A collagen tripeptide with anti-wrinkle and firming functions, its preparation method and application

Abstract

This invention provides a collagen tripeptide with anti-wrinkle and firming functions, its preparation method, and its applications, belonging to the field of functional peptide preparation technology. A method for preparing a collagen tripeptide rich in GPH tripeptide involves pre-treated animal tissue undergoing enzymatic hydrolysis under the action of a complex enzyme composed of alkaline protease, neutral protease, and proline endonuclease. After enzyme inactivation, collagen peptides with a molecular weight of 300-1000 Da are separated. These peptides are then purified using a CM-Sepharose FF weak cation exchange chromatography column, and specific fractions are collected. After impurity removal and drying, collagen peptides rich in GPH tripeptide are obtained. The method described in this invention can significantly increase the GPH tripeptide content in the product. Testing has shown that the collagen peptides rich in GPH tripeptide prepared by this invention have anti-wrinkle and skin-firming functions, making them suitable for the preparation of cosmetics or health products.

Description

Technical Field

[0001] This invention belongs to the field of functional peptide preparation technology, specifically relating to a collagen tripeptide with anti-wrinkle and firming functions, its preparation method, and its application. Background Technology

[0002] GPH tripeptides are used in the cosmetics industry, playing a role in skin moisturizing, barrier repair, anti-aging, and collagen promotion. Currently, the preparation of GPH tripeptides is mainly based on chemical synthesis, while enzymatic hydrolysis and microbial fermentation are in the research and application stage. Although chemical synthesis can yield products with large-scale production, high purity, and strong sequence controllability, the use of chemical reagents during the preparation process poses a risk of residue, limiting its application. Microbial fermentation methods face challenges in strain construction and low product expression levels, limiting large-scale application. Enzymatic hydrolysis offers advantages such as mild reaction conditions (room temperature and pressure), no chemical reagent residues, and a wide range of raw material sources, but currently suffers from low GPH tripeptide yields (requiring multi-step purification) and unstable yields. Summary of the Invention

[0003] The purpose of this invention is to provide a collagen peptide rich in GPH tripeptide and its preparation method. By adjusting the composition and ratio of the complex enzyme used for biological enzymatic hydrolysis, combined with a refining and purification process, the content of GPH tripeptide can be effectively increased.

[0004] This invention provides a method for preparing collagen peptides rich in GPH tripeptide, comprising the following steps: pretreated animal tissue is enzymatically hydrolyzed under the action of a complex enzyme, and the enzyme is inactivated to obtain an enzymatic hydrolysate; the complex enzyme is composed of alkaline protease, neutral protease and proline endopeptidase;

[0005] Collagen peptides with a molecular weight of 300-1000 Da were isolated from the enzymatic hydrolysate;

[0006] The collagen peptides with a molecular weight of 300-1000 Da were purified using a CM-Sepharose FF weak cation exchange column. The elution program was as follows: rinsing with phosphate buffer for 20-40 min; then gradient elution with phosphate buffer containing NaCl for 25-35 min, with the NaCl concentration in the phosphate buffer gradually increased from 0.1 mol / L to 1.0 mol / L, and the eluent flow rate was 0.5 mL / min to 500 mL / min; the fraction with a retention time of 10-20 min was collected to obtain the purified collagen peptides.

[0007] Preferably, the mass ratio of the alkaline protease, neutral protease and proline endonuclease is 0.8~1.2:1.8~2.2:0.8~1.2.

[0008] Preferably, the amount of the compound enzyme added is 0.5% to 2% of the oven-dry weight of the animal tissue.

[0009] Preferably, the enzymatic hydrolysis temperature is 50~55℃; the enzymatic hydrolysis pH value is 7.0~7.5; the enzymatic hydrolysis time is 4~5h; the enzymatic hydrolysis is accompanied by stirring; and the stirring speed is 150~300rpm.

[0010] Preferably, the pretreatment method for the animal tissue includes at least one of the following: defatting and deodorization, heat treatment, and pulping;

[0011] The method for degreasing and deodorizing involves treating animal tissues under acidic or alkaline conditions in conjunction with an oxidizing agent.

[0012] The oxidant is a chlorine dioxide preparation with a working volume concentration of 0.6% to 1.0%, or hydrogen peroxide with a working volume concentration of 0.1% to 0.5%, or ozone with a working volume concentration of 0.1% to 0.15 ppm.

[0013] The acids include organic acids and inorganic acids; the organic acids include citric acid monohydrate or malic acid with a working mass concentration of 0.9% to 1.5%; the inorganic acids include hydrochloric acid with a working volume concentration of 0.1% to 0.3% and sodium hydroxide with a working mass concentration of 0.1% to 0.3%.

[0014] The heat treatment temperature is 55~100℃; the heat treatment time is 30~90min;

[0015] The pulping process includes at least one of the following: rotational shearing, emulsification, homogenization, and blending.

[0016] Preferably, the method for separating collagen peptides with a molecular weight of 300-1000 Da from the enzymatic hydrolysate includes solid-liquid separation of the enzymatic hydrolysate, collection of the liquid phase, filtration through a 1000 Da ultrafiltration membrane, filtration of the collected filtrate through a 300 Da ultrafiltration membrane, and collection of the filtrate.

[0017] Preferably, the animal tissue includes at least one of the following: fish tissue, animal skin, and animal bone.

[0018] The present invention provides collagen peptides prepared by the preparation method described above, wherein the mass percentage concentration of GPH tripeptide is 5% or more.

[0019] This invention provides the application of the collagen peptide in the preparation of products that enhance skin anti-wrinkle and / or improve skin firmness.

[0020] Preferably, the product includes cosmetics and / or health products.

[0021] This invention provides a method for preparing collagen peptides rich in GPH tripeptides. The method employs a complex enzyme composed of alkaline protease, neutral protease, and proline endonuclease to enzymatically hydrolyze pretreated animal tissues. The complex enzyme is designed for different cleavage sites, which facilitates the production of a hydrolysate with a high GPH content. The hydrolysate undergoes rigorous molecular weight screening, and collagen peptides with molecular weights of 300-1000 Da are purified using a CM-Sepharose FF weak cation exchange column. The electrostatic interaction between the GPH peptides and the chromatographic packing material is utilized to refine the collagen tripeptides, thereby increasing the GPH content in the product. This method exhibits good reproducibility and operability, making it suitable for large-scale production of collagen peptides rich in GPH tripeptides. Attached Figure Description

[0022] Figure 1 Flowchart for the zebrafish embryo tail wrinkling inhibition test;

[0023] Figure 2 Morphological diagram of light-induced damage in zebrafish of the model group;

[0024] Figure 3 Morphological diagram of light-induced damage in zebrafish from the positive group;

[0025] Figure 4 Morphological images of light-induced damage in zebrafish in the 0.71 g / L test substance group;

[0026] Figure 5 Morphological images of light-induced damage in zebrafish in the 0.36 g / L test substance group;

[0027] Figure 6 Morphological images of light-induced damage in zebrafish in the 0.14 g / L test substance group;

[0028] Figure 7 The results of the photodamage protection function tests for each treatment group; compared with the blank control group, ### P <0.001; compared with the model control group, *** P <0.001, ** P <0.01;

[0029] Figure 8 The results of the relative expression of elastin gene in zebrafish in each treatment group show that, compared with the blank control group, ###P<0.001. Detailed Implementation

[0030] This invention provides a method for preparing collagen peptides rich in GPH tripeptide, comprising the following steps: pretreated animal tissue is enzymatically hydrolyzed under the action of a complex enzyme, and the enzyme is inactivated to obtain an enzymatic hydrolysate; the complex enzyme is composed of alkaline protease, neutral protease and proline endopeptidase;

[0031] Collagen peptides with a molecular weight of 300-1000 Da were isolated from the enzymatic hydrolysate;

[0032] The collagen peptides with a molecular weight of 300-1000 Da were purified using a CM-Sepharose FF weak cation exchange column. The elution program was as follows: rinsing with phosphate buffer for 20-40 min; then gradient elution with phosphate buffer containing NaCl for 25-35 min, with the NaCl concentration in the phosphate buffer gradually increased from 0.1 mol / L to 1.0 mol / L, and the eluent flow rate was 0.5 mL / min to 500 mL / min; the fraction with a retention time of 10-20 min was collected to obtain the purified collagen peptides.

[0033] This invention involves enzymatically hydrolyzing pretreated animal tissues under the action of a complex enzyme, and obtaining an enzymatic hydrolysate after enzyme inactivation.

[0034] In this invention, the animal tissue preferably comprises at least one of the following collagen-rich raw materials: fish tissue, animal skin, and animal bones. The fish tissue is preferably fish skin or fish scales. The fish preferably includes freshwater or saltwater fish. The fish preferably includes tilapia, grass carp, snakehead, cod, and basa, etc. The animal skin preferably includes cowhide, sheepskin, horsehide, donkey skin, and pigskin, etc. The animal bones preferably include cow bones, sheep bones, and pig bones, etc.

[0035] In this invention, the pretreatment method for the animal tissue preferably includes at least one of the following: defatting and deodorization, heat treatment, and pulping. The defatting and deodorization method preferably involves treating the animal tissue under acidic or alkaline conditions with a combined oxidant. The oxidant is preferably a chlorine dioxide preparation with a working volume concentration of 0.6% to 1.0%, or hydrogen peroxide with a working volume concentration of 0.1% to 0.5%, or ozone with a working volume concentration of 0.1% to 0.15 ppm. The acid preferably includes organic and inorganic acids. The organic acid preferably includes citric acid monohydrate or malic acid with a working mass concentration of 0.9% to 1.5%; the inorganic acid preferably includes hydrochloric acid with a working volume concentration of 0.1% to 0.3%. The alkali preferably includes sodium hydroxide with a working mass concentration of 0.1% to 0.3%. The treatment time under acidic or alkaline conditions with the combined oxidant is preferably 24 to 36 hours, but can be 28 to 32 hours, or 30 hours. This invention does not impose any particular limitation on the temperature of the combined oxidant treatment under acidic or alkaline conditions; any temperature well-known in the art can be used, such as 20-27°C, or even 25°C. During the combined oxidant treatment under acidic or alkaline conditions, it is preferable to stir once every 2 hours for 5 minutes each time. After the combined oxidant treatment under acidic or alkaline conditions, it is preferable to rinse with water until the pH value is 6.5-7.5 and the conductivity is <500 μS / cm.

[0036] In this invention, the heat treatment temperature is preferably 55-100℃, but can be 60-90℃, 65-80℃, or 70-75℃. The heat treatment time is preferably 30-90 minutes, but can be 40-70 minutes or 50-60 minutes. During the heat treatment, it is preferable to add water at a volume of 1-3 times that of the animal tissue. After the heat treatment, the pH value of the system is preferably adjusted to 9-10. During the heat treatment process, air blowing and stirring are preferred to ensure uniform heating.

[0037] In this invention, the slurrying process preferably includes at least one of the following: rotary shearing, emulsification, homogenization, and blending. The instruments used for rotary shearing, emulsification, homogenization, and blending preferably include a high-speed shear emulsifier and a high-pressure / high-speed homogenizer. The rotational speed of the rotary shearing is preferably 200-1000 rpm, and can be 500 rpm. The rotary shearing is preferably a feed-in-feed material handling method. The rotary shearing time is preferably 5-15 min, and can be 10 min. The emulsification time is preferably 5-30 min, and can be 10 min.

[0038] In this invention, the preferred mass ratio of the alkaline protease, neutral protease, and proline endonuclease is 0.8~1.2:1.8~2.2:0.8~1.2, or 1:2:1. The preferred amount of the composite enzyme is 0.5%~2% of the oven-dry weight of the animal tissue, or 0.8%~1.5%, or 1.0%~1.2%. The preferred enzyme activity of the alkaline protease is 300,000 U / g; the preferred enzyme activity of the neutral protease is 100,000 U / g; and the preferred enzyme activity of the proline endonuclease is 50,000 U / g. The preferred enzymatic hydrolysis temperature is 50~55℃, or 52~54℃, or 53℃. The preferred pH value for enzymatic hydrolysis is 7.0~7.5, or 7.2~7.4, or 7.3. The preferred hydrolysis time is 4~5 hours, or 4.5 hours. The hydrolysis is preferably accompanied by stirring. The stirring speed is preferably 150~300 rpm, but can be 180~250 rpm or 200~230 rpm.

[0039] In this invention, the enzyme inactivation method is preferably high-temperature enzyme inactivation or pulsed light enzyme inactivation / ultra-high pressure enzyme inactivation. The preferred temperature for high-temperature enzyme inactivation is 85-90°C, and can be 87°C. The preferred time for high-temperature enzyme inactivation is 15-20 minutes, and can be 18 minutes. This enzyme inactivation method is beneficial for inactivating the complex enzyme, terminating the enzymatic hydrolysis process, and preventing over-enzymatic hydrolysis.

[0040] After obtaining the enzymatic hydrolysate, the present invention separates collagen peptides with a molecular weight of 300~1000 Da from the enzymatic hydrolysate.

[0041] In this invention, the method for separating collagen peptides with a molecular weight of 300-1000 Da from the enzymatic hydrolysate preferably includes solid-liquid separation of the enzymatic hydrolysate, collection of the liquid phase, filtration through a 1000 Da ultrafiltration membrane, collection of the filtrate, filtration through a 300 Da ultrafiltration membrane, and collection of the filtrate. The solid-liquid separation method is preferably a diaphragm-type press plate and frame filter. The 1000 Da ultrafiltration membrane can effectively retain large molecular weight peptides (such as polypeptides with more than 10 amino acids). The 300 Da ultrafiltration membrane can effectively retain small molecular weight impurities (such as free amino acids and dipeptides), allowing oligopeptides of 300-1000 Da to permeate, and is rich in collagen tripeptides, achieving precise molecular weight fractionation. Before ultrafiltration, to prevent membrane pore blockage, it is preferable to use a 300-mesh filter cloth to remove insoluble residues (such as undigested collagen fibers). During ultrafiltration, the pressure is preferably controlled at 0.1-0.2 MPa to prevent membrane damage due to excessive pressure.

[0042] After obtaining collagen peptides with a molecular weight of 300-1000 Da, the present invention purifies the collagen peptides with a molecular weight of 300-1000 Da using a CM-Sepharose FF weak cation exchange column. The elution program is as follows: washing with phosphate buffer for 20-40 min; then performing gradient elution with phosphate buffer containing NaCl for 25-35 min, with the NaCl concentration in the phosphate buffer gradually increased from 0.1 mol / L to 1.0 mol / L, and the elution flow rate being 0.5 mL / min to 500 mL / min; collecting the fraction with a retention time of 10-20 min to obtain the purified collagen peptides.

[0043] In this invention, when purifying collagen peptides with a molecular weight of 300-1000 Da, it is preferable to adjust the pH of the system to 6.4-6.6, or even 6.5. This facilitates the electrostatic adsorption of amino groups in the collagen tripeptide and carboxyl groups in the CM-Sepharose FF weak cation exchanger, while neutral impurity peptides (such as Gly-Gly-Pro) are not adsorbed due to their neutral charge, thus achieving specific separation. The fraction is preferably collected precisely using an ultraviolet detector.

[0044] In this invention, the purification preferably includes decolorizing, concentrating, clarifying, sterilizing, and dehydrating the fraction in one step. Decolorization is preferably achieved using activated carbon adsorption to remove color and odor. Concentration preferably includes at least one of the following methods: nanofiltration membrane concentration, triple-effect evaporator concentration, and falling film scraper concentration. Clarification is preferably achieved using a tubular centrifuge or paperboard. Sterilization is preferably achieved using filter cartridge sterilization or heat sterilization. Dehydration preferably includes spray drying or freeze drying.

[0045] The present invention provides collagen peptides prepared by the preparation method described above, wherein the mass percentage concentration of GPH tripeptide is 5% or more.

[0046] In this invention, the precise enzymatic hydrolysis of collagen tripeptide GPH is achieved by further optimizing the type and ratio of the compound enzyme used for enzymatic hydrolysis, thereby increasing the content of collagen tripeptide GPH in the enzymatic hydrolysate. At the same time, the chromatographic purification step can separate collagen tripeptide GPH and remove non-target peptides, thereby increasing the proportion of collagen tripeptide GPH in the product.

[0047] In this invention, the collagen peptides are rich in GPH, exhibiting excellent anti-wrinkle and skin-firming functions. Experiments show that the collagen peptides prepared in this invention can inhibit skin wrinkling caused by irradiation while improving skin firmness. Furthermore, experiments demonstrate that the collagen peptides can promote elastin expression, thereby enhancing skin elasticity.

[0048] This invention provides the application of the collagen peptide in the preparation of products that enhance skin anti-wrinkle and / or improve skin firmness.

[0049] In this invention, the product preferably includes cosmetics and / or health products. The product preferably also includes common excipients. The excipient in the cosmetic preferably includes sodium hyaluronate, used to construct a 3D hydration network, synergistically with GPH to increase skin hydration and prolong the residence time of active ingredients. The collagen peptide content in the product is preferably 1%~50% by mass, but can be 2%~40%, 5%~30%, or 10%~20%.

[0050] The following detailed description, in conjunction with embodiments, illustrates a collagen tripeptide with anti-wrinkle and firming functions provided by the present invention, its preparation method, and its application. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0051] The raw material used in this embodiment is fresh frozen tilapia skin, which has a protein content of ≥80%, a fat content of ≤5%, and is free from odor and mold.

[0052] All reagents used are food-grade, specifically as follows: chlorine dioxide preparation (ClO2 content 45%), citric acid monohydrate (content > 99%), alkaline protease (enzyme activity 300,000 U / g), neutral protease (enzyme activity 100,000 U / g), proline endonuclease (enzyme activity 50,000 U / g), CM-Sepharose FF weak cation exchange packing material, sodium dihydrogen phosphate, disodium hydrogen phosphate, sodium chloride, and food-grade activated carbon;

[0053] The equipment used includes a high-speed shear emulsifier, a high-pressure homogenizer, a reaction vessel, a diaphragm press plate and frame filter, a 1000Da ultrafiltration membrane module, a 300Da ultrafiltration membrane module, a high-performance liquid chromatograph (equipped with an ultraviolet detector), a tubular centrifuge, a nanofiltration membrane concentration device, a spray dryer, and a pulsed intense light treatment device.

[0054] Preparation of fish embryo culture medium: Weigh 2940 mg anhydrous calcium chloride, 1233 mg magnesium sulfate heptahydrate, 630 mg sodium bicarbonate, and 55 mg potassium chloride and dissolve in 10 L of water. The pH value is 6.5–8.5. All chemicals are of analytical grade.

[0055] Example 1

[0056] A method for preparing collagen peptides rich in GPH tripeptide

[0057] 1. Rinsing: Take 10kg of dried tilapia skin, place it in a stainless steel soaking tank, add 200L of tap water, and soak and rinse for 12 hours. Turn it over once every 4 hours during the soaking period, and drain the water after the soaking is completed.

[0058] 2. Degreasing and deodorizing: Add 4 times the amount of water to the fish skin (after rinsing and removing impurities), and soak it in a 0.6% final concentration chlorine dioxide preparation (food grade, ClO2 content 45%~48%) and 0.9% citric acid monohydrate for 24 hours. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500μS / cm.

[0059] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add 1 volume of clean water, adjust the pH value to 9, heat to 80℃ and maintain for 60 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0060] 4. Slurrying: The solid-liquid mixture obtained in step 3 is sheared by a high-speed homogenizer (500 rpm) to obtain a homogeneous slurry.

[0061] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (300,000 U / g), neutral protease (100,000 U / g), and proline endopeptidase (50,000 U / g) in a mass ratio of 1:2:1. The amount of enzyme added is 1% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 5 hours at pH 7.2 and 55°C, accompanied by a stirring rate of 300 r / min.

[0062] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 90℃ and incubate for 15 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0063] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0064] 8. Membrane filtration: A 1000Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300Da ultrafiltration membrane, allowing only oligopeptides of 300-1000Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1~0.2MPa to prevent membrane rupture due to excessive pressure.

[0065] 9. Chromatographic Purification: A 9L column was used with CM-Sepharose FF weak cation exchange resin as the packing material. Under pH 6.5 conditions, the collagen tripeptide-rich solution was adsorbed onto the resin. Elution process: Impurities were first washed with phosphate buffer for 20 min, followed by gradient elution with phosphate buffer containing NaCl for 30 min. Specifically, the NaCl concentration in the phosphate buffer containing NaCl was increased from 0.1 mol / L to 1.0 mol / L to ensure orderly elution of collagen tripeptides. The elution rate was 400 ml / min. GPH tripeptides, due to their moderate binding affinity to the packing material, had a retention time concentrated in the range of 12-15 min and could be accurately collected using a UV detector to obtain the purified solution.

[0066] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0067] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0068] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0069] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0070] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0071] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in collagen peptide products was determined by high performance reversed-phase chromatography.

[0072] 15.1 Reagents

[0073] Unless otherwise specified, all reagents used in this method are of chromatographic grade. Trifluoroacetic acid (C2HF3O2), water (H2O), and GPH standard (MW 285.3, purity ≥95%).

[0074] 15.2 Chromatographic conditions

[0075] Chromatographic column: ZORBAX SB-Aq, 4.6 mm × 250 mm, 5 μm. Mobile phase: 0.1% trifluoroacetic acid solution. Detection wavelength: 220 nm. Flow rate: 1 mL / min. Column oven: 50℃. Injection volume: 10 μL. Analysis time: 15 min.

[0076] 15.3 Establishment of the Standard Curve

[0077] A 1% standard solution was prepared using the mobile phase, and then diluted with the mobile phase to prepare samples with concentrations of 0.001% (10 μg / mL). A standard linear equation was generated based on the area and concentration of the standard using data processing software.

[0078] Sample preparation: Weigh 0.1 g of sample using weighing paper, transfer to a 10 mL volumetric flask, dilute to the mark with mobile phase, and then dilute 10-fold with mobile phase to obtain a 0.1% sample solution. Filter through a filter membrane, and use the filtrate for determination.

[0079] Calculation of the proportion of GPH tripeptide

[0080] The prepared sample solution was injected and analyzed under the chromatographic conditions described above. Then, the mass percentage of GPH tripeptide in the product was calculated using Formula I:

[0081] Formula I

[0082] In the formula: X represents the content of glycine-proline-hydroxyproline in the sample, in g / 100g; C represents the mass concentration of GPH in the sample, in μg / mL; V represents the volume of the sample solution, in mL; F represents the dilution factor; M represents the mass of the sample, in g; 10 -6 This indicates the conversion factor.

[0083] The results showed that the mass percentage of GPH was 8%.

[0084] Example 2

[0085] A method for preparing collagen peptides rich in GPH tripeptide

[0086] 1. Rinsing: Take 10kg of grass carp scales, place them in a stainless steel soaking tank, and soak them in tap water for 3 hours to remove blood and impurities. Stir once during the soaking process, and drain the water after soaking.

[0087] 2. Degreasing and deodorizing: Add 3 times the amount of water to the cleaned fish scales, then soak in a solution of 0.5% hydrogen peroxide (food grade, mass fraction 32%~36%) and 0.3% hydrochloric acid for 24 hours. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500μS / cm.

[0088] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add 1 volume of clean water, adjust the pH value to 9, heat to 80℃ and maintain for 60 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0089] 4. Slurrying: The solid-liquid mixture obtained in step 3 is emulsified (500 rpm, emulsification time 30 min) to obtain a homogeneous slurry material;

[0090] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (enzyme activity 300,000 U / g), neutral protease (enzyme activity 100,000 U / g), and proline endopeptidase (enzyme activity 50,000 U / g) in a mass ratio of 1:2:1. The amount of enzyme added is 1.5% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 4 hours at pH 7.2 and 55℃, accompanied by a stirring rate of 200 r / min.

[0091] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 85℃ and incubate for 20 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0092] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0093] 8. Membrane filtration: A 1000 Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300 Da ultrafiltration membrane, allowing only oligopeptides of 300-1000 Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1~0.2 MPa to prevent membrane damage due to excessive pressure.

[0094] 9. Chromatographic Purification: A 4L column was used with CM-Sepharose FF weak cation exchange resin as the packing material. Under pH 6.5 conditions, the collagen tripeptide-rich solution was adsorbed onto the resin. Elution process: Impurities were first washed with phosphate buffer for 20 min, followed by gradient elution with phosphate buffer containing NaCl for 30 min. Specifically, the NaCl concentration in the phosphate buffer containing NaCl was increased from 0.1 mol / L to 1.0 mol / L to ensure orderly elution of collagen tripeptides. The elution flow rate was 150 ml / min. GPH tripeptides, due to their moderate binding affinity to the packing material, had a retention time concentrated in the range of 13-16 min and could be accurately collected using a UV detector to obtain the purified solution.

[0095] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0096] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0097] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0098] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0099] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0100] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in the collagen peptide product was determined according to the method in Example 1.

[0101] The results showed that the mass percentage of GPH was 6.3%.

[0102] Example 3

[0103] A method for preparing collagen peptides rich in GPH tripeptide

[0104] 1. Rinsing: Take 10kg of dried cowhide, place it in a stainless steel soaking tank, add 200L of tap water, and soak and rinse it for 12 hours. Turn it over once every 4 hours during the soaking period, and drain the water after the soaking is completed.

[0105] 2. Degreasing and deodorizing: Add 4 times the amount of water to the cowhide (after rinsing and removing impurities), and soak it for 36 hours with ozone at a final concentration of 0.15 ppm and sodium hydroxide at 0.3%. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500 μS / cm.

[0106] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add twice the volume of clean water, adjust the pH value to 10, heat to 100℃ and maintain for 90 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0107] 4. Slurrying: The solid-liquid mixture obtained in step 3 is sheared, emulsified, and homogenized using a high-speed homogenizer to obtain a homogeneous slurry material;

[0108] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (300,000 U / g), neutral protease (100,000 U / g), and proline endopeptidase (50,000 U / g) in a mass ratio of 1:2:1.2. The amount of enzyme added is 2% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 5 hours at pH 7.2 and 55°C, accompanied by a stirring rate of 150 r / min.

[0109] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 90℃ and incubate for 20 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0110] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0111] 8. Membrane filtration: A 1000Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300Da ultrafiltration membrane, allowing only oligopeptides of 300-1000Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1-0.2 MPa to prevent membrane rupture due to excessive pressure.

[0112] 9. Chromatographic Purification: A 9L column was used with CM-Sepharose FF weak cation exchange resin as the packing material. Under pH 6.5 conditions, the collagen tripeptide-rich solution was adsorbed onto the resin. Elution process: Impurities were first washed with phosphate buffer for 20 min, followed by gradient elution with phosphate buffer containing NaCl for 30 min. Specifically, the NaCl concentration in the phosphate buffer containing NaCl was increased from 0.1 mol / L to 1.0 mol / L to ensure orderly elution of collagen tripeptides. The elution rate was 350 ml / min. GPH tripeptides, due to their moderate binding affinity to the packing material, had a retention time concentrated in the range of 12-16 min and could be accurately collected using a UV detector to obtain the purified solution.

[0113] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0114] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0115] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0116] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0117] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0118] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in the collagen peptide product was determined according to the method in Example 1.

[0119] The results showed that the mass percentage of GPH was 6.5%.

[0120] Comparative Example 1

[0121] A method for preparing collagen peptides

[0122] 1. Rinsing: Take 10kg of dried tilapia skin, place it in a stainless steel soaking tank, add 200L of tap water, and soak and rinse for 12 hours. Turn it over once every 4 hours during the soaking period, and drain the water after the soaking is completed.

[0123] 2. Degreasing and deodorizing: Add 4 times the amount of water to the fish skin (after rinsing and removing impurities), and soak it in a 0.6% final concentration chlorine dioxide preparation (food grade, ClO2 content 45%~48%) and 0.9% citric acid monohydrate for 24 hours. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500μS / cm.

[0124] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add 1 volume of clean water, adjust the pH value to 9, heat to 80℃ and maintain for 60 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0125] 4. Pulping: The solid-liquid mixture obtained in step 3 is sheared by a high-speed homogenizer (500 rpm for 10 min) to obtain a homogeneous slurry.

[0126] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (enzyme activity 300,000 U / g) and neutral protease (enzyme activity 100,000 U / g) in a mass ratio of 1:2. The amount of enzyme added is 1% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 5 hours at pH 7.2 and 55℃, accompanied by a stirring rate of 300 r / min.

[0127] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 90℃ and incubate for 15 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0128] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0129] 8. Membrane filtration: A 1000Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300Da ultrafiltration membrane, allowing only oligopeptides of 300-1000Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1~0.2MPa to prevent membrane rupture due to excessive pressure.

[0130] 9. Chromatographic Purification: A 9L column was used with CM-Sepharose FF weak cation exchange resin as the packing material. Under pH 6.5 conditions, the collagen tripeptide-rich solution was adsorbed onto the resin. Elution process: Impurities were first washed with phosphate buffer for 20 min, followed by gradient elution with phosphate buffer containing NaCl for 30 min. Specifically, the NaCl concentration in the phosphate buffer containing NaCl was increased from 0.1 mol / L to 1.0 mol / L to ensure orderly elution of collagen tripeptides. The elution rate was 400 ml / min. GPH tripeptides, due to their moderate binding affinity to the packing material, had a retention time concentrated in the range of 12-15 min and could be accurately collected using a UV detector to obtain the purified solution.

[0131] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0132] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0133] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0134] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0135] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0136] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in the collagen peptide product was determined according to the method in Example 1.

[0137] The results showed that the mass percentage of GPH was 0.2%.

[0138] Comparative Example 2

[0139] A method for preparing collagen peptides

[0140] 1. Rinsing: Take 10kg of dried tilapia skin, place it in a stainless steel soaking tank, add 200L of tap water, and soak and rinse for 12 hours. Turn it over once every 4 hours during the soaking period, and drain the water after the soaking is completed.

[0141] 2. Degreasing and deodorizing: Add 4 times the amount of water to the fish skin (after rinsing and removing impurities), and soak it in a 0.6% final concentration chlorine dioxide preparation (food grade, ClO2 content 45%~48%) and 0.9% citric acid monohydrate for 24 hours. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500μS / cm.

[0142] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add 1 volume of clean water, adjust the pH value to 9, heat to 80℃ and maintain for 60 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0143] 4. Slurrying: The solid-liquid mixture obtained in step 3 is subjected to high-speed shearing (500 rpm) to obtain a homogeneous slurry material;

[0144] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (enzyme activity 300,000 U / g), papain (enzyme activity 100,000 U / g), and proline endopeptidase (enzyme activity 50,000 U / g) in a mass ratio of 1:2:1. The amount of enzyme added is 1% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 5 hours at a pH of 7.0~7.5 and a temperature of 55°C, accompanied by a stirring rate of 300 r / min.

[0145] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 90℃ and incubate for 15 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0146] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0147] 8. Membrane filtration: A 1000Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300Da ultrafiltration membrane, allowing only oligopeptides of 300-1000Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1~0.2MPa to prevent membrane rupture due to excessive pressure.

[0148] 9. Chromatographic purification: A 9L column was used with CM-Sepharose FF weak cation exchange resin as the packing material. Under pH 6.5 conditions, the collagen tripeptide-rich solution was adsorbed onto the resin. Elution process: Impurities were first washed with phosphate buffer for 20 min, followed by gradient elution with phosphate buffer containing NaCl for 30 min. Specifically, the NaCl concentration in the phosphate buffer containing NaCl was increased from 0.1 mol / L to 1.0 mol / L to ensure orderly elution of collagen tripeptides. The elution flow rate was 400 ml / min. GPH tripeptides, due to their moderate binding affinity to the packing material, had a retention time concentrated in the range of 12-15 min and could be accurately collected using a UV detector to obtain the purified solution.

[0149] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0150] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0151] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0152] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0153] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0154] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in the collagen peptide product was determined according to the method in Example 1.

[0155] The results showed that the mass percentage of GPH was 4.5%.

[0156] Comparative Example 3

[0157] A method for preparing collagen peptides

[0158] 1. Rinsing: Take 10kg of dried tilapia skin, place it in a stainless steel soaking tank, add 200L of tap water, and soak and rinse for 12 hours. Turn it over once every 4 hours during the soaking period, and drain the water after the soaking is completed.

[0159] 2. Degreasing and deodorizing: Add 4 times the amount of water to the fish skin (after rinsing and removing impurities), and soak it in a 0.6% final concentration chlorine dioxide preparation (food grade, ClO2 content 45%~48%) and 0.9% citric acid monohydrate for 24 hours. Stir intermittently, turning on the stirrer for 5 minutes every 2 hours. After the process is complete, rinse with water until the pH reaches 7.0 and the conductivity is <500μS / cm.

[0160] 3. Heat treatment: Put the cleaned raw materials into the reaction vessel, add 1 volume of clean water, adjust the pH value to 9, heat to 80℃ and maintain for 60 minutes, and turn on the air blowing and stirring throughout the process to ensure uniform heating;

[0161] 4. Slurrying: The solid-liquid mixture obtained in step 3 is emulsified (500 rpm, emulsification time 30 min) to obtain a homogeneous slurry material;

[0162] 5. Enzymatic hydrolysis: Add a compound enzyme to the pulped material obtained in step 4. The compound enzyme is composed of alkaline protease (300,000 U / g), neutral protease (100,000 U / g), and proline endopeptidase (50,000 U / g) in a mass ratio of 1:2:1. The amount of enzyme added is 1% of the dry weight of the collagen raw material. Enzymatic hydrolysis is carried out for 5 hours at a pH of 7.0-7.5 and a temperature of 55°C, accompanied by a stirring rate of 300 r / min.

[0163] 6. Enzyme inactivation: After enzymatic hydrolysis, heat to 90℃ and incubate for 15 minutes to inactivate the enzyme, obtaining the enzymatic hydrolysate;

[0164] 7. First clarification: Solid-liquid separation is performed using a 300-mesh diaphragm plate and frame filter to obtain a clear protein solution;

[0165] 8. Membrane filtration: A 1000Da ultrafiltration membrane is selected to retain large peptide molecules. The permeate is then filtered through a 300Da ultrafiltration membrane, allowing only oligopeptides of 300-1000Da to pass through, resulting in a feed solution rich in collagen tripeptides. The ultrafiltration pressure is controlled within the range of 0.1~0.2MPa to prevent membrane rupture due to excessive pressure.

[0166] 9. Chromatographic purification: A 9L volume chromatographic column was used, packed with 200-300 mesh silica gel. Mobile phase A was n-hexane, and mobile phase B was anhydrous ethanol. After equilibrating the column with mobile phase B:15%, the sample was cumulatively injected with mobile phase B:15% every 2-5 minutes, with each injection volume being 1 / 3 to 1 / 5 of the total sample volume. After all the sample had been injected, gradient elution was performed. The elution gradient was: mobile phase B 15% for 20 minutes, 40%-75% for 60 minutes, and 75% constant flow. The sample flow rate was 20-50 mL / min, and the detection wavelength was 200-240 nm. The purified solution was obtained.

[0167] 10. Decolorization: Add 5% activated carbon (by weight of the purified solution) for adsorption, decolorization, and deodorization. The decolorization conditions are 60℃ and pH 4.5.

[0168] 11. Concentration: Nanofiltration membrane concentration to a solids content of 30%;

[0169] 12. Secondary clarification: Clarify by filtration with paperboard and collect the clear liquid;

[0170] 13. Sterilization: Sterilize the clear liquid with a 0.22μm filter cartridge to obtain a sterilized solution;

[0171] 14. Drying: Spray dry the sterilization solution to obtain collagen peptide products.

[0172] 15. The mass percentage of glycine-proline-hydroxyproline (GPH) in the collagen peptide product was determined using the preparation method of Example 1.

[0173] The results showed that the mass percentage of GPH was 2.5%.

[0174] Example 4

[0175] Example 1 tested the skin's protection against photodamage using GPH-rich collagen peptides.

[0176] The efficacy of GPH-rich collagen peptides was tested using zebrafish embryo tail shrinkage inhibition assay. Healthy zebrafish embryos, 3 days post-fertilization, were selected. The testing procedure is described below. Figure 1 .

[0177] 1. Test Groups: A blank control group (fish embryo culture medium), a model control group (fish embryo culture medium + UVB irradiation), a positive control group (ergothioneine solution + UVB irradiation), and a test substance group (test substance + UVB irradiation) were established. Blank control group: 30 fish embryos were randomly selected and placed into 6cm culture dishes, with 6mL of fish embryo culture medium added. Model control group: 30 fish embryos were randomly selected and placed into 6cm culture dishes, with 6mL of fish embryo culture medium added. Positive control group: 30 fish embryos were randomly selected and placed into 6cm culture dishes, with 6mL of ergothioneine solution added. Test substance treatment group: 30 fish embryos were randomly selected and placed into 6cm culture dishes, with 6mL of test substance solution added.

[0178] 2. Treatment method: Incubate in a constant temperature incubator at 28℃±1℃ for 1 hour. Anesthetize the zebrafish with tricaine and administer 0.3J / cm² treatment. 2 After UVB irradiation, the anesthetic was removed, and the appropriate solution was added according to the group. The fish were then incubated in a constant temperature incubator at 28℃±1℃ for 24h±1h. Zebrafish were anesthetized with tricaine, and then the tail of the embryos was photographed under a stereomicroscope using uniform photographic parameters.

[0179] 3. Data and Result Calculation

[0180] Open the photograph using analysis software such as ImageJ, mark the area from the anus to the tip of the tail fin for each fish embryo, and then select "Measure Area" in the "Measure" tab to measure the tail area of ​​the fish embryo. Calculate the tail area wrinkling inhibition rate according to Formula II:

[0181] Tail area wrinkling inhibition rate (%) = (S − M) / (B − M) × 100% Formula II.

[0182] In the formula: S—the average tail area of ​​fish embryos in the test substance treatment group; B—the average tail area of ​​fish embryos in the blank control group; M—the average tail area of ​​fish embryos in the model control group.

[0183] Calculate the mean and standard error for each experimental group. Statistical results are expressed as mean ± standard error. Perform analysis of variance using statistical software. A two-tailed t-test is conducted to assess the tail area between the test group and the model control group. P value. P <0.05 indicates a significant difference.

[0184] See results Figures 2-7 The sample inhibited tail area shrinkage in zebrafish embryos by 8.89% at test concentrations of 0.71 g / L, 0.36 g / L, and 0.14 g / L. P =0.0000095), 6.79% P =0.0017) and 5.64% ( P =0.0027). Collagen peptide solutions rich in GPH can significantly reduce tail wrinkling in zebrafish embryos caused by UVB irradiation, demonstrating a protective effect against photodamage.

[0185] Example 5

[0186] Example 1: GPH-rich collagen peptides prepared to promote the elastin gene in zebrafish Elna Experiments of expression

[0187] Healthy zebrafish, 6 days post-fertilization, were selected as subjects. The test groups were as follows: a blank control group (fish embryo culture medium), a positive control group (acetyl hexapeptide-8), and a test substance group (test substance). Blank control group: 36 zebrafish were randomly selected and evenly distributed into 24-well plates, with 3 wells per well containing 12 zebrafish and 2.5 mL of fish embryo culture medium. Positive control group: 36 zebrafish were randomly selected and evenly distributed into 24-well plates, with 3 wells per well containing 12 zebrafish and 2.5 mL of acetyl hexapeptide-8 working solution per well. Test substance group: 36 zebrafish were randomly selected and evenly distributed into 24-well plates, with 3 wells per well containing 12 zebrafish and 2.5 mL of GPH-rich collagen peptide solution per well. The plates were incubated at 28℃±1℃ for 24h±1h post-fertilization. Collect 12 zebrafish from each well into a 1.5 mL tube, remove the solution, add 0.5 mL of RNAlater solution, and store frozen.

[0188] RNA was extracted from zebrafish in each group using the TRIzol method. The RNA was synthesized into cDNA using a PrimeScript RT kit containing a gDNA eraser (Takara; Cat no. RR047A), and stored frozen. Real-time RT-PCR amplification was performed using the cDNA as a model. The elastin gene was among the amplified cDNA. ElnPrimers used for amplification: Upstream primer AAAACCAGGTTACGGCTCTGT (SEQ ID NO:1); Downstream primer TCCTCCTGGATAAGCTCCGTATC (SEQ ID NO:2). β-actin, as a housekeeping gene, was amplified using upstream primer GCTGACAGGATGCAGAAGGA (SEQ ID NO:3); downstream primer TAGAAGCATTTGCGGTGGAC (SEQ ID NO:4). Amplification was performed according to the reaction system and procedure recommended by the kit. Real-time PCR data were collected. Ct was used as the amplification result, with the amplification level of β-actin gene as the housekeeping gene. calculate Elna The relative expression level was used as the test result.

[0189] See results Figure 8 The results of GPH-rich collagen peptides on elastin gene expression at the corresponding test concentrations showed that the elastin gene expression promotion rate was positive and statistically significant. P If the concentration of the test substance is less than 0.05, it is determined that the test substance has the effect of promoting elastin regeneration.

[0190] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing collagen peptides rich in GPH tripeptide, characterized in that, Includes the following steps: The pretreated animal tissues are enzymatically hydrolyzed under the action of a complex enzyme, and the enzyme is inactivated to obtain an enzymatic hydrolysate; the complex enzyme is composed of alkaline protease, neutral protease and proline endonuclease; the animal tissues are at least one of the following: tilapia skin, grass carp scales and cowhide. The mass ratio of alkaline protease, neutral protease, and proline endonuclease is 0.8~1.2:1.8~2.2:0.8~1.2; The amount of the compound enzyme added is 0.5% to 2% of the oven-dry weight of the animal tissue; The enzymatic hydrolysis temperature is 50~55℃; the enzymatic hydrolysis pH value is 7.0~7.5; and the enzymatic hydrolysis time is 4~5 hours. Collagen peptides with a molecular weight of 300-1000 Da were isolated from the enzymatic hydrolysate; The collagen peptides with a molecular weight of 300-1000 Da were purified using a CM-Sepharose FF weak cation exchange column. The elution program was as follows: rinsing with phosphate buffer for 20-40 min; followed by gradient elution with phosphate buffer containing NaCl for 25-35 min, with the NaCl concentration in the phosphate buffer gradually increased from 0.1 mol / L to 1.0 mol / L, and the elution flow rate was 0.5 mL / min to 500 mL / min. Collect the fraction retained for 10-20 minutes to obtain purified collagen peptides.

2. The preparation method according to claim 1, characterized in that, The enzymatic hydrolysis is accompanied by stirring; the stirring speed is 150~300 rpm.

3. The preparation method according to claim 1, characterized in that, The pretreatment method for the animal tissue includes at least one of the following: defatting and deodorization, heat treatment, and pulping; The method for degreasing and deodorizing involves treating animal tissues under acidic or alkaline conditions in conjunction with an oxidizing agent. The oxidant is a chlorine dioxide preparation with a working volume concentration of 0.6% to 1.0%, or hydrogen peroxide with a working volume concentration of 0.1% to 0.5%, or ozone with a working volume concentration of 0.1% to 0.15 ppm. The acids include organic acids and inorganic acids; the organic acids include citric acid monohydrate or malic acid with a working mass concentration of 0.9% to 1.5%; the inorganic acids include hydrochloric acid with a working volume concentration of 0.1% to 0.3% and sodium hydroxide with a working mass concentration of 0.1% to 0.3%. The heat treatment temperature is 55~100℃; the heat treatment time is 30~90min; The pulping process includes at least one of the following: rotational shearing, emulsification, homogenization, and blending.

4. The preparation method according to claim 1, characterized in that, A method for separating collagen peptides with a molecular weight of 300-1000 Da from the enzymatic hydrolysate includes solid-liquid separation of the enzymatic hydrolysate, collection of the liquid phase, filtration through a 1000 Da ultrafiltration membrane, collection of the filtrate, filtration through a 300 Da ultrafiltration membrane, and collection of the filtrate.

Images