ ID NO: 462, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 462; HCDR2 containing the amino acid sequence of SEQ ID NO: 483, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 483; HCDR3 containing the amino acid sequence of SEQ ID NO: 504, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 504; LCDR1 containing the amino acid sequence of SEQ ID NO: 546, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 546; LCDR2 containing the amino acid sequence of SEQ ID NO: 567, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 567; and LCDR3 containing the amino acid sequence of SEQ ID NO: 588, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

588. m) HCDR1 containing the amino acid sequence of SEQ ID NO: 463, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 463; HCDR2 containing the amino acid sequence of SEQ ID NO: 484, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 484; HCDR3 containing the amino acid sequence of SEQ ID NO: 505, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 505; LCDR1 containing the amino acid sequence of SEQ ID NO: 547, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 547; LCDR2 containing the amino acid sequence of SEQ ID NO: 568, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 568; and LCDR3 containing the amino acid sequence of SEQ ID NO: 589, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

589. n) HCDR1 comprising the amino acid sequence of SEQ ID NO: 464, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 464; HCDR2 comprising the amino acid sequence of SEQ ID NO: 485, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 485; HCDR3 comprising the amino acid sequence of SEQ ID NO: 506, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 506; LCDR1 comprising the amino acid sequence of SEQ ID NO: 548, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 548; LCDR2 comprising the amino acid sequence of SEQ ID NO: 569, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 569; and LCDR3 comprising the amino acid sequence of SEQ ID NO: 590, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

590. o) HCDR1 containing the amino acid sequence of SEQ ID NO: 465, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 465; HCDR2 containing the amino acid sequence of SEQ ID NO: 486, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 486; HCDR3 containing the amino acid sequence of SEQ ID NO: 507, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 507; LCDR1 containing the amino acid sequence of SEQ ID NO: 549, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 549; LCDR2 containing the amino acid sequence of SEQ ID NO: 570, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 570; and LCDR3 containing the amino acid sequence of SEQ ID NO: 591, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

591. p) HCDR1 containing the amino acid sequence of SEQ ID NO: 466, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 466; HCDR2 containing the amino acid sequence of SEQ ID NO: 487, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 487; HCDR3 containing the amino acid sequence of SEQ ID NO: 508, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 508; LCDR1 containing the amino acid sequence of SEQ ID NO: 550, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 550; LCDR2 containing the amino acid sequence of SEQ ID NO: 571, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 571; and LCDR3 containing the amino acid sequence of SEQ ID NO: 592, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

592. q) HCDR1 containing the amino acid sequence of SEQ ID NO: 467, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 467; HCDR2 containing the amino acid sequence of SEQ ID NO: 488, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 488; HCDR3 containing the amino acid sequence of SEQ ID NO: 509, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 509; LCDR1 containing the amino acid sequence of SEQ ID NO: 551, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 551; LCDR2 containing the amino acid sequence of SEQ ID NO: 572, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 572; and LCDR3 containing the amino acid sequence of SEQ ID NO: 593, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

593. r) HCDR1 containing the amino acid sequence of SEQ ID NO: 468, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 468; HCDR2 containing the amino acid sequence of SEQ ID NO: 489, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 489; HCDR3 containing the amino acid sequence of SEQ ID NO: 510, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 510; LCDR1 containing the amino acid sequence of SEQ ID NO: 552, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 552; LCDR2 containing the amino acid sequence of SEQ ID NO: 573, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 573; and LCDR3 containing the amino acid sequence of SEQ ID NO: 594, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

594. s) HCDR1 containing the amino acid sequence of SEQ ID NO: 469, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 469; HCDR2 containing the amino acid sequence of SEQ ID NO: 490, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 490; HCDR3 containing the amino acid sequence of SEQ ID NO: 511, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 511; LCDR1 containing the amino acid sequence of SEQ ID NO: 553, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 553; LCDR2 containing the amino acid sequence of SEQ ID NO: 574, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 574; and LCDR3 containing the amino acid sequence of SEQ ID NO: 595, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

595. t) HCDR1 containing the amino acid sequence of SEQ ID NO: 470, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 470; HCDR2 containing the amino acid sequence of SEQ ID NO: 491, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 491; HCDR3 containing the amino acid sequence of SEQ ID NO: 512, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 512; LCDR1 containing the amino acid sequence of SEQ ID NO: 554, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 554; LCDR2 containing the amino acid sequence of SEQ ID NO: 575, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 575; and LCDR3 containing the amino acid sequence of SEQ ID NO: 596, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 596; or u) HCDR1 containing the amino acid sequence of SEQ ID NO: 471, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 471; HCDR2 containing the amino acid sequence of SEQ ID NO: 492, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 492; HCDR3 containing the amino acid sequence of SEQ ID NO: 513, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 513; LCDR1 containing the amino acid sequence of SEQ ID NO: 555, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 555; LCDR2 containing the amino acid sequence of SEQ ID NO: 576, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 576; and LCDR3 containing the amino acid sequence of SEQ ID NO: 597, or a functional variant thereof having one or two amino acid substitutions relative to the amino acid sequence of SEQ ID NO:

597.

18. An antibody or antigen-binding fragment thereof that binds to differentiation cluster 117 (CD117), wherein the antibody or antigen-binding fragment thereof comprises: a) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 514 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 598; b) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 515 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 599; c) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 516 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 600; d) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 517 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 601; e) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 518 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 602; f) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 519 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 603; g) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 520 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 604; h) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 521 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 605; i) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 522 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 606; j) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 523 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 607; k) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 524 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 608; l) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 525 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 609; m) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 526 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 610; n) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 527 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 611; o) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 528 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 612; p) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 529 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 613; q) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 530 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 614; r) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 531 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 615; s) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 532 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 616; t) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 533 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 617; or u) VH containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 534 and VL containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

618.

19. The antibody or antigen-binding fragment thereof as claimed in claim 17 or claim 18, wherein the antibody or antigen-binding fragment thereof is a humanized or chimeric antibody or antigen-binding fragment thereof.

20. The antibody or antigen-binding fragment thereof as claimed in claim 18, wherein the antigen or antigen-binding fragment thereof comprises: a) VH containing the amino acid sequence of SEQ ID NO: 514 and VL containing the amino acid sequence of SEQ ID NO: 598; b) VH containing the amino acid sequence of SEQ ID NO: 515 and VL containing the amino acid sequence of SEQ ID NO: 599; c) VH containing the amino acid sequence of SEQ ID NO: 516 and VL containing the amino acid sequence of SEQ ID NO: 600; d) VH containing the amino acid sequence of SEQ ID NO: 517 and VL containing the amino acid sequence of SEQ ID NO: 601; e) VH containing the amino acid sequence of SEQ ID NO: 518 and VL containing the amino acid sequence of SEQ ID NO: 602; f) VH containing the amino acid sequence of SEQ ID NO: 519 and VL containing the amino acid sequence of SEQ ID NO: 603; g) VH containing the amino acid sequence of SEQ ID NO: 520 and VL containing the amino acid sequence of SEQ ID NO: 604; h) VH containing the amino acid sequence of SEQ ID NO: 521 and VL containing the amino acid sequence of SEQ ID NO: 605; i) VH containing the amino acid sequence of SEQ ID NO: 522 and VL containing the amino acid sequence of SEQ ID NO: 606; j) VH containing the amino acid sequence of SEQ ID NO: 523 and VL containing the amino acid sequence of SEQ ID NO: 607; k) VH containing the amino acid sequence of SEQ ID NO: 524 and VL containing the amino acid sequence of SEQ ID NO: 608; l) VH containing the amino acid sequence of SEQ ID NO: 525 and VL containing the amino acid sequence of SEQ ID NO: 609; m) VH containing the amino acid sequence of SEQ ID NO: 526 and VL containing the amino acid sequence of SEQ ID NO: 610; n) VH containing the amino acid sequence of SEQ ID NO: 527 and VL containing the amino acid sequence of SEQ ID NO: 611; o) VH containing the amino acid sequence of SEQ ID NO: 528 and VL containing the amino acid sequence of SEQ ID NO: 612; p) VH containing the amino acid sequence of SEQ ID NO: 529 and VL containing the amino acid sequence of SEQ ID NO: 613; q) VH containing the amino acid sequence of SEQ ID NO: 530 and VL containing the amino acid sequence of SEQ ID NO: 614; r) VH containing the amino acid sequence of SEQ ID NO: 531 and VL containing the amino acid sequence of SEQ ID NO: 615; s) VH containing the amino acid sequence of SEQ ID NO: 532 and VL containing the amino acid sequence of SEQ ID NO: 616; t) VH containing the amino acid sequence of SEQ ID NO: 533 and VL containing the amino acid sequence of SEQ ID NO: 617; or u) VH containing the amino acid sequence of SEQ ID NO: 534 and VL containing the amino acid sequence of SEQ ID NO:

618.

21. An antibody or antigen-binding fragment thereof that binds to differentiation cluster 117 (CD117), wherein the antibody or antigen-binding fragment thereof comprises: a) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 750 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

771. b) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 751 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

772. c) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 752 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 773; d) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 753 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 774; e) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 754 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 775; f) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 755 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

776. g) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 756 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

777. h) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 757 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

778. i) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 758 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

779. j) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 759 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 780; k) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 760 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO:

781. l) A heavy chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 761 and a light chain containing at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO:

782. m) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 762 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

783. n) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 763 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

784. o) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as the amino acid sequence of SEQ ID NO: 764 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as the amino acid sequence of SEQ ID NO: 785; p) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO: 765 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as SEQ ID NO:

786. q) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 766 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 787; r) A heavy chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO: 767 and a light chain containing at least 90% or at least 95% of the amino acid sequence identical to that of SEQ ID NO:

788. s) A heavy chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 768 and a light chain comprising an amino acid sequence that is at least 90% or at least 95% identical to the amino acid sequence of SEQ ID NO: 789; t) A heavy chain comprising at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 769, and a light chain comprising at least 90% or at least 95% of an amino acid sequence identical to that of SEQ ID NO: 790; or u) A heavy chain containing at least 90% or at least 95% of the same amino acid sequence as the amino acid sequence of SEQ ID NO: 770 and a light chain containing at least 90% or at least 95% of the same amino acid sequence as the amino acid sequence of SEQ ID NO:

791.

22. The antibody or antigen-binding fragment thereof as claimed in claim 21, wherein the antibody or antigen-binding fragment thereof comprises: a) The heavy chain containing the amino acid sequence of SEQ ID NO: 750 and the light chain containing the amino acid sequence of SEQ ID NO: 771; b) The heavy chain containing the amino acid sequence of SEQ ID NO: 751 and the light chain containing the amino acid sequence of SEQ ID NO: 772; c) The heavy chain containing the amino acid sequence of SEQ ID NO: 752 and the light chain containing the amino acid sequence of SEQ ID NO: 773; d) The heavy chain containing the amino acid sequence of SEQ ID NO: 753 and the light chain containing the amino acid sequence of SEQ ID NO: 774; e) The heavy chain containing the amino acid sequence of SEQ ID NO: 754 and the light chain containing the amino acid sequence of SEQ ID NO: 775; f) The heavy chain containing the amino acid sequence of SEQ ID NO: 755 and the light chain containing the amino acid sequence of SEQ ID NO: 776; g) The heavy chain containing the amino acid sequence of SEQ ID NO: 756 and the light chain containing the amino acid sequence of SEQ ID NO: 777; h) The heavy chain containing the amino acid sequence of SEQ ID NO: 757 and the light chain containing the amino acid sequence of SEQ ID NO: 778; i) The heavy chain containing the amino acid sequence of SEQ ID NO: 758 and the light chain containing the amino acid sequence of SEQ ID NO: 779; j) The heavy chain containing the amino acid sequence of SEQ ID NO: 759 and the light chain containing the amino acid sequence of SEQ ID NO: 780; k) The heavy chain containing the amino acid sequence of SEQ ID NO: 760 and the light chain containing the amino acid sequence of SEQ ID NO: 781; l) The heavy chain containing the amino acid sequence of SEQ ID NO: 761 and the light chain containing the amino acid sequence of SEQ ID NO: 782; m) The heavy chain containing the amino acid sequence of SEQ ID NO: 762 and the light chain containing the amino acid sequence of SEQ ID NO: 783; n) The heavy chain containing the amino acid sequence of SEQ ID NO: 763 and the light chain containing the amino acid sequence of SEQ ID NO: 784; o) The heavy chain containing the amino acid sequence of SEQ ID NO: 764 and the light chain containing the amino acid sequence of SEQ ID NO: 785; p) The heavy chain containing the amino acid sequence of SEQ ID NO: 765 and the light chain containing the amino acid sequence of SEQ ID NO: 786; q) The heavy chain containing the amino acid sequence of SEQ ID NO: 766 and the light chain containing the amino acid sequence of SEQ ID NO: 787; r) The heavy chain containing the amino acid sequence of SEQ ID NO: 767 and the light chain containing the amino acid sequence of SEQ ID NO: 788; s) a heavy chain containing the amino acid sequence of SEQ ID NO: 768 and a light chain containing the amino acid sequence of SEQ ID NO: 789; t) A heavy chain containing the amino acid sequence of SEQ ID NO: 769 and a light chain containing the amino acid sequence of SEQ ID NO: 790; or u) The heavy chain containing the amino acid sequence of SEQ ID NO: 770 and the light chain containing the amino acid sequence of SEQ ID NO:

791.

23. The antibody or antigen-binding fragment thereof as described in any one of claims 17-22, wherein it is a monoclonal antibody or antigen-binding fragment thereof.

24. The antibody or antigen-binding fragment thereof as claimed in any one of claims 17-23, wherein the antibody is a monospecific antibody, a bispecific antibody or a multispecific antibody; or wherein the antigen-binding fragment is a single-chain Fv (scFv), a disulfide-linked Fv (sdFv), a Fab fragment or an F(ab')2 fragment.

25. The antibody or antigen-binding fragment thereof as claimed in any one of claims 17-24, wherein the CD117 is human CD177.

26. The antibody or antigen-binding fragment thereof as described in any one of claims 17-25, wherein the antibody or antigen-binding fragment thereof is in a Kc of less than 75 nM, less than 50 nM, less than 25 nM, or less than 10 nM. D Combined with CD117.

27. An isolated nucleic acid encoding an antibody or an antigen-binding fragment thereof as described in any one of claims 17-26.

28. An expression vector comprising the nucleic acid as described in claim 27.

29. An isolated host cell comprising the nucleic acid as described in claim 27 or the expression vector as described in claim 28.

30. An isolated host cell expressing an antibody or an antigen-binding fragment thereof as described in any one of claims 17-26.

31. A method for generating an antibody or antigen-binding fragment thereof that binds to CD117, the method comprising incubating a host cell as described in claim 29 or claim 30 under conditions suitable for generating the antibody or antigen-binding fragment thereof.

32. The method of claim 31, further comprising separating the antibody or its antigen-binding fragment.

33. A method for treating a subject in need of a disease or condition associated with SIGLEC-8 expression, the method comprising administering to the subject an effective amount of an antibody or an antigen-binding fragment thereof as described in any one of claims 1-10.

34. The method of claim 33, wherein the disease or symptom is a mast cell disease.

35. The method of claim 34, wherein the mast cell disease is systemic mastocytosis, mast cell activation syndrome, or hereditary alpha-trypsinemia.

36. The method of claim 33, wherein the disease or condition is an immune disease.

37. The method of claim 33, wherein the disease or condition is cancer.

38. The method of claim 37, wherein the cancer is chronic eosinophilic leukemia, eosinophilic syndrome, or chronic myeloid leukemia.

39. The method of claim 33, wherein the disease or condition is asthma, allergy, chronic urticaria, atopic dermatitis, or asthma.

40. The method of claim 33, wherein the disease or condition is eosinophilic esophagitis, eosinophilic gastroenteritis, or duodenitis.

41. A method for treating a subject in need of a disease or condition associated with CD117 expression, the method comprising administering to the subject an effective amount of an antibody or an antigen-binding fragment thereof as described in any one of claims 17-26.

42. The method of claim 41, wherein the disease or condition is cancer.

43. The method of claim 42, wherein the cancer is ovarian cancer, seminoma, glioma, glioblastoma, mast cell tumor, melanoma, and gastrointestinal tumor.

44. The method of claim 41, wherein the disease or condition is chronic urticaria, nodular prurigo, severe combined immunodeficiency, or retinopathy.

45. The method of claim 44, wherein the retinopathy is diabetic retinopathy, retinopathy of prematurity, or wet macular degeneration.

Images