Cutin regulating composition containing mandelic acid and having skin smoothing and brightening effects and application thereof

Abstract

The invention belongs to the technical field of daily-use chemistry, and particularly relates to a keratin regulating composition containing mandelic acid and having skin smoothing and brightening effects and application of the keratin regulating composition. The composition provided by the invention comprises mandelic acid, lactobionic acid, hydroxyethyl piperazine ethanesulfonic acid, lactobacillus / soybean milk fermentation product filtrate and lactobacillus fermentation lysate. According to the application, mandelic acid, lactobionic acid, hydroxyethyl piperazine ethanesulfonic acid, lactobacillus / soybean milk fermentation product filtrate and lactobacillus fermentation lysate are compounded, so that the activity of KLK family proteases, especially kallikrein 5 (KLK5), can be obviously promoted, the decomposition of desmosome between keratinocytes is promoted, epidermal cells lose cohesion and finally naturally fall off, and the effect of promoting the activity of KLK family proteases is achieved. The cutin exfoliation promoting effect is achieved, so that the problems of skin darkness, roughness, pore blockage, acne and the like are solved, the glossiness and fineness of the skin are improved, and healthy and bright skin is achieved.

Description

[0001] This application claims priority to Chinese Patent Application No. 202510345072.8, filed on March 24, 2025, entitled "A Keratin-Regulating Composition Containing Mandelic Acid and Having the Effect of Refining and Brightening Skin and Its Application", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the field of daily chemical technology, and in particular to a keratin-regulating composition containing mandelic acid that has the effect of refining and brightening the skin, and its application. Background Technology

[0003] As the largest organ in the human body, the skin's epidermal cells typically renew every 28 days. This cycle encompasses the division of basal cells, the migration and differentiation of keratinocytes, and the eventual shedding of stratum corneum cells. The stratum corneum is mainly composed of highly differentiated keratinocytes, an extracellular keratinized capsule, and keratin fibers, interconnected by keratin granules. The human epidermis (SC) consists of 15-20 layers of cells formed in the basal layer of the epidermis. These cells are gradually pushed to the outermost layer of the skin, where they shed to maintain epidermal homeostasis. Normal metabolic shedding of the stratum corneum depends on specific proteases, such as serine proteases (kallikrein 5 (KLK5)) and cathepsins, which gradually break down desmosomes between keratinocytes, causing the epidermal cells to lose cohesion and eventually shed naturally as tiny flakes. However, this process is disrupted with age. Studies have found that the rate of stratum corneum renewal gradually decreases after age 20 (Journal of Gerontology, 1983, 38(2), 137-142). When the stratum corneum metabolism is abnormal, the accumulation of dead skin cells will lead to problems such as dullness, roughness, clogged pores, and acne.

[0004] Currently, common keratinocyte regeneration active ingredients mainly function through the following four mechanisms: 1. Maintaining the acidic environment of the stratum corneum, providing suitable enzymatic conditions for serine proteases; 2. Increasing the activity of KLK family proteases, promoting keratinocyte exfoliation; 3. Chelating calcium ions in the stratum corneum, altering the calcium ion concentration in keratinocytes, and inducing keratinocyte dissociation; 4. Directly acting on the desmosome structure, accelerating its decomposition. Among these, the use of α-hydroxy acids (AHAs, such as glycolic acid) or β-hydroxy acids (BHAs, such as salicylic acid) is a typical and widely used method of chemical exfoliation. For example, using 3%–6% glycolic acid (pH 3.5–4.5) or 1%–2% salicylic acid (pH 3.5–4.5) can chelate calcium ions in the stratum corneum, thereby reducing the calcium ion concentration (calcium ions are a key factor in maintaining desmosome stability), loosening the desmosome structure, and promoting the shedding of old and dead keratinocytes. However, the currently disclosed acid components do not show significant effects on promoting the activity of KLK family proteases, especially KLK5. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a keratin regulation composition containing mandelic acid and having the effect of refining and brightening the skin, and its application. The composition provided in this application has a significant promoting effect on KLK family proteases, especially KLK5, thereby promoting the renewal of epidermal cells and improving the luster and smoothness of the skin.

[0006] This application provides a keratin-regulating composition containing mandelic acid and having the effect of refining and brightening the skin, comprising: mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactobacillus fermentation lysate.

[0007] This application combines mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate, and lactic acid bacteria fermentation lysate, which can significantly promote the activity of KLK family proteases, especially kallikrein 5 (KLK5), promote the decomposition of desmosomes between keratinocytes, cause epidermal cells to lose cohesion, and eventually fall off naturally, thereby promoting the exfoliation of keratinocytes. This solves problems such as dull skin, roughness, clogged pores, and acne, improves the skin's radiance and smoothness, and achieves healthy and radiant skin.

[0008] Mandelic acid, also known as bitter mandelic acid or mandelic acid, has the following structural formula: ; Mandelic acid is a fat-soluble α-hydroxy acid, belonging to a relatively mild fruit acid, and has the following effects: Skin whitening: Mandelic acid can inhibit tyrosinase activity and reduce melanin production; Improves skin texture: Mandelic acid can promote the renewal of the stratum corneum, making the skin smooth and delicate; Antibacterial and anti-inflammatory: Mandelic acid can inhibit bacteria that cause skin inflammation and improve skin inflammation problems; Moisturizing: Mandelic acid can help the skin retain moisture and enhance its moisturizing ability.

[0009] This application does not impose any special restrictions on the mandelic acid, but preferably on the di-configuration DL-mandelic acid, which is a commercially available product.

[0010] Lactobionic acid, with the molecular formula C 12 H 22 O 12 The structural formula is as follows: ; Lactobionic acid is a polyhydroxy acid, belonging to the relatively mild fruit acid category, and possesses multiple benefits such as moisturizing, repairing, anti-aging, and antioxidant properties. This application does not impose any specific restrictions on the lactobionic acid used; commercially available products are acceptable.

[0011] Mandelic acid and lactobionic acid are both relatively mild fruit acids. Under acidic conditions, they mainly promote exfoliation by competitively binding calcium ions to cadherin on desmosomes, thereby reducing the connectivity of desmosomes. However, the applicant found that when combined with hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate, and Lactobacillus fermentation lysate, mandelic acid and lactobionic acid can exert their exfoliating effect by promoting the activity of KLK5 protease, even at a relatively high pH close to neutral.

[0012] Hydroxyethylpiperazine ethanesulfonic acid, with the molecular formula C8H 18 N₂O₄S, structural formula as follows: ; Hydroxyethylpiperazine ethane sulfonic acid has the following effects: Softening skin keratin: Hydroxyethylpiperazine ethane sulfonic acid has the effect of loosening keratin and can help remove dead skin cells from the skin surface; Regulating skin pH: Hydroxyethylpiperazine ethane sulfonic acid can maintain a relatively stable weakly acidic range for a long time, which can help adjust the skin pH and keep the skin surface pH in a more suitable state to help improve skin condition; Sunscreen and whitening: Hydroxyethylpiperazine ethanesulfonic acid can block ultraviolet rays and reduce the stimulation of pigment cells by ultraviolet rays, thereby reducing the formation of melanin in the skin.

[0013] In this application, hydroxyethylpiperazine ethanesulfonic acid, when combined with mandelic acid, lactobionic acid, Lactobacillus / soybean fermentation product filtrate, and lactic acid bacteria fermentation lysate, acts as a zwitterionic buffer. By regulating the cell membrane surface charge, it enhances the delivery efficiency of mandelic acid and lactobionic acid to the deep epidermis, while simultaneously optimizing the KLK5 protease activity environment, thereby promoting KLK5 protease activity. This application does not impose any specific limitations on the hydroxyethylpiperazine ethanesulfonic acid used; commercially available products are acceptable.

[0014] Lactobacillus / soy milk fermentation product filtrate, also known as LACTOBACILLUS / SOYMILK FERMENTFILTRATE, is a filtrate of black soybean milk obtained through fermentation using various lactobacilli. It possesses protective, soothing, moisturizing, repairing, and whitening effects. This application does not impose any specific limitations on the described Lactobacillus / soy milk fermentation product filtrate; commercially available products are acceptable, such as the commercially available product with the brand name OPTIMEAL 10W.

[0015] Lactococcus ferment lysate, or lactic acid bacteria fermentation lysate, is a complex obtained from cell lysis during lactic acid bacteria fermentation. It is rich in amino acids, small peptides, polysaccharides, and B vitamins, and has various health benefits. Promotes skin cell renewal: Lactic acid bacteria fermentation lysates can enhance the skin's metabolic function and maintain a youthful appearance.

[0016] Strengthen the skin barrier: Lactic acid bacteria fermentation lysates reduce skin damage from external environmental factors such as ultraviolet rays and pollution.

[0017] Antioxidant: Lactic acid bacteria fermentation lysates can resist free radical damage and slow down the skin aging process.

[0018] Soothes skin: Lactic acid bacteria fermentation lysate helps relieve skin allergies and inflammation.

[0019] This application does not impose any special restrictions on the lactic acid bacteria fermentation lysate; any commercially available product is acceptable, such as the commercially available product with the brand name ProRenew Complex CLR™ NP.

[0020] In this application, the Lactobacillus / soy milk fermentation product filtrate and Lactobacillus fermentation lysate, through their rich post-biotic components, such as cytoplasmic contents, small peptides, polysaccharides, and amino acids, form a synergistic network with mandelic acid, lactobionic acid, and hydroxyethylpiperazine ethanesulfonic acid, thereby efficiently regulating KLK5 protease activity from multiple dimensions.

[0021] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactobacillus / soy milk fermentation product filtrate, and lactobacillus fermentation lysate is 1~10:1~10:1~20:0.1~20:1~20.

[0022] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactobacillus / soy milk fermentation product filtrate, and lactobacillus fermentation lysate is 1~3:1~3:10~18:1~10:1~10.

[0023] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactobacillus / soy milk fermentation product filtrate, and lactobacillus fermentation lysate is 1~3:1~2:12~17:1~2:1~2.

[0024] In some specific implementations, the mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate, and lactic acid bacteria fermentation lysate is: 2:1.1:15:1:1.1, 3:3:18:1.1:1, 2:1.1:15:1.1:10, 1:1.1:10:1.1:1, or 2:1.1:10:1.1:10.

[0025] The keratinization regulating composition provided in this application can promote the activity of kallikrein 5 (KLK5), thereby promoting exfoliation, improving skin luster and smoothness, and achieving the effect of smoothing and brightening the skin. Experimental results show that compared with the combination of mandelic acid and lactobionic acid, the combination of mandelic acid, lactobionic acid and lactic acid bacteria fermentation lysate actually reduced the expression level of KLK5 protease mRNA. The combination of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactic acid bacteria fermentation lysate further greatly increased the expression level of KLK5 protease mRNA. Therefore, it can be considered that the addition of hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactic acid bacteria fermentation lysate significantly enhances the function of mandelic acid and lactobionic acid in promoting KLK5 protease activity.

[0026] The composition provided in this application can significantly upregulate the expression of filaggrin genes. As a key component of the skin barrier, the increased expression of filaggrin directly promotes the synthesis of natural moisturizing factors and related intercellular lipids, thereby effectively repairing and strengthening the skin's physical barrier, and thus alleviating problems such as skin sensitivity and peeling. Therefore, this application provides the use of the above composition in the preparation of repair and / or moisturizing products.

[0027] The present invention also provides a product comprising: the composition described in the above technical solution.

[0028] In some embodiments of the present invention, the above-mentioned products include, but are not limited to, personal care products, pharmaceuticals, etc. Those skilled in the art will understand that, in addition to the compositions described in the above technical solutions, other excipients are also included, such as pharmaceutical excipients or excipients for personal care products.

[0029] In some embodiments of the present invention, the personal care products include: basic care products and / or makeup products.

[0030] In some embodiments of the present invention, the cosmetic products include, but are not limited to: (1) Base makeup: Foundation / cream: Used to even out skin tone and cover blemishes; BB cream / CC cream: A lightweight base makeup product that combines skincare and makeup application; Concealer / pen: Used to cover up specific areas such as pimples and dark circles; Loose powder / setting powder: Sets makeup and reduces facial shine.

[0031] (2) Eye makeup: Eyeshadow: Adds color and dimension to the eyes; Eyeliner pencil / liquid / gel: Used to draw lines on the eyes, making them look more vibrant; Mascara: Lengthens and thickens eyelashes, enhancing the depth of the eyes; Eyebrow pencil / powder / gel: Fill in gaps in eyebrows and create the ideal eyebrow shape.

[0032] (3) Cheek makeup: Blush: Adds natural color to the cheeks and improves complexion; Contouring powder / stick: Use shading techniques to make facial contours more three-dimensional; (4) Lip makeup: Lipstick / lip gloss / lip tint: to change or emphasize the color of the lips; Lip liner: Defines the clear outline of the lips and prevents lipstick from bleeding.

[0033] (5) Multifunctional cosmetics: Highlighter sticks / liquids / powders: Highlight high points on the face (such as the bridge of the nose and cheekbones) to create a luminous effect.

[0034] In addition, there are products designed specifically for special occasions, such as waterproof and sweatproof eyeliners and long-lasting, non-fading lipsticks.

[0035] In some embodiments of the present invention, the basic care products include, but are not limited to: Facial cleanser: Gently removes dirt, oil, and makeup residue from the face; Cleansing oil / cleansing water / cleansing balm: specially designed to thoroughly remove makeup, especially waterproof cosmetics; Toner / lotion: Used after cleansing, it can further cleanse the skin's surface of residue, while replenishing the skin's moisture, restoring the skin's pH balance, and laying a good foundation for the absorption of subsequent skin care products; Serum: Contains a high concentration of active ingredients, providing deep nourishment and repair for specific skin problems (such as anti-aging, moisturizing, whitening, etc.); Eye cream: Specially designed for the sensitive area around the eyes, it has the effects of reducing fine lines and dark circles and firming the skin around the eyes. The texture is usually light and easily absorbed. Day / night lotion or cream: It has functions such as protection, repair and nourishment, and promotes cell regeneration. It can provide the skin with the necessary moisture and lock in the replenished moisture. Sunscreen: Used for ultraviolet protection and prevention of photoaging, etc. Face masks: provide extra nourishment and care for the skin, such as hydration, pore cleansing, or brightening of the complexion.

[0036] In some specific implementations, the personal care product is an essence water, which includes 0.1wt% to 5wt% of the composition described in the above technical solution, preferably 0.5wt% to 4wt% of the composition described in the above technical solution, more preferably 1wt% to 3wt% of the composition described in the above technical solution, and most preferably 1.1wt% to 2.5wt%.

[0037] In some specific implementations, the essence water also includes: 0.1wt%~1wt% of disodium EDTA; 1wt%~5wt% propylene glycol; Sodium hyaluronate, 0.01wt%~0.5wt%; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizate; 0.01wt%~1wt% acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% of 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~1wt% aqueous solution of aminomethylmethanol; The remaining water.

[0038] In some specific implementations, the essence water includes: 0.1wt%~1wt% of disodium EDTA; 1wt%~5wt% propylene glycol; Sodium hyaluronate, 0.01wt%~0.5wt%; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizate; 0.01wt%~1wt% acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% of 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~5wt% of the composition described in the above technical solution; 0.1wt%~1wt% aqueous solution of aminomethylmethanol; The remaining water.

[0039] In some specific implementations, the essence water includes: 0.5wt% disodium EDTA; 2wt% propylene glycol; 0.1wt% sodium hyaluronate; 0.5wt% panthenol; 0.1 wt% dipotassium glycyrrhizate; 0.1wt% acetylated sodium hyaluronate; 6 wt% butanediol; 0.2 wt% p-hydroxyacetophenone; 1 wt% of 1,2-hexanediol; 1 wt% of 1,2-pentanediol; 2.02% of the composition described in the above technical solution; 0.4 wt% aqueous solution of aminomethylmethanol; The remaining water.

[0040] After 14 and 28 days of use, the essence water provided in this application showed significant improvement in skin radiance and roughness. Furthermore, the improvement in skin radiance and roughness gradually increased with the duration of use. This indicates that the essence water provided in this application has the effect of brightening and refining the skin, thus proving that the composition of this invention can enhance skin radiance and smoothness.

[0041] This application combines mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate, and lactic acid bacteria fermentation lysate, which can significantly promote the activity of KLK family proteases, especially kallikrein 5 (KLK5), promote the decomposition of desmosomes between keratinocytes, cause epidermal cells to lose cohesion, and eventually fall off naturally, thereby promoting the exfoliation of keratinocytes. This solves problems such as dull skin, roughness, clogged pores, and acne, improves the skin's radiance and smoothness, and achieves healthy and radiant skin. Attached Figure Description

[0042] Figure 1 A bar chart showing how the composition in Test Example 1 promoted KLK5 gene expression; Figure 2 A bar chart showing how the composition in Test Example 4 promoted KLK5 gene expression; Figure 3 A bar chart showing how the composition promotes filaggrin gene expression. Detailed Implementation

[0043] This invention provides a keratin-regulating composition containing mandelic acid that has skin-refining and brightening effects, and its application. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0044] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0045] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0046] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0047] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0048] This application provides a keratin-regulating composition containing mandelic acid and having the effect of refining and brightening the skin, comprising: mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactobacillus fermentation lysate.

[0049] The keratinization regulating composition provided in this application can promote the activity of kallikrein 5 (KLK5), thereby promoting exfoliation, improving skin luster and smoothness, and achieving the effect of smoothing and brightening the skin. Experimental results show that compared with the combination of mandelic acid and lactobionic acid, the combination of mandelic acid, lactobionic acid and lactic acid bacteria fermentation lysate actually reduced the expression level of KLK5 protease mRNA. The combination of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactic acid bacteria fermentation lysate further greatly increased the expression level of KLK5 protease mRNA. Therefore, it can be considered that the addition of hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactic acid bacteria fermentation lysate significantly enhances the function of mandelic acid and lactobionic acid in promoting KLK5 protease activity.

[0050] The following examples further illustrate the compositions provided in this application and their applications.

[0051] Comparative Example 1 Mandelic acid and lactobionic acid were mixed in a mass ratio of 2:1.1 to obtain a colorless, water-soluble composition.

[0052] Comparative Example 2 Mandelic acid, lactobionic acid, and lactic acid bacteria fermentation lysate were mixed in a mass ratio of 2:1.1:8 to obtain a colorless, water-soluble composition.

[0053] Comparative Example 3 Mandelic acid, lactobionic acid, and hydroxyethylpiperazine ethanesulfonic acid were mixed in a ratio of 2:1.1:15 to obtain a colorless, water-soluble composition.

[0054] Comparative Example 4 The lactic acid bacteria fermentation lysate and the lactic acid bacteria / soy milk fermentation product filtrate solution were mixed at a mass ratio of 1.1:1 to obtain a colorless, water-soluble composition.

[0055] Comparative Example 5 Hydroxyethylpiperazine ethane sulfonic acid and Lactobacillus / soy milk fermentation product filtrate solution were mixed at a mass ratio of 15:1 to obtain a colorless, water-soluble composition.

[0056] Example 1

[0057] Mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, lactic acid bacteria fermentation lysate and lactic acid bacteria / soy milk fermentation product filtrate solution were mixed in a mass ratio of 2:1.1:15:1.1:1 to obtain a colorless, water-soluble composition.

[0058] Example 2

[0059] The composition was obtained by mixing mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, lactic acid bacteria fermentation lysate and lactic acid bacteria / soy milk fermentation product filtrate solution in a mass ratio of 3:3:18:1.1:1.

[0060] Example 3

[0061] Mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, lactic acid bacteria fermentation lysate and lactic acid bacteria / soy milk fermentation product filtrate solution were mixed in a mass ratio of 2:1.1:15:1.1:10 to obtain a colorless, water-soluble composition.

[0062] Example 4

[0063] Mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactic acid bacteria fermentation lysate and lactic acid bacteria / soy milk fermentation product filtrate solution were mixed in a mass ratio of 1:1.1:10:1.1:1 to obtain a colorless, water-soluble composition.

[0064] Example 5

[0065] Mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactic acid bacteria fermentation lysate and lactic acid bacteria / soy milk fermentation product filtrate solution were mixed in a mass ratio of 2:1.1:10:1.1:10 to obtain a colorless, water-soluble composition.

[0066] Test Example 1 I. Experimental Materials 1. Cells and reagents Human keratinocyte line (HaCaT); DMEM medium (Gibco); Standard fetal bovine serum (Gibco); Lactobionic acid; Mandelic acid; Hydroxyethylpiperazine ethanesulfonic acid; Lactobacillus / soy milk fermentation product filtrate (OPTIMEAL 10W); Lactic acid bacteria fermentation lysate (ProRenew Complex CLR™NP); 0.25% pancreatic enzyme (Gibco); Sterile PBS (pH=7.4, Gibco); GPCR-specific premixed reagent (SYBR Green Master Mix, Thermo Fisher Scientific Inc.); Primer synthesis (BioTNT); Deprolactin-free (DEPC) water (Ya-enzyme); RNAiso plus (Total RNA Extraction Reagent) (Thermo Fisher Scientific Inc.) Anhydrous ethanol, dimethyl sulfoxide, chloroform, isopropanol, etc.

[0067] 2. Equipment: CO2 cell incubator (Haier Medical); Clean bench (Haier Medical); Low-speed centrifuge (Beckman); High-speed low-temperature centrifuge (Beckman); Bio-Rad CFX OPUS 384 high-throughput real-time fluorescence quantitative PCR instrument (Bio-Rad).

[0068] II. Experimental Methods (a) Cell culture 1. Culture medium and culture conditions Human keratinocytes were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin and antibiotics in 6-well plates, and then placed in a cell incubator at 37°C and 5% CO2. 2. Recovery of keratinocytes Remove the cryovials from the liquid nitrogen tank and quickly place them in a 37°C water bath to thaw them rapidly. Centrifuge at 300g for 5 minutes. Carefully aspirate the supernatant with a sterile dropper. Add an appropriate amount of DMEM medium to the precipitate, mix well, dilute, and transfer to a 6-well plate for culture. 3. Medium change and passage of keratinocytes HaCaT cells were cultured in DMEM medium, with medium changes 3-4 times per week. When the cells reached approximately 80% confluence, they were digested with 0.25% trypsin, and digestion was stopped with medium containing 10% serum. After gentle pipetting, the cell suspension was collected, centrifuged, the supernatant was discarded, and the cells were resuspended in an appropriate amount of DMEM medium. The cells were then passaged in 1:3 ratios. 4. Collection and cryopreservation of keratinocytes Human keratinocytes in the logarithmic growth phase were selected, digested with 0.25% pancreatic acid, and then added to DMEM medium to prepare a cell suspension. After centrifugation, the supernatant was discarded, and an appropriate amount of cryopreservation solution (DMEM medium + serum + dimethyl sulfadiazine) was added. After mixing, the cells were transferred to cryovials and stored at 4°C for 1 hour, then at -20°C for 2 hours, and finally at -80°C for short-term storage. Cells for long-term storage were stored in liquid nitrogen.

[0069] (II) RT-PCR method to detect the effect of the composition on KLK5 mRNA expression in keratinocytes 1. Extraction of total RNA from keratinocytes When the cells reach 80%-90% confluence, they are routinely digested to obtain cells with a density of 50×10⁶. 4 Cell suspensions were dropped into 6-well plates, 2 ml / well. After culturing for 24 h, combinations of Comparative Example 1 (final concentrations of mandelic acid and lactobionic acid were 0.2 wt% and 0.11 wt%, respectively), Comparative Example 2 (final concentrations of mandelic acid, lactobionic acid, and lactic acid bacteria fermentation lysate were 0.2 wt%, 0.11 wt%, and 0.8 wt%, respectively), and Example 1 (final concentrations of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, lactic acid bacteria fermentation lysate, and lactobacillus / soybean milk fermentation filtrate solution were 0.2 wt%, 0.11 wt%, 1.5 wt%, 0.11 wt%, and 0.1 wt%, respectively) were added, and a negative control group (without drugs) was set up. Cells were cultured for another 24 h, with 12 replicates per group. After another 24 h of culture, total RNA was extracted from keratinocytes using RNAiso plus (Total RNA extraction reagent). The culture medium in the 6-well plates was discarded, and the cells were washed once with PBS. per 10cm 2Add 1 ml of RNAiso Plus, incubate horizontally for 5-10 minutes, and repeatedly pipette the cells to detach the adherent cells from the wells. Transfer the RNAiso Plus lysis buffer containing cells to a sterile centrifuge tube, mix thoroughly by pipetting, incubate at room temperature for 5 minutes, and centrifuge at 12000g, 4℃ for 5 minutes. Then add 200 μl of chloroform (approximately 1 / 5 the volume of RNAiso Plus) to the homogenate lysis buffer, vortex vigorously for 15 seconds, and wait until the solution shows no phase separation (i.e., fully emulsified). Incubate at room temperature for 5 minutes, and centrifuge at 12000g, 4℃ for 15 minutes. At this point, the liquid in the tube will separate into three layers: a colorless supernatant on top, a white protein intermediate layer, and a colored organic layer at the bottom. Carefully aspirate the supernatant (approximately 400-500 μl) into a new sterile centrifuge tube (do not aspirate the white intermediate layer). Then, add an equal volume (approximately 400-500 μl) of isopropanol to the supernatant, mix thoroughly, and incubate at 15-30°C for 10 min. Centrifuge at 12000g, 4°C for 10 min, carefully discard the supernatant, slowly add 1 ml of 75% ethanol, centrifuge at 12000g, 4°C for 5 min, and discard the ethanol. Dry the precipitate in the tube at room temperature for 5 min, then add an appropriate amount of RRNA-free water (approximately 20 μl), gently pipette until the RNA precipitate is completely dissolved, transfer 2 μl to an EP tube, check the concentration and purity of the extracted RNA, and store the remainder at -20°C or -70°C.

[0070] 2. Primer sequences KLK5 primer sequences: upstream AGATGTTCCAGGGGGTCAAA; downstream TTGATGAGCATGAGGTCGTTAGA; ACTB (internal reference) primer sequences: upstream AAGGTGACAGCAGTCGGTT; downstream TGTGTGGACTTGGGAGAGG.

[0071] 3. Real-time PCR quantitative reaction (I) Preliminary Preparations 1. Reagent preparation: Prepare SYBR Green Master Mix, primers (ACTB and KLK5 upstream and downstream primers), cDNA template, nuclease-free water (DEPC), etc. 2. Primer design: Specific primers were designed based on the ACTB and KLK5 gene sequences to ensure primer specificity and amplification efficiency. The primers are shown above. 3. Instrument warm-up: Turn on the Bio-Rad CFX OPUS 384 instrument in advance and warm it up to the appropriate temperature.

[0072] (II) Real-time PCR Quantitative Experiment Procedure 1. Prepare the reaction system: Prepare a 10 μL reaction system on ice, which usually includes 5 μL SYBR Green MasterMix, 0.5 μL each of forward and reverse primers (adjust the amount according to the primer concentration), 1 μL cDNA template, and 3 μL nuclease-free water; 2. Sample addition: Carefully add the prepared reaction solution to the corresponding wells of the 384-well plate, taking care to avoid generating air bubbles, and then seal the plate with a sealing film; 3. Place the sealed 384 well plate into the Bio-Rad CFX OPUS 384 instrument, ensuring the well plate is placed stably; 4. Program Setup: Set the real-time quantitative PCR reaction program in the instrument software, including pre-denaturation (95℃, 30s), denaturation (95℃, 5s), annealing (set according to primer Tm value, 60℃, 30s), and extension (72℃, 30s). The number of cycles is usually 40-45. Simultaneously set the fluorescence signal acquisition step, generally acquiring the fluorescence signal during the annealing or extension phase. 5. Run the experiment: After confirming that the program settings are correct, click the Run button to start the real-time quantitative PCR experiment; 6. Data Analysis: After the experiment, the data were analyzed using the software accompanying the Bio-Rad CFX OPUS 384 instrument. First, the amplification and melting curves were examined to ensure good amplification specificity. Then, based on the Ct values ​​of the internal reference gene ACTB and the target gene KLK5, the relative expression level of the KLK5 gene was calculated using the relative quantification method (2^(-ΔΔCt) method). Results are expressed as mean X. One-way ANOVA was used for comparisons between groups, with P < 0.05 considered statistically significant.

[0073] (III) Data Results See Table 1 and Figure 1 Table 1 is a summary table of KLK5 protease mRNA expression levels. Figure 1 Bar chart showing the effect of the composition on promoting KLK5 gene expression.

[0074] Table 1 Summary of KLK5 protease mRNA expression levels

[0075] Note: The t-test was used for comparisons between groups, and all statistical analyses were two-tailed. A p-value < 0.05 was considered significant; the smaller the p-value, the more significant the difference. Compared to the control group, significant differences are indicated by * (p < 0.05) and ** (p < 0.01). Compared to comparative example 1 and comparative example 2, significant differences are indicated by # (# p < 0.05) and ## p < 0.01.

[0076] Conclusion: See Table 1 and Figure 1 It can be seen that the compositions of Comparative Example 1, Comparative Example 2, and Example 1 all help promote the expression of the KLK5 protease gene, with increases of 65.6%, 44.8%, and 118.2%, respectively, and Example 1 showed the best promoting effect. As shown in Table 1, compared with Comparative Example 2, the composition provided in Example 1 actually has a significant effect on promoting KLK5 protease activity through synergistic action, which is 1.8 times that of the composition of Comparative Example 1 and 2.6 times that of the composition of Comparative Example 2. Based on this, it can be seen that the composition provided in this application can effectively promote the activity of KLK5, a protease that specifically hydrolyzes desmosomes in the skin, that is, by restoring the skin's own enzymatic reaction, it helps to enhance the skin's own skin rejuvenation ability, thereby helping to improve the skin's radiance and smoothness.

[0077] Test Example 2: Experiment on the efficacy of improving skin radiance and roughness in humans The compositions provided in Comparative Example 2 and Example 1 were formulated into essence water according to the formulations shown in Table 2, and human efficacy tests were conducted.

[0078] Table 2 Essence Water Formula

[0079] 1. Test Plan: Thirty-two subjects, aged 32.78 ± 5.66 years, with uneven skin tone, dullness, and roughness, were tested. The test product was randomly applied to the left and right sides of the face every morning and evening for 28 days. Skin luster was measured at different time points using non-invasive instruments. Facial images were acquired using VC20 and the average skin roughness R3 was analyzed. The red area of ​​the skin was also analyzed using VISIA-CR facial images.

[0080] 2. Test parameters and instruments Specific testing protocol for skin radiance indicators: Instrument: Courage+Khazaka, GL 200 skin radiance testing probe; Parameter: Skin radiance; Test sites: Both cheeks (according to a random table); Test method: Measure 3 times and take the average value; Test time points: before product use (D0), 14 days after sample use (D14), and 28 days after sample use (D28). VC20 Indicator Roughness Imaging Test Procedure: Instrument: VC-20plus Skin Surface Texture Testing System; Parameter: Average skin roughness R3; Test sites: Both cheeks (according to a random table); Test method: Take one photo; Test time points: before using the product (D0), 14 days after using the product (D14), and 28 days after using the product (D28). VISIA-CR facial image acquisition skin red area test protocol: Instrument: VISIA-CR Skin Red Area Measurement System; Parameter: Area of ​​the red zone on the skin; Test sites: Both cheeks (according to a random table); Test method: Take one photo; Test time points: before using the product (D0) and 28 days after using the product (D28).

[0081] 3. Data Statistics: 1) Descriptive statistics Calculate the mean, standard deviation, minimum, maximum and median of each parameter for the test product group at each time point, and calculate the difference between the test product group before using the product (D0) and after using the product (D14, D28). 2) Normality test The above differences were tested for normality using the Shapiro-Wilk Test method in SPSS software. If the asymptotic statistical significance (two-tailed) value of the normality test is p>0.05, then the data series follows a normal distribution. 3) Evaluation criteria: Instrument parameter evaluation; a) Before-and-after comparison of product 6 in test group and product 6 in test group example: If the statistical significance level p < 0.05, it indicates that there is a statistically significant difference between the test group comparison sample 6 and the test group example 6 before and after use; if the statistical significance level p ≥ 0.05, it indicates that there is no statistically significant difference between the test group comparison sample 6 and the test group example 6 before and after use.

[0082] 4. The test results are shown in Table 3: Table 3 Summary of 28-day skin test results

[0083] As shown in Table 3, after 14 and 28 days of use, the essence water provided by Comparative Example 6 and Example 6 showed significant improvements in skin radiance and roughness. Furthermore, in terms of the rate of change, Example 6 demonstrated a greater degree of improvement compared to Comparative Example 6, and the improvement in skin radiance and roughness gradually increased with prolonged use. Secondly, Table 3 also revealed that after 28 days of continuous use containing products from Comparative Example 6 and Example 6, the area of ​​skin redness did not increase compared to before use, and statistical analysis showed no significant difference. This demonstrates that the irritation level did not increase after 28 days of continuous use of either product. Therefore, the essence water provided by Example 6 has the effect of brightening and refining the skin without causing irritation, proving that the composition of the present invention can improve skin radiance and refinement.

[0084] Test Example 3: Human Experiment on Improving Skin Radiance, Roughness, and Moisturizing Effects The essence water prepared in Comparative Example 6 and Example 6 was used to conduct experimental tests on its effects on improving skin radiance, roughness, and moisturizing in humans.

[0085] 3.1 Test Plan: The test included 32 participants aged 32.78 ± 5.66 years who had uneven, dull, and rough facial skin. The participants used the test product on the left and right sides of their faces randomly every morning and evening for 28 days. The moisture content of the stratum corneum was measured at different time points using non-invasive instruments.

[0086] 3.2 Test Indicators and Instruments Specific test procedure for stratum corneum moisture content: Instrument: CM825 skin moisture test probe; Parameter: Stratum corneum moisture content (moisturizing); Test sites: Both cheeks (according to a random table); Test method: Measure 3 times and take the average value; Test time points: before product use (D0), immediately after applying the wet compress for 8 minutes, 7 days after using the sample (D7), 14 days after using the sample (D14), and 28 days after using the sample (D28). 3.3 Data Statistics: 1) Descriptive statistics Calculate the mean, standard deviation, minimum, maximum and median of each parameter for the test product group at each time point, and calculate the difference between the test product group before (D0) and after (D14, D28) using the product.

[0087] 2) Normality test The above differences were tested for normality using the Shapiro-Wilk Test method in SPSS software. If the asymptotic statistical significance (two-tailed) value of the normality test is p>0.05, then the data series follows a normal distribution.

[0088] 3) Evaluation criteria: Instrument parameter evaluation; a) Before-and-after comparison of product 6 in test group and product 6 in test group example: If the statistical significance level p < 0.05, it indicates that there is a statistically significant difference between the test group comparison sample 6 and the test group example 6 before and after use; if the statistical significance level p ≥ 0.05, it indicates that there is no statistically significant difference between the test group comparison sample 6 and the test group example 6 before and after use.

[0089] 3.4 The test results are shown in Table 4.

[0090] Table 4 Test Results of Test Example 3

[0091] As shown in Table 4, the essence water provided in Comparative Example 6 and Example 6 has both immediate and long-lasting moisturizing effects. After 8 minutes, 7 days, 14 days, and 28 days of wet compress application, the moisture content of the stratum corneum of the skin significantly increased, indicating enhanced moisturizing power. Moreover, in terms of the rate of change, Example 6 showed a greater degree of improvement compared to Comparative Example 6. This demonstrates that the essence water provided in Example 6 has a stronger moisturizing effect, proving that the composition of the present invention can improve skin moisturizing power.

[0092] Test Example 4 The experimental method is as follows: 4.1 Cell Culture Human keratinocytes (Hacat, passage 16) were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. Cells were harvested from the monolayer culture and seeded into 12-well plates at 1.5 × 10⁶ cells per well. 5 Cells were cultured for 6 hours until they adhered to the culture vessel, then pretreated with serum-free medium for 18 hours.

[0093] 4.2 Administration The test groups were determined according to the test protocol shown in Table 5. When the cell deposition rate in the 12-well plates reached 30%–50%, the drugs were administered to each group, with three replicates per group. 1 mL of culture medium was added to each well of the blank control and negative control groups, while 1 mL of culture medium containing the corresponding test sample was added to each well of the sample groups. Except for the blank group, all other groups underwent testosterone (TE) stimulation (simulating the pathological state of oily skin problems; in skin biology, testosterone can stimulate sebum secretion by binding to androgen receptors on sebaceous gland cells and affect the proliferation and differentiation of keratinocytes, thus participating in common oily skin problems such as keratinocyte metabolic disorders, follicular blockage, and acne formation). After drug administration, the 12-well plates were incubated in an incubator for 24 hours.

[0094] Table 5 Test Plan for Test Example 4

[0095] 4.3 RNA Extraction and qPCR 1) KLK5 gene extraction RNA extraction: Total RNA was extracted from each group of cells using the Tiangen Total RNA Extraction Kit, following the instructions. The concentration and purity of RNA were measured using a spectrophotometer to ensure that the OD260 / OD280 ratio was between 1.8 and 2.0.

[0096] Reverse transcription: Take 1 μg of total RNA and use TOYOBO's ReverTra Ace™ qPCR RT Master Mix for reverse transcription to synthesize cDNA.

[0097] Primer sequences are shown in Table 6: Table 6 Primer sequences extracted from the KLK5 gene

[0098] qPCR: Using cDNA as a template, qPCR reactions were performed on a real-time quantitative PCR instrument using SYBR™ Green Realtime PCR Master Mix. The reaction volume was 20 μL, including 10 μL SYBR™ Green Realtime PCR Master Mix, 0.8 μL upstream primer, 0.8 μL downstream primer, 2 μL cDNA template, and 6.4 μL ddH2O. The reaction conditions were: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds, 60℃ annealing for 30 seconds, for a total of 40 cycles. GAPDH was used as an internal reference gene, and the relative expression level of the KLK5 gene was calculated using the 2^-ΔΔCt^ method.

[0099] 2) Extraction of filaggrin genes RNA extraction: Total RNA was extracted from each group of cells using the Tiangen Total RNA Extraction Kit, following the instructions. The concentration and purity of RNA were measured using a spectrophotometer to ensure that the OD260 / OD280 ratio was between 1.8 and 2.0.

[0100] Reverse transcription: Take 1 μg of total RNA and use TOYOBO's ReverTra Ace™ qPCR RT MasterMix to perform reverse transcription to synthesize cDNA.

[0101] Primer sequences are shown in Table 7: Table 7 Primer sequences for filaggrin gene extraction

[0102] qPCR: Using cDNA as a template, qPCR reactions were performed on a real-time quantitative PCR instrument using SYBR™ Green Realtime PCR Master Mix. The reaction volume was 20 μL, including 10 μL SYBR™ Green Realtime PCR Master Mix, 0.8 μL upstream primer, 0.8 μL downstream primer, 2 μL cDNA template, and 6.4 μL ddH2O. The reaction conditions were: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds, 60℃ annealing for 30 seconds, for a total of 40 cycles. GAPDH was used as an internal control gene, and the relative expression level of the FLG gene was calculated using the 2^-ΔΔCt^ method.

[0103] 4.4 Calculation of Lift Rate

[0104] 4.5 Statistical Analysis of Results GraphPad Prism was used for plotting, and the results are expressed as Mean ± SD. One-way ANOVA was used for comparisons between groups. Significance compared to Example 1 group is indicated by *, p-value < 0.05 is indicated by *, p-value < 0.01 is indicated by **, and p-value < 0.001 is indicated by ***.

[0105] 4.6 Experimental Results: 1) Summary results of KLK5 mRNA expression See Table 8 and Figure 2 Table 8 is a summary table of the relative expression levels of KLK5 protease mRNA in test example 4. Figure 2 A bar chart showing how the composition in Test Example 4 promoted KLK5 gene expression.

[0106] Table 8 Summary of relative expression levels of KLK5 protease mRNA in Test Example 4

[0107] From Table 8 and Figure 2 It is understood that the composition provided in this application embodiment can significantly promote the expression of the KLK5 gene. That is, it can help enhance the skin's own skin rejuvenation ability by upregulating the expression of the KLK5 gene, that is, by restoring the skin's own enzymatic reaction, promoting the decomposition of desmosomes between keratinocytes, causing epidermal cells to lose cohesion and eventually fall off naturally, thereby achieving the effect of promoting keratin exfoliation, thereby solving problems such as dull skin, roughness, clogged pores and acne, and thus helping to improve the skin's radiance and smoothness.

[0108] In particular, the composition provided in Example 1, compared with Comparative Examples 3 and 4, showed the following synergistic effect according to the King's method: q=E A+B / (E A +E B -E A × E B ); The q-value is much greater than 1; therefore, the composition provided in Example 1 achieves a synergistic effect compared to the single agent. This confirms that the synergistic network between mandelic acid, lactobionic acid, HEPES, and the two fermentation products can more effectively promote stratum corneum renewal, achieving a gentle yet effective skin resurfacing effect.

[0109] 2) Summary results of filaggrin mRNA expression See Table 9 and Figure 3 Table 9 is a summary table of the relative expression levels of filaggrin mRNA. Figure 3A bar chart showing how the composition promotes filaggrin gene expression.

[0110] Table 9 Summary of relative expression levels of filaggrin mRNA

[0111] From Table 9 and Figure 3 It is understood that the composition provided in this application embodiment can significantly upregulate the expression of filaggrin gene. As a key component of the skin barrier, the increased expression of filaggrin directly promotes the synthesis of natural moisturizing factors and related intercellular lipids, thereby effectively repairing and strengthening the skin's physical barrier, and thus alleviating problems such as skin sensitivity and peeling.

[0112] In particular, the composition provided in Example 1, compared with Comparative Examples 3 and 4, showed the following synergistic effect according to the King's method: q=E A+B / (E A +E B -E A × E B ); The q-value is much greater than 1; therefore, the composition provided in Example 1 achieved a synergistic effect compared to the single agent. This confirms that the synergistic network between mandelic acid, lactobionic acid, HEPES, and the two fermentation products can more efficiently promote the expression of the barrier-associated protein filaggrin, thereby strengthening the skin barrier.

[0113] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A keratin-regulating composition containing mandelic acid and possessing skin-refining and brightening effects, characterized in that, include: Mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, Lactobacillus / soy milk fermentation product filtrate and lactic acid bacteria fermentation lysate; The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, lactobacillus / soy milk fermentation product filtrate and lactobacillus fermentation lysate is 1~10:1~10:1~20:0.1~20:1~20.

2. The keratinization composition according to claim 1, characterized in that, The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethane sulfonic acid, lactobacillus / soy milk fermentation product filtrate and lactobacillus fermentation lysate is 1~3:1~3:10~18:1~10:1~10.

3. The keratin-regulating composition according to claim 2, characterized in that, The mass ratio of mandelic acid, lactobionic acid, hydroxyethylpiperazine ethanesulfonic acid, Lactobacillus / soy milk fermentation product filtrate, and Lactobacillus fermentation lysate is 2:1.1:15:1:1.1, 3:3:18:1.1:1, 2:1.1:15:1.1:10, 1:1.1:10:1.1:1, or 2:1.1:10:1.1:

10.

4. Use of the keratin-regulating composition according to any one of claims 1 to 3 in the preparation of products that promote keratin exfoliation.

5. Use of the keratin-regulating composition according to any one of claims 1 to 3 in the preparation of repair and / or moisturizing products.

6. Use of the keratin-regulating composition according to any one of claims 1 to 3 in the preparation of a product having the effect of refining and brightening the skin.

7. The product, characterized in that, include: The keratin-regulating composition according to any one of claims 1 to 3.

8. The product as described in claim 7, characterized in that, It is a personal care product.

9. An essence water comprising 0.1wt% to 5wt% of the keratin-regulating composition as described in any one of claims 1 to 3.

10. The essence water according to claim 9, characterized in that, Also includes: 0.1wt%~1wt% of disodium EDTA; 1wt%~5wt% propylene glycol; Sodium hyaluronate, 0.01wt%~0.5wt%; 0.1wt%~1wt% panthenol; 0.01wt%~0.5wt% dipotassium glycyrrhizate; 0.01wt%~1wt% acetylated sodium hyaluronate; 1wt%~10wt% butanediol; 0.1wt%~1wt% of p-hydroxyacetophenone; 0.1wt%~5wt% of 1,2-hexanediol; 0.1wt%~5wt% of 1,2-pentanediol; 0.1wt%~1wt% aqueous solution of aminomethylmethanol; The remaining water.

Images